Salt tolerance related genes, molecular markers and applications in maize

By cloning the maize glycine betaine synthesis gene ZmGB1 and developing related molecular markers, the problem of scarce gene resources in maize breeding has been solved, enabling early and accurate identification of maize salt tolerance and significantly accelerating the breeding process.

CN119432875BActive Publication Date: 2026-03-17CHINA AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-26
Publication Date
2026-03-17

AI Technical Summary

Technical Problem

The basic theoretical research on salt-alkali tolerance breeding of maize is lagging behind in the current technology, and the gene resources are scarce, making it difficult to effectively improve the salt tolerance of maize. Existing research has failed to discover the synthesis pathway of glycine betaine in higher plants, resulting in slow breeding progress.

Method used

The maize glycine betaine synthesis gene ZmGB1, located at positions 87677579-87677606 on chromosome 3, was cloned. Related molecular markers and kits were provided. Salt tolerance in maize was detected by PCR amplification. Molecular markers and kits for maize breeding were developed using GWAS population analysis and bioinformatics methods.

Benefits of technology

Accurate identification of salt tolerance in maize seeds or early cotyledons significantly accelerates the breeding process of salt-tolerant maize varieties and improves breeding efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119432875B_ABST
    Figure CN119432875B_ABST
Patent Text Reader

Abstract

The application provides a salt-resistant gene of corn, wherein the nucleotide sequence of the gene is selected from the following sequences: (a) the sequence shown in SEQ ID NO. 1; (b) a nucleotide sequence obtained by substituting, deleting and / or adding one or more nucleotides in the sequence shown in SEQ ID NO. 1 and expressing the same functional protein; the application also provides a molecular marker related to the gene and a method for identifying the salt resistance of corn. The technical scheme of the application can accurately and simply identify the salt resistance of corn in an early stage and accelerate the corn breeding process.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a corn salt tolerance-related gene, molecular marker, and its application. Background Technology

[0002] Salt stress is one of the most widespread and damaging abiotic stresses to agriculture, affecting all stages of plant growth and development. When plants are under salt stress, seed germination rates decrease, root growth is inhibited, roots become shallower, nutrient absorption is suppressed, ion homeostasis within the plant is disrupted, leading to metabolic disorders; older leaves die off more quickly, new leaf growth is severely inhibited, resulting in weakened photosynthesis, flower abortion and reduced seed setting rate during the reproductive growth stage, ultimately causing crop yield reduction. However, current research on the basic theory of salt-tolerant maize breeding lags behind, and available gene resources are scarce. Therefore, it is necessary to fully explore the excellent salt-tolerant gene resources of maize and breed and create superior salt-tolerant varieties.

[0003] Plant salt and alkali stress response is a complex biological process (Yang and Guo, 2018; Gong et al., 2020). Current knowledge indicates that maize's salt and alkali tolerance response mainly manifests in osmotic regulation, deionization, reactive oxygen species scavenging, and transmembrane H+ regulation. + Several aspects are involved, including gradient maintenance (Liang et al., 2023). High concentrations of salt in soil or water can cause osmotic stress. Excessive salt leads to a decrease in root water potential, reducing the plant's ability to absorb water (Hasegawa et al., 2000), resulting in water loss (Yang and Guo, 2018). In addition, plants also maintain water potential by synthesizing osmotic regulators. Existing research shows that when plants are under salt stress, the concentration of betaine increases rapidly, maintaining osmotic balance between the cytoplasm and vacuoles and preventing cell dehydration (Chen and Murata, 2008).

