Preparation and application of dsRNA of plutella xylostella neuropeptide F genes NPF1 and NPF2

Abstract

The invention provides preparation and application of dsRNA (double-stranded ribonucleic acid) of plutella xylostella neuropeptide F genes NPF1 and NPF2. According to the method disclosed by the invention, the expression of the neuropeptide F genes NPF1 and NPF2 of the plutella xylostella can be inhibited through RNAi, so that the feeding and weight gain of the plutella xylostella are further inhibited, the growth and development of the plutella xylostella are influenced, the aim of controlling pests is achieved, extremely high specificity and high efficiency are achieved, and a new thought is provided for green pest control.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to the preparation and application of dsRNA of neuropeptide F genes NPF1 and NPF2 of diamondback moth. Background Art

[0002] The diamondback moth (Plutelaxylostela) belongs to the family Plutella xylostela in the order Lepidoptera of the phylum Arthropoda. It is a holometabolous insect that mainly harms cruciferous vegetables. Since the 1970s, it has caused large-scale outbreaks due to its wide distribution range, strong adaptability and rapid reproduction. The main measures for the prevention and control of diamondback moth are biological, chemical, physical and agricultural measures. At present, diamondback moth has developed varying degrees of resistance to pyrethroids, organophosphates, carbamates, organochlorines, benzoylureas, nereistoxins, insect growth regulators and microbial insecticides, which involve almost all the agents used for the prevention and control of diamondback moth. The situation of comprehensive control is very severe, and the research on control strategies based on new mechanisms of action has become particularly important. Neuropeptides and their receptors, which are widely distributed and highly conserved in insects, are involved in regulating many physiological behaviors and processes of insects, making neuropeptides and their receptors considered to be important potential biological targets for pest control. Studies have found that neuropeptide F (NPF) and its receptor (NPFR) are involved in regulating physiological functions such as feeding, reproduction, learning, and movement in many insects, but there are few studies on neuropeptide F and its receptor in Plutella xylostella.

[0003] Due to the specificity and high efficiency of RNAi in silencing target genes, it is widely used to analyze the gene function of Lepidoptera insects, laying the foundation for the growth and development, molecular regulation mechanism and biological research of Lepidoptera insects. There are many ways to introduce dsRNA into target insects, among which microinjection and feeding are widely used in diamondback moth. Ellango et al. gave dsRNA to diamondback moth by feeding, silencing the target gene tyrosine hydroxylase (TH), reducing TH transcription and larval feeding levels, and causing larval death, indicating that the TH gene has the potential to be a target gene for RNAi-mediated diamondback moth management. Israni et al. smeared dsRNA expressed by HTII5 strain on the surface of leaves and fed it to diamondback moth and cotton bollworm, interfering with ecdysone receptor, insect intestinal mucin and serine protease genes, significantly reducing target gene transcription, larvae accompanied by various molting abnormalities, overall development delay, and mass death, and significantly reducing adult reproductive potential, egg laying and egg hatching rate. For the smaller diamondback moth, silencing target genes through feeding is simpler and more attractive than microinjection, immersion, etc. Summary of the invention

[0004] The purpose of the present invention is to provide a method for controlling diamondback moth. The present invention prepares dsRNA of neuropeptide F gene for use in controlling diamondback moth larvae. The dsRNA can inhibit the feeding and weight gain of diamondback moth larvae, and affect their growth and development, thereby achieving the purpose of controlling pests.

[0005] To achieve the above object, the present invention provides the following technical solutions:

[0006] In a first aspect, the present invention discloses a neuropeptide F gene of Plutella xylostella, which has a sequence shown in SEQ ID NO.1 or SEQ ID NO.2.

[0007] In a second aspect, the present invention discloses the use of the diamondback moth neuropeptide F gene for controlling the diamondback moth.

[0008] In a third aspect, the present invention discloses a dsRNA targeting the expression of a neuropeptide F gene of Plutella xylostella, wherein the neuropeptide F gene of Plutella xylostella has a sequence shown in SEQ ID NO.1 or SEQ ID NO.2.

