An internal reference gene related to Arabidopsis stress resistance gene expression regulation and its application

Abstract

The present invention discloses an internal reference gene related to the expression regulation of Arabidopsis stress resistance gene and its application, and relates to the field of gene engineering technology. The internal reference gene is LHCB5 and / or LHCB4.1, and the nucleotide sequence of LHCB5 is shown in SEQ ID NO.1, and the nucleotide sequence of LHCB4.1 is shown in SEQ ID NO.2. The present invention analyzes and finds that the internal reference genes LHCB5 and LHCB4.1 show consistent stability under Arabidopsis high temperature stress conditions through multiple analysis methods. When LHCB5 and LHCB4.1 are used as internal reference genes for relative quantification alone and in combination, the relative expression amount of HSFA2 gene under high temperature stress conditions increases and the trend is relatively consistent, which verifies that LHCB5 and LHCB4.1 alone and in combination can be used as internal reference genes for qPCR analysis of Arabidopsis under high temperature stress, providing a reliable reference standard for future research on gene expression of Arabidopsis under high temperature stress, and helping to improve the accuracy and comparability of experimental data.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to an internal reference gene related to the expression regulation of Arabidopsis stress resistance genes and an application thereof. Background Art

[0002] High temperature stress refers to the high temperature environment that exceeds the normal growth temperature range encountered by plants during their growth process. High temperature stress is one of the factors that significantly affect plant growth and development among many abiotic adversities. High temperatures of different intensities and durations will cause different degrees of damage to plants at different growth stages. Arabidopsis thaliana.L, as a widely used model plant in the world, provides an ideal material for plant genetics research. Therefore, in-depth research on the gene expression regulatory network of Arabidopsis thaliana under high temperature stress, as well as the exploration of its heat-resistant genes and molecular mechanisms, is of great scientific significance for revealing the plant response mechanism to adversity, and also provides an important scientific research basis and application prospects for breeding for high temperature resistance in agricultural production.

[0003] Real-time fluorescence quantitative PCR (quantitative Real-Time PCR, qPCR) technology is developed from traditional PCR technology and is a key tool for analyzing gene expression in plant molecular biology research. This technology measures the total amount of DNA amplification in real time by monitoring the fluorescent signal during the PCR process, and uses internal reference genes as references to accurately quantify specific target genes in different samples. It has significant advantages such as high specificity, high sensitivity, good repeatability and quantitative accuracy. By selecting genes that are stably expressed in specific environments or tissues as internal reference genes, the experimental data can be standardized, thereby correcting the effects of factors such as RNA starting amount, reverse transcription efficiency, and PCR amplification efficiency on the experimental results, ensuring the accuracy of the results.

[0004] In theory, an ideal reference gene should be stably expressed in different tissues, developmental stages, and treatment conditions, but such a broad-spectrum reference gene has not yet been reported. Jatropha curcas requires different reference genes at different developmental stages, and at least two genes are required to ensure accuracy. In the vegetative growth stage, ACTIN and TUB8 are ideal reference gene combinations, while in the reproductive growth stage, GAPDH and EF-1α are more suitable. This shows that the selection of reference genes is different at different developmental stages of plants. When cotton (Gossypium hirsutumL.) is subjected to salt stress, GAPDH and EF1A-8 ​​(Translation elongation factor 1A-8) are expressed stably in the leaves and roots of cotton, making them ideal reference gene choices; in drought stress, the expression levels of GAPDH and EF1A-8 ​​decrease, making them no longer suitable as reference genes. These research results indicate that researchers need to screen relatively stable reference genes according to specific experimental conditions to accurately analyze the expression level of the target gene and ensure the reliability of the experimental results.

[0005] The present application aims to provide a stable internal reference gene for the study of stress resistance genes in Arabidopsis thaliana under the specific environment of high temperature stress, laying a foundation for the subsequent accurate analysis of the expression levels of related genes. Summary of the invention

[0006] In order to overcome the deficiencies of the prior art, the object of the present invention is to provide an internal reference gene related to the expression regulation of Arabidopsis stress resistance genes and its application.