[0004] In animals, plants, and some bacteria, glycine betaine is synthesized via a two-step choline process: choline dehydrogenase (CDH, in animals) or choline monooxygenase (CMO, in plants) oxidizes choline to betaine aldehyde (BA), which is then catalyzed by betaine aldehyde dehydrogenase (BADH) to form glycine betaine. In plants such as those in the Chenopodiaceae and Poaceae families, GB is produced through a two-step reaction of choline and betaine aldehyde (Hanson and Scott 1980, Hanson and Wyse 1982). However, GB accumulation is not detectable in all plants, and functional CMO and BADH are present. In some plants, such as alfalfa, barley, soybean, cotton, corn, peas, sorghum, spinach, strawberry, and wheat, GB accumulation can be detected; however, in plants such as Arabidopsis thaliana, eggplant, potato, tomato, and rice, GB accumulation cannot be detected even under abiotic stress (Kurepin, Ivanov et al. 2015, Annunziata, Ciarmiello et al. 2019). To date, CMO and BADH have only been found in plants of the Chenopodiaceae and Amaranthaceae families, suggesting that other choline oxidases may exist in other families to perform this function in place of CMO (Russell, Rathinasabapathi et al. 1998). Therefore, it is highly likely that new synthases and pathways exist in higher plants to synthesize GB, and further research is needed.

[0005] Under stress conditions, using bioinformatics methods to identify salt-tolerant, high-betaine materials and develop molecular markers is a feasible approach to crop improvement, offering more possibilities for crop enhancement (Fang et al., 2016; Kumar et al., 2017). Summary of the Invention

[0006] To overcome the shortcomings of existing technologies:

[0007] On one hand, the present invention provides a maize salt tolerance-related gene, the nucleotide sequence of which is selected from:

[0008] (a) The sequence shown in SEQ ID NO.1;

[0009] (b) A nucleotide sequence of the sequence shown in SEQ ID NO.1 that has been substituted, deleted and / or added with one or more nucleotides and expresses the same functional protein.

[0010] The phrase "replacement, deletion, and / or addition of one or more nucleotides and expression of the same functional protein" can be achieved by those skilled in the art using conventional knowledge and techniques in the fields of proteins and genes, including but not limited to knowledge and tools related to amino acid codons, amino acid classification, protein structure analysis, and functional prediction.

[0011] On the other hand, the present invention provides the protein encoded by the above-mentioned maize salt tolerance-related gene, the amino acid sequence of which is shown in SEQ ID NO.2.

[0012] Regarding the aforementioned maize salt tolerance-related genes, the inventors of this invention discovered significant differences in salt tolerance and glycine betaine content among different inbred lines in the GWAS population. Using the GWAS population as material, this invention cloned the maize glycine betaine synthesis gene ZmGB1 (Glycine Betaine 1) using GWAS analysis and other bioinformatics methods. The coding region of this gene is 921 bp in length (see SEQ ID No. 1 for the detailed sequence) and encodes 306 amino acids (see SEQ ID No. 2 for the detailed sequence).

[0013] On the other hand, the present invention provides a salt-tolerant QTL for maize, characterized in that the QTL is located at position 87677579-87677606 on chromosome 3.

[0014] On the other hand, the present invention provides a molecular marker related to maize salt tolerance, wherein the molecular marker is a nucleotide sequence shown in SEQ ID NO.3 or SEQ ID NO.4, which shows the SEQ ID NO.3 or SEQ ID NO.4 type in the above-mentioned maize salt tolerance related genes or maize salt tolerance QTLs.

[0015] Furthermore, individuals with the nucleotide sequence shown in SEQ ID No. 3 among the salt-tolerant QTLs are salt-tolerant; individuals with the nucleotide sequence shown in SEQ ID No. 4 among the salt-tolerant QTLs are salt-sensitive.

[0016] On the other hand, the present invention provides a kit for identifying whether maize is salt-tolerant, the kit comprising primer pair ZmGB1-F1 and primer ZmGB1-R1 for detecting the aforementioned molecular marker:

[0017] Primer ZmGB1-F1: GCAGACGTACGTAGGCAGAA (SEQ ID NO.11);

[0018] Primer ZmGB1-R1: CTGTCTCAGCCCACGTCAT (SEQ ID NO.12).

[0019] Furthermore, the kit also includes enzymes and other reagents for PCR amplification using the primer pairs described above. The enzymes and other reagents for PCR amplification include, but are not limited to, various polymerases, dNTPs, buffers, etc. These reagents can be commercially available ready-made reagents or kits, or they can be custom-prepared and designed based on reference books in the field of molecular biology such as *Molecular Cloning*.