[0009] In a fourth aspect, the present invention discloses a method for preparing a dsRNA targeting the expression of the neuropeptide F gene of Plutella xylostella, the method comprising using a sequence shown in SEQ ID NO.1 or SEQ ID NO.2 as a template, using primers to amplify a positive chain and an antisense chain, and forming dsRNA after transcription and annealing.

[0010] Preferably, in the method, the primers include: dsNPF1-F: TAATACGACTCACTATAGGGTCCATGATGTGCAAGAGTGTGCTGG; dsNPF1-R: TAATACGACTCACTATAGGGGAAGGTCCGGCTTCTCAACATCCTT; dsNPF2-F: TAATACGACTCACTATAGGGAT GTCCATGATGTGCAAGAG; dsNPF2-R: TAATACGACTCACTATAGGGTCATCTCCG TTGCCCGTAAGTGAA.

[0011] In a fifth aspect, the present invention provides a method for controlling Plutella xylostella, the method comprising contacting Plutella xylostella larvae with a substance that inhibits the expression of the Plutella xylostella neuropeptide F gene.

[0012] Preferably, the substance that inhibits the expression of the neuropeptide F gene of Plutella xylostella is a dsRNA that targets the expression of the neuropeptide F gene of Plutella xylostella.

[0013] Preferably, the contacting comprises causing the diamondback moth larvae to ingest a substance that inhibits the expression of the diamondback moth neuropeptide F gene, or injecting the diamondback moth larvae with a substance that inhibits the expression of the diamondback moth neuropeptide F gene.

[0014] In a sixth aspect, the present invention provides an agent for controlling Plutella xylostella, the agent comprising dsRNA targeting the expression of neuropeptide F gene of Plutella xylostella.

[0015] Compared with the prior art, the present invention has the following beneficial effects: the present invention can effectively silence the target genes neuropeptide F1 (NPF1) and neuropeptide F2 (NPF2) by delivering dsRNA into the body of the diamondback moth. After continuous silencing of the NPF1 and NPF2 genes, the larvae in the experimental group had delayed development, smaller morphology, and a significant difference in weight compared with the control group; after administering dsNPF1 and dsNPF2, the 2nd instar larvae of the diamondback moth were fed normally until pupation, and the food intake was significantly lower than that of the control group, and the pupation time was delayed by about 24-48 hours. After silencing the NPF1 and NPF2 genes, the feeding behavior of the diamondback moth is regulated, thereby inhibiting the weight gain of the diamondback moth, delaying development, and delaying the pupation time, affecting its growth and development, and providing a new idea for green pest control. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is the electrophoresis diagram of neuropeptide F genes NPF1 and NPF2 of Plutella xylostella;

[0017] Figure 2 is the expression pattern of neuropeptide F genes NPF1 and NPF2 in different instars of Plutella xylostella;

[0018] Figure 3 Electrophoresis diagram of synthetic template strand and dsRNA;

[0019] Figure 4 Interference efficiency detection after injection of dsRNA at different times;

[0020] Figure 5 Effects of dsRNA injection on feeding and growth of Plutella xylostella larvae;

[0021] Figure 6 Effects of dsRNA injection on the pupation rate and mortality of Plutella xylostella larvae.

[0022] Description of Sequence Listing

[0023] SEQ ID NO.1 is the gene coding region sequence of Plutella xylostella NPF1;

[0024] SEQ ID NO.2 is the gene coding region sequence of Plutella xylostella NPF2;

[0025] SEQ ID NO.3 is the amino acid sequence of the gene coding region of Plutella xylostella NPF1;

[0026] SEQ ID NO.3 is the amino acid sequence of the gene coding region of Plutella xylostella NPF2. DETAILED DESCRIPTION

[0027] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0028] In the description of the present invention, it should be noted that the terms "upper", "lower", "inner", "outer", "front end", "rear end", "two ends", "one end", "the other end" and the like indicating the orientation or positional relationship are only for the convenience of describing the present invention and simplifying the description, and do not indicate or imply that the device or element referred to must have a specific orientation, be constructed and operate in a specific orientation, and therefore cannot be understood as limiting the present invention. In addition, the terms "first" and "second" are only used for descriptive purposes and cannot be understood as indicating or implying relative importance.