[0007] The present invention achieves the above-mentioned purpose through the following technical solutions:

[0008] The present invention provides an internal reference gene related to the expression regulation of Arabidopsis stress resistance genes. The internal reference gene is LHC B5 and / or LHCB4.1. The nucleotide sequence of LHCB5 is shown in SEQ ID NO.1, and the nucleotide sequence of LHCB4.1 is shown in SEQ ID NO.2.

[0009] The present invention also provides an application of the internal reference gene in real-time fluorescence quantitative PCR detection of stress resistance-related genes under abiotic stress in Arabidopsis thaliana.

[0010] As a further optimization scheme of the present invention, the abiotic stress includes high temperature stress.

[0011] As a further optimization scheme of the present invention, the internal reference gene is any one or two of LHCB5 and LHCB4.1.

[0012] The present invention also provides a method for quantitatively analyzing the internal reference gene as claimed in claim 1, comprising the following steps:

[0013] (1) Extract total RNA from Arabidopsis tissue and reverse transcribe it into cDNA;

[0014] (2) designing primers based on the specific region of the internal reference gene to obtain real-time fluorescence quantitative PCR primers;

[0015] (3) using the cDNA of step (1) as a template and the primers of step (2) to perform a real-time fluorescence quantitative PCR reaction;

[0016] The primers for LHCB5 are:

[0017] SEQ ID NO.5: Upstream primer F: CTGAGGTTGTTCTCCTCGGT;

[0018] SEQ ID NO.6: Downstream primer R: AGAAGAGCTCCTTGCTCAGG;

[0019] The primers for the LHCB4.1 are:

[0020] SEQ ID NO.15: Upstream primer F: GAATGGCTTACCGGCGTTAC;

[0021] SEQ ID NO.16: Downstream primer R: TGGAACTCGATGTAGCCGAT;

[0022] (4) After the reaction is completed, the fluorescence signal of the melting curve is collected, the melting curve is analyzed and the Ct value is obtained as the basis for subsequent data analysis.

[0023] As a further optimization scheme of the present invention, the real-time fluorescence quantitative PCR amplification reaction system is: the total system is 20 μL, ChamQ TM SYBR qPCR Master Mix 10μL, forward primer and reverse primer 0.2μL each, template cDNA 3μL, ddH2O 6.6μL.

[0024] As a further optimization scheme of the present invention, the real-time fluorescence quantitative PCR amplification reaction program is: 95°C pre-denaturation for 3 min; 95°C denaturation for 10 s, 56°C annealing for 30 s, 72°C extension for 30 s, and 40 cycles.

[0025] The present invention has the following beneficial effects:

[0026] The invention screens and obtains LHCB5 and LHCB4.1 genes through Arabidopsis thaliana transcriptome data analysis under high temperature stress, uses q-PCR technology, analyzes the expression stability of candidate internal reference genes through a ΔCt algorithm, three bioinformatics tools NormFinder, GeNorm and BestKeeper programs, and finally uses RefFinder for comprehensive evaluation. In the five analysis methods, LHCB5 and LHCB4.1 both show consistent stability, and when LHCB5 and LHCB4.1 are used alone or in combination as internal reference genes for relative quantification, the relative expression amount of the HSFA2 gene under high temperature stress increases and the trends are relatively consistent, which verifies that LHCB5 and LHCB4.1 alone or in combination can be used as internal reference genes for qPCR analysis of Arabidopsis thaliana under high temperature stress, provides a reliable reference standard for future research on gene expression of Arabidopsis thaliana under high temperature stress, and is helpful to improve the accuracy and comparability of experimental data. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 is the agarose gel electrophoresis of Arabidopsis total RNA in the three treatment groups;

[0028] Figure 2 It is the melting curve of qPCR amplification products of 13 candidate internal reference genes;

[0029] Figure 3 is the cycle threshold (Ct) variation analysis graph of 13 candidate reference genes;

[0030] Figure 4 This is the result of geNorm analysis of the expression stability of 13 candidate internal reference genes under high temperature stress conditions;