[0020] On the other hand, the present invention provides a method for identifying whether corn is salt-tolerant, the method comprising:

[0021] (1) Extract genomic DNA from the maize to be tested;

[0022] (2) Amplify maize genomic DNA using the following primer pairs:

[0023] Primer ZmGB1-F1: GCAGACGTACGTAGGCAGAA (SEQ ID NO.11),

[0024] Primer ZmGB1-R1: CTGTCTCAGCCCACGTCAT (SEQ ID NO.12);

[0025] (3) Determine whether the corn to be tested is salt-tolerant based on the amplification results: if a 119bp fragment is obtained, the corn to be tested is salt-tolerant; if a 110bp fragment is obtained, the corn to be tested is salt-sensitive.

[0026] Furthermore, the nucleotide sequence of the 119bp fragment is SEQ ID NO.3, and the nucleotide sequence of the 110bp fragment is SEQ ID NO.4.

[0027] Further, the PCR system used for amplification in step (2) is a 20 μl system, including: 10 μl of 2×Super MultiplexPCR Mix, 1 μl of 10 μM Primer ZmGB1-F1, 1 μl of 10 μM Primer ZmGB1-R1, 1 μl of extracted maize genomic DNA, and 7 μl of diH2O.

[0028] Further, the PCR program used for amplification in step (2) is as follows: first, pre-denaturation at 94℃ for 2 min; then, 34 cycles are performed: denaturation at 94℃ for 30 s, annealing at 56℃ for 30 s, extension at 72℃ for 30 s; and finally extension at 72℃ for 5 min.

[0029] Furthermore, in step (3), the amplification results are observed by electrophoresis, enzyme digestion, or sequencing.

[0030] Further, in step (1), maize seeds are used to extract genomic DNA from the maize to be tested.

[0031] On the other hand, the present invention provides the application of the above-mentioned reagent kits, molecular markers or methods in salt-tolerant maize breeding.

[0032] Furthermore, salt-tolerant maize is used in the breeding process in this application.

[0033] Beneficial effects:

[0034] (1) This invention provides a novel major salt-tolerant QTL for maize, and the nucleotide sequence of its associated salt-tolerant QTL gene. Within this salt-tolerant QTL gene, a fragment located in its intron that is deleted or inserted, and linked to maize salt tolerance, has been identified. The insertion or deletion of this fragment can serve as a molecular marker for maize salt tolerance. This invention also provides primer pairs and a kit for detecting the maize salt-tolerant molecular marker of this invention, as well as a method for detecting whether maize is salt-tolerant.

[0035] (2) Since salt tolerance in maize is a quantitative trait, phenotypic analysis is time-consuming and laborious. The above-mentioned major salt tolerance QTLs, salt tolerance QTL genes, molecular markers, primer pairs and kits can all be applied to salt tolerance breeding of maize. They can be identified during the seed stage or the early stage of cotyledon growth, which is time-saving and accurate and can accelerate the breeding process of salt-tolerant maize varieties. Attached Figure Description

[0036] Figure 1 The diagram shows the major salt tolerance locus identified in the salt tolerance gene ZmGB1 based on GWAS population analysis, and the location of its related gene ZmGB1 (Part A); a schematic diagram of the PbCXUN-Myc-ZmGB1 vector structure (Part B); and the detection of overexpression levels in overexpression lines (Part C).

[0037] Figure 2 Schematic diagram of the structure of the ZmGB1 gene.

[0038] Figure 3 The results showed that wild-type and ZmGB1 gene-overexpressing plants (ZmGB1) grew for 2 weeks under control or salt treatment conditions OE -1, ZmGB1 OE -2) growth status (Part A); wild-type and ZmGB1 overexpressing plants that grew for 2 weeks under control or salt treatment conditions (ZmGB1 OE -1, ZmGB1 OE -2) glycine betaine compound content (part B); wild-type and ZmGB1 gene overexpressing plants under control or salt treatment conditions (ZmGB1 OE -1, ZmGB1 OE -2) Biomass measurement results (Part C).

[0039] Figure