[0029] In the description of the present invention, it should be noted that, unless otherwise clearly specified and limited, the terms "installed", "provided with", "connected", etc. should be understood in a broad sense. For example, "connected" can be a fixed connection, a detachable connection, or an integral connection; it can be a mechanical connection or an electrical connection; it can be a direct connection, or it can be indirectly connected through an intermediate medium, or it can be the internal communication of two components. For ordinary technicians in this field, the specific meanings of the above terms in the present invention can be understood according to specific circumstances.

[0030] The purpose of the present invention is to provide a use of dsRNA of neuropeptide F genes NPF1 and NPF2 of diamondback moth in controlling diamondback moth. The dsRNA can inhibit the feeding and weight gain of diamondback moth, affect its growth and development, and thus achieve the purpose of controlling pests.

[0031] In the scheme of the present invention, the method for obtaining dsRNA and its application is as follows:

[0032] (1) First, Plutella xylostella of different ages were collected, RNA was extracted, and the first chain of cDNA was obtained by reverse transcription. The first chain of cDNA was used as a template to clone the NPF1 and NPF2 gene sequences, whose nucleotide sequences are shown in SEQ ID No. 1 and SEQ ID No. 2, and which encode proteins with amino acid sequences shown in SEQ ID No. 3 and SEQ ID No. 4;

[0033] (2) Design specific primers and use in vitro synthesis to obtain dsRNA that interferes with the neuropeptide F genes NPF1 and NPF2 of Plutella xylostella;

[0034] (3) Deliver dsRNA to Plutella xylostella by feeding or injection to silence the expression of neuropeptide F genes NPF1 and NPF2, and detect the interference efficiency by RT-qPCR;

[0035] (4) Observe the phenotype and weight changes of Plutella xylostella after feeding or injection of dsRNA; move the moth to normal feed after feeding or injection of dsRNA until pupation, and observe the changes in feeding and pupation time.

[0036] The experimental results showed that the target genes NPF1 and NPF2 can be effectively silenced by delivering dsRNA to the diamondback moth by feeding or injection. After continuous silencing of the NPFR gene, the larvae in the experimental group had delayed development, smaller morphology, and a significant difference in weight from the control group; after dsNPF1 and dsNPF2 were given, the second-instar larvae of the diamondback moth were fed normally until pupation, and the food intake was lower than that of the control group, and the pupation time was delayed. After the NPF1 and NPF2 genes were silenced, the weight gain of the diamondback moth was inhibited, the development was delayed, the pupation time was postponed, and its growth and development were affected by regulating the feeding behavior of the diamondback moth, providing a new idea for the control of green pests.

[0037] The technical solution of the present invention will be described more clearly and completely below in conjunction with specific embodiments and drawings.

[0038] Example 1: Cloning of neuropeptide F genes NPF1 and NPF2 from Plutella xylostella

[0039] As shown in SEQ ID NO.1 and SEQ ID NO.2, the full lengths of the coding regions of the NPF1 and NPF2 genes of Plutella xylostella are 369 bp and 249 bp, respectively, encoding 123 and 83 amino acids, respectively, and the predicted protein molecular weights are 14.14 and 9.53 kDa, respectively.