[0031] Figure 5 This is the result of NormFinder analyzing the expression stability of 13 candidate reference genes under high temperature stress conditions;

[0032] Figure 6 This is the result of BestKeeper analyzing the expression stability of 13 candidate reference genes under high temperature stress conditions;

[0033] Figure 7 This is the result of RefFinder analyzing the expression stability of 13 candidate reference genes under high temperature stress conditions;

[0034] Figure 8 This is a graph showing the stability verification results of LHCB4.1, LHCB5 alone and in combination as internal reference genes. DETAILED DESCRIPTION

[0035] The present application is further described in detail below in conjunction with the accompanying drawings. It is necessary to point out here that the following specific implementation methods are only used to further illustrate the present application and cannot be understood as limiting the scope of protection of the present application. Technical personnel in this field can make some non-essential improvements and adjustments to the present application based on the above application content.

[0036] 1. Materials

[0037] The methods used in this example are conventional methods known to those skilled in the art unless otherwise specified, and the reagents and other materials used are commercially available products unless otherwise specified.

[0038] 2. Methods

[0039] 2.1 Screening and obtaining candidate internal reference genes

[0040] Based on the transcriptional data of Arabidopsis thaliana under heat stress, 13 candidate reference genes were screened, namely RBP45B, LHCB5, PIP1C, CHLM, SCA1, LHCA3, LHCB4.1, LHCB6, ARFA1E, GAPDH, UBQ5, ACTIN2, and UBQ10, which were highly expressed in various tissues of Arabidopsis thaliana.

[0041] 2.2 Extraction and reverse transcription of Arabidopsis thaliana total RNA

[0042] 2.2.1. Columbia wild-type Arabidopsis thaliana (Col-0) was grown in a 22°C light incubator (humidity 65%, light intensity 160 μmol m -2 s -1 , 16h light / 8h dark) for three weeks, and then subjected to high temperature stress; three treatment groups were set up: treatment group 1: normal growth under 22℃ temperature environment; treatment group 2: 42℃ high temperature stress treatment for 2.5h; treatment group 3: 32℃ high temperature stress treatment for 2d; leaf samples were then taken from the three treatment groups and immediately frozen in liquid nitrogen, and then transferred to a -80℃ refrigerator for storage for subsequent RNA extraction of samples.

[0043] 2.2.2. Prepare 100 mg of samples from each of the three treatment groups, and extract Arabidopsis total RNA using the Trizol method; 1% agarose gel electrophoresis revealed that the electrophoresis bands of Arabidopsis total RNA in the three treatment groups were clear and free of mixed bands ( Figure 1 ), indicating that the extracted total RNA samples were of qualified quality; the OD values ​​of the total RNA samples were detected by ultra-micro UV spectrophotometer, and the A260 / A280 of all samples were between 1.8 and 2.0, indicating that the purity was high, indicating that the extracted total RNA was not degraded; then the total RNA was purified by Nanjing Novozymes The extracted total RNA was reverse transcribed into cDNA using II 1st Strand cDNA Synthesis Kit and stored at -20°C for future use.

[0044] 2.3 Primer design

[0045] Specific primers were designed by https: / / www.genscript.com.cn / tools / real-time-pcr-taqman-primer-design-tool. The parameters for designing specific primers were set as follows: amplification length 100-150 base pairs, primer sequence length 18-22 bases, GC content 45%-55%, melting temperature (Tm) 55-60°C. The specific primer sequences of 13 candidate internal reference genes are shown in Table 1:

[0046] Table 1 Specific primer sequences of the above 13 candidate internal reference genes

[0047]

[0048]

[0049] 2.4 Real-time fluorescence quantitative PCR analysis

[0050] The cDNA of the three treatment groups obtained in step 2.2 above was used as a template, and the specific primers designed in step 2.3 above were used to perform real-time fluorescence quantitative PCR amplification reaction on the 13 candidate internal reference genes. The fluorescence quantitative PCR instrument model used was Bio-Rad CFX96; the Q-PCR mix reagent was ChamQ TM SYBR qPCR Master Mix, PCR amplification reaction system and reaction procedures are as follows:

[0051] PCR amplification reaction system: total system 20μL, ChamQ TM SYBR qPCR Master Mix 10 μL, forward primer and reverse primer 0.2 μL each (concentration 10 μM), template cDNA 3 μL, ddH2O 6.6 μL.