[0040] The total RNA of Plutella xylostella was extracted by TRIzol method. Plus All-in-one 1st StrandcDNA Synthesis SuperMix (gDNA Purge) instructions, synthesize the first strand cDNA, use it as a template, use NPF1-F: ATGTCCATGATGTGCAAGAG, NPF1-R: TCTCCGTTGCCCGTAGGTGA as primers to amplify the NPF1 gene coding region, use NPF2-F: ATGTCCATGATGTGCAAGAG, NPF2-R: TCTCCGTTGCCCGTAGGTGA as primers to amplify the NPF2 gene coding region, the reaction system is as follows:

[0041]

[0042] PCR amplification conditions are as follows:

[0043]

[0044] Prepare 1% agarose gel, stain with YeaRed Nucleic Acid Gel Stain, take 10μL of the amplified product and electrophoresed it at 140V for 30min. Recover the target fragment from the gel and send it to Bio-Tech for sequencing. After PCR amplification, the band sizes are 369bp and 249bp respectively. The electrophoresis results are as follows Figure 1 As shown, the position of the amplified band was consistent with the expectation.

[0045] Example 2: Analysis of expression patterns of neuropeptide F gene in different instars of Plutella xylostella

[0046] Three samples of 1st, 2nd, 3rd and 4th instar larvae of Plutella xylostella were taken respectively and frozen at -80℃ for later use.

[0047] Sybrgreen fluorescent dye method was used to detect the spatiotemporal expression of NPF1 and NPF2 genes. Specific primers were designed according to the gene sequences of Plutella xylostella NPFR and RPL32 (internal reference), as shown below.

[0048]

[0049]

[0050] (2) Fluorescence quantitative PCR

[0051] Refer to 5×PrimeScript TM RT Master Mix Kit Instructions, perform fluorescence quantitative PCR. Perform the reaction in a 200 μL PCR tube according to the following procedure:

[0052] ① Reverse transcription reaction

[0053] Incubate at 37°C for 15 min, heat at 85°C for 5 s, and cool at 4°C for 2 min;

[0054] ②Real-Time PCR reaction

[0055] The reaction system is as follows:

[0056]

[0057] The program settings are as follows:

[0058]

[0059] RPL32 was used as the internal reference gene, and the relative expression of genes among different treatments was calculated according to the Ct value based on the 2-ΔΔCt method.

[0060] The expression patterns at different ages are shown in Figure 2 As shown. Taking the expression level of NPF1 or NPF2 gene in the 1st instar diamondback moth as the benchmark, NPF1 and NPF2 are expressed in all instars of the diamondback moth. The expression level of NPF1 gene is highest in the 4th instar larvae, followed by the 1st instar larvae. The expression level of NPF2 is also highest in the 4th instar larvae, followed by the 3rd instar larvae, and the lowest in the 2nd instar larvae. There are extremely significant differences between the 1st instar, 2nd instar, 3rd instar and 4th instar larvae (p<0.01). In this study, the expression levels of NPF1 and NPF2 genes showed a significant upward trend during the larval binge period (3rd instar-4th instar), which suggests that the gene may be related to the feeding behavior of the diamondback moth. The 1st and 2nd instar larvae of the diamondback moth eat less, the end of the 3rd instar to the beginning of the 4th instar is a binge period, and the pupal stage and adults do not eat.

[0061] Example 3: Synthesis of dsRNA of neuropeptide F gene of Plutella xylostella

[0062] According to the gene sequences of Plutella xylostella neuropeptide F1 (XP_011550161.2) and neuropeptide F2 (XP_011550160.2), specific primers with T7 promoter at the 5' end were designed to amplify the transcription template. The underlined part is the T7 promoter. The specific sequence is as follows:

[0063]

[0064] The PCR reaction system is as follows:

[0065]

[0066] The sense and antisense strands of dsNPF1 were amplified using two pairs of primers, Inpf1-F / NPF1-R and NPF1-F / Inpf1-R, respectively. The sense and antisense strands of dsNPF2 were amplified using two pairs of primers, Inpf2-F / NPF2-R and NPF2-F / Inpf2-R, respectively. The PCR amplification products were subjected to 1% agarose gel electrophoresis, and the gel containing the target gene was recovered.

[0067] The positive strand and the antisense strand are added in a 1:1 ratio to avoid residual single-stranded RNA after annealing. Add the reaction reagents according to the following system:

[0068]

[0069] Mix gently by pipetting, centrifuge briefly, incubate at 37℃ for 2h, and end the reaction at 72℃ for 10min. Cool at room temperature to anneal and form dsRNA.

[0070] Use RNase T1 and DNaseI to specifically degrade single-stranded RNA and the GGG base at the 5' end. Before the reaction, dilute 100U / μL RNase T1 with RNaseT1 Dilution Buffer at a ratio of 9:1. The double enzyme digestion system is as follows:

[0071]

[0072] After incubation at 37°C for 30 min, the transcription products were subjected to 1% agarose gel electrophoresis.

[0073] The results are as follows Figure 3 As shown, the ssRNA that did not form dsRNA was digested by DNaseI and RNase T1. The dsRNA size was consistent with the expected result, and the concentrations were 1836ng / μL and 1653ng / μL, respectively, which can be used for subsequent interference experiments.

[0074] The magnetic bead method is used to purify dsRNA, which can effectively remove salts, proteins and free nucleic acids. The specific steps are as follows:

[0075] ①Take out RNA Clean Beads from the 4℃ refrigerator and equilibrate at room temperature for 30 minutes. Add 80μL of mixed RNA Clean Beads solution to the dsRNA and mix thoroughly with a pipette. Incubate at room temperature for 8 minutes to allow the dsRNA to fully bind to the magnetic beads;

[0076] ② Place the 1.5mL centrifuge tube on the magnetic stand until the magnetic beads are adsorbed and the solution becomes clear, then slowly remove the supernatant;

[0077] ③ Add 200 μL of 80% ethanol, place the centrifuge tube on the magnetic rack, let it stand at room temperature for 30 seconds, discard the supernatant, and repeat this step once;

[0078] ④ Open the lid and dry in a clean bench for 8 minutes. At this time, there is no water on the surface of the magnetic beads. Remove the centrifuge tube from the magnetic stand, add 40μL RNase-free H2O, fully elute the magnetic beads, and incubate at room temperature for 4 minutes;

[0079] ⑤ Place the centrifuge tube on the magnetic rack and let it stand for 5 minutes without touching the magnetic beads. Transfer the supernatant to an enzyme-free tube, measure the concentration, and store at -20℃.

[0080] Example 4: Detection of the interference efficiency of neuropeptide F gene in Plutella xylostella

[0081] Twenty 2nd-instar diamondback moths in each group were placed in a petri dish and placed on ice for anesthesia in preparation for injection. dsEGFP was used as a control. Three replicates were set for each group of experiments. Diamondback moths were taken out after 12h, 24h, 48h, and 72h, respectively, and kept at -80℃ for later use. Total RNA from different groups of diamondback moths was extracted and transcribed into cDNA. Fluorescence quantitative PCR was used to detect the changes in the expression levels of the target genes NPF1 and NPF2 under different dsRNA interference times. The specific experimental steps refer to the expression pattern analysis of different instars of diamondback moth.

[0082] Compared with the control dsEGFP-treated group, the expression levels of NPF1 gene at 24h, 48h and 72h after dsNPF1 injection were significantly lower than those in the control group. Figure 4 As shown. At 72h, the expression of NPF1 gene was the lowest, and the silencing efficiency reached 34%, which was the best state of interference. The expression of NPF2 gene at 12h, 24h, 48h and 72h after injection of dsNPF2 was significantly lower than that of the control group. Figure 4 As shown. At 48h, the expression of NPF2 gene was the lowest, and the silencing efficiency reached 31%. Therefore, injecting dsNPF1 and dsNPF2 into Plutella xylostella effectively reduced the expression of target genes.

[0083] Example 5: Effects of feeding neuropeptide F gene dsRNA on the growth, development and feeding of Plutella xylostella

[0084] The 2nd-instar diamondback moth larvae injected with dsNPF1 or dsNPF2 were raised on artificial diet and observed continuously until the diamondback moths pupated. The diamondback moths fed with dsEGFP were used as the control, and 20 diamondback moths were inoculated in each culture dish, with 3 replicates, to observe the effects of NPF1 and NPF2 gene silencing on the growth and development of diamondback moths. The experimental results are shown in Figure 5 shown.