[0052] PCR amplification reaction program: ① pre-denaturation at 95°C for 3 min; ② denaturation at 95°C for 10 s, annealing at 56°C for 30 s, extension at 72°C for 30 s (collecting fluorescence signals), 40 cycles; ③ collecting melting curve fluorescence signals.

[0053] Through the analysis of the melting curves of the real-time fluorescence quantitative PCR amplification products, it was found that all 13 candidate internal reference genes produced only a single melting peak, without any mixed peaks (such as Figure 2This indicates that the primers have good specificity in amplification and do not produce primer dimers or non-specific amplification. The primers can be used for Ct value analysis in subsequent qPCR tests, and the test results are highly reliable.

[0054] 3 Data processing and analysis

[0055] 3.1 Analysis of Ct value and △Ct value

[0056] 3.1.1 Ct value analysis

[0057] The Ct value of real-time fluorescence quantitative PCR refers to the number of cycles experienced when the fluorescent signal in each reaction tube reaches the set threshold value. It can intuitively reflect the expression level of the gene. The expression level of the gene is inversely proportional to the Ct value. The higher the gene expression level, the fewer times it is amplified to the threshold, that is, the lower the Ct value; conversely, the lower the gene expression level, the more times it is amplified to the threshold, that is, the higher the Ct value.

[0058] qRT-PCR was performed on samples under normal growth conditions and samples under high temperature stress treatment to evaluate the expression levels and stability of 13 candidate reference genes, as follows:

[0059] like Figure 3 A The results showed that in the expression level analysis, the Ct values ​​of LHCB4.1 and LHCB5 genes were smaller, indicating that their expression levels were higher; the Ct value of the ARFA1E gene was the largest, indicating that its expression level was the lowest, and the Ct values ​​of other genes were between 18 and 28; in the stability analysis, the box plot ranges of LHCB4.1 (18.9-20.8) and LHCB5 (19.4-20.1) were narrow, indicating that their expression stability was better; while the box plot ranges of UBQ10 (20.79-26.14) and RBP45B (23.15-28.31) were wide, indicating that their expression stability was poor.

[0060] 3.1.2. △Ct value analysis

[0061] △Ct value analysis ranks genes according to the average of their SD values, further revealing the expression stability of these candidate reference genes.

[0062] like Figure 3B The results showed that the expression levels of LHCB4.1, LHCB5, SCA1 and LHCA3 were relatively concentrated, with small changes in △Ct values, low average values ​​of standard deviation (SD / STDEV) values ​​and small coefficients of variation, indicating that the expression stability of these genes was high under high temperature stress; while the △Ct values ​​of ACTIN2, RBP45B, UBQ10 and GAPDH varied greatly, with high average values ​​of standard deviation (SD / STDEV) values ​​and large coefficients of variation, indicating that the expression stability of these genes was poor under high temperature stress.

[0063] In summary, it is shown that under the same conditions, the expression levels of different candidate reference genes are different; and under different high temperature stress conditions, there are also significant differences in the expression stability of the candidate reference genes themselves.

[0064] 3.2 geNorm analysis

[0065] The geNorm program uses the M value (mean expression stability index) to evaluate the stability of the internal reference gene. The lower the M value, the more stable the gene expression. If the M value of a gene is less than 1.5, then the gene can be used as an alternative internal reference gene.

[0066] like Figure 4 As shown in A, geNorm software analysis showed that under high temperature stress, the M values ​​of all candidate reference genes were less than 1.5, and their stability was ranked from high to low as LHCB5 = LHCB4.1 > SCA1 > LHCA3 > LHCB6 > PIP1C > CHLM > ARFA1E > UBQ5 > ACTIN2 > RBP45B > UBQ10 > GAPDH; according to the size of the M value, LHCB5 and LHCB4.1 were more stably expressed than other genes;

[0067] The V value in the geNorm algorithm refers to the pairwise variation value used to determine the optimal number of reference genes. n / V n+1 If the ratio is less than 0.15, n reference genes are optimal; otherwise, n+1 reference genes are required.