[0085] After 3 days, the control group grew well, and almost all larvae grew to the 4th instar. Compared with the control group, the larvae of Plutella xylostella injected with dsNPF1 or dsNPF2 72 h later had delayed development, and some larvae were still in the 3rd instar stage with smaller body size. Figure 5 As shown. The food consumption of 2nd-instar diamondback moth larvae injected with dsNPF1 or dsNPF2 was significantly lower than that of the control group, and the amount of food intake was shown by the amount of excrement on the surface of the feeding dish. The growth and development of diamondback moth larvae injected with dsNPF1 or dsNPF2 were slow. On the sixth day after the injection, the pupation rate and mortality rate of the test insects in the experimental group were significantly different from those in the control group. Compared with the control group, the pupation rate of diamondback moth larvae injected with dsNPF1 and dsNPF2 was significantly lower than that of the control group at 144h after injection, while the mortality rate was significantly higher than that of the control group injected with dsEGFP. The experimental results are shown in Figure 6 In summary, the above results show that the NPF1 and NPF2 genes of Plutella xylostella regulate the growth and development of Plutella xylostella larvae by regulating the feeding behavior of Plutella xylostella larvae.

[0086] The matters not described in detail in the present invention are all known technologies to those skilled in the art.

[0087] Finally, it should be noted that the above specific implementation methods are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified and replaced by equivalents without departing from the spirit and scope of the technical solution of the present invention, which should be included in the scope of the claims of the present invention.

Claims

1. A neuropeptide F gene of Plutella xylostella, characterized in that It has the sequence shown by SEQ ID NO.1 or SEQ ID NO.

2.

2. Use of the neuropeptide F gene of Plutella xylostella, characterized in that: Used to control diamondback moth.

3. A dsRNA targeting the expression of neuropeptide F gene of Plutella xylostella, characterized in that: The Plutella xylostella neuropeptide F gene has a sequence shown in SEQ ID NO.1 or SEQ ID NO.

2.

4. A method for preparing dsRNA targeting the expression of neuropeptide F gene of Plutella xylostella, characterized in that: The method comprises taking the sequence shown in SEQ ID NO.1 or SEQ ID NO.2 as a template, using primers to amplify a sense strand and an antisense strand, and forming dsRNA after transcription and annealing.

5. The method for preparing dsRNA targeting the expression of neuropeptide F gene of Plutella xylostella according to claim 4, characterized in that: The primers include: dsNPF1-F: TAATACGACTCACTATAGGGTCCATGATGTGCAAGAGTGTGCTGG; dsNPF1-R: TAATACGACTCACTATAGGGGAAGGTCCGGCTTCTCAAC ATCCTT; dsNPF2-F: TAATACGACTCACTATAGGGATGTCCATGATGTGCAAGAG; dsNPF2-R: TAATACGACTCACTATAGGGTCATCTCCGTTGCCCGTAAGTGAA.

6. A method for controlling Plutella xylostella, characterized in that: The method comprises contacting the diamondback moth larvae with a substance that inhibits the expression of the diamondback moth neuropeptide F gene.

7. The method for controlling Plutella xylostella according to claim 6, characterized in that: The substance for inhibiting the expression of the neuropeptide F gene of the diamondback moth is a dsRNA targeting the expression of the neuropeptide F gene of the diamondback moth.

8. The method for controlling Plutella xylostella according to claim 6, characterized in that: The contact includes allowing the diamondback moth larvae to ingest a substance that inhibits the expression of the diamondback moth neuropeptide F gene, or injecting the diamondback moth larvae with a substance that inhibits the expression of the diamondback moth neuropeptide F gene.

9. A medicament for controlling Plutella xylostella, characterized in that: The agent comprises dsRNA targeting the expression of neuropeptide F gene of Plutella xylostella.

Images