[0068] like Figure 4 As shown in B, under high temperature stress treatment, the V2 / V3 value was 0.07, which was less than 0.15, indicating that the calibration requirements of qRT-PCR data can be met using the two most stable reference gene combinations.

[0069] 3.3 NormFinder analysis

[0070] NormFinder software ranks the stability of genes according to the expression stability value (S value). The smaller the S value, the more stable the gene expression.

[0071] like Figure 5 As shown, the S values ​​of 13 candidate genes under high temperature stress treatment are disclosed, and their stability is ranked from high to low. Among them, the S values ​​of the two genes LHCB4.1 and LHCB5 are smaller, indicating that the expression of these two candidate genes is more stable, while the S values ​​of the two genes LHCB6 and GAPDH are larger, indicating that the expression stability of these two candidate genes is poor.

[0072] 3.4 BestKeeper Analysis

[0073] Bestkeeper mainly evaluates gene stability by comparing the standard deviation (SD) and coefficient of variation (CV) between the Ct values ​​of each candidate reference gene. The lower the SD and CV values, the higher the gene expression stability.

[0074] like Figure 6 As shown, under high temperature stress treatment, the SD and CV values ​​of LHCB5 and LHCB4.1 were the lower two, indicating that they had better stability. The SD and CV values ​​of PIP1C, CHLM, UBQ5, UBQ10, RBP45B and ACTIN2 genes were relatively high, so they were not suitable as internal reference genes under high temperature stress.

[0075] 3.5 RefFinder analysis

[0076] In order to reduce the errors that may be caused by a single evaluation software, we used the online analysis tool RefFinder, which calculates the geometric mean of the gene expression stability rankings obtained by the above three software (geNorm, NormFinder, and BestKeeper) under high temperature stress, thereby obtaining a comprehensive ranking. The smaller the geometric mean, the higher the stability of gene expression.

[0077] like Figure 7 As shown, the comprehensive stability of the candidate reference genes is ranked from high to low as follows: LHCB4.1>LHCB5>SCA1>LHCA3>PIP1C>ARFA1E>CHLM>LHCB6>UBQ5>GAPDH>ACTIN2>RBP45B>UBQ10.

[0078] 4. Stability verification of internal reference genes

[0079] Through the analysis of the above five methods, it was found that LHCB4.1 and LHCB5 showed consistent stability in the evaluation of the five methods. Therefore, the screened LHCB4.1 and LHCB5 were used alone and in combination as normalization factors to verify the expression level of the HSFA2 gene after high temperature stress treatment.

[0080] HSFA2 (Heat Stress Transcription Factor A2) is an important heat shock transcription factor in Arabidopsis thaliana and a member of the plant heat shock transcription factor (HSF) family. The expression of HSFA2 in Arabidopsis thaliana is very sensitive to heat stress.

[0081] like Figure 8 As shown, the results showed that under high temperature stress conditions, when LHCB4.1 and LHCB5 were used alone or in combination as internal reference genes, the expression level of HSFA2 gene was upregulated, and the changes tended to be consistent and relatively stable, all between 15-35 times. The upregulation multiples after different temperature and time treatments may be slightly different. This shows that it is feasible to use LHCB4.1 and LHCB5 alone or in combination as internal reference genes under high temperature stress, which will also lay the foundation for further research on the functions of Arabidopsis internal reference genes.

[0082] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention.

Claims

1. An application of an internal reference gene in real-time fluorescence quantitative PCR detection of stress resistance-related genes in Arabidopsis thaliana under abiotic stress, characterized in that: The internal reference gene is LHCB5 and / or LHCB4.1 , LHCB5 The nucleotide sequence is shown in SEQ ID NO.1, LHCB4.1 The nucleotide sequence is shown as SEQ ID NO.2, and the abiotic stress is high temperature stress.

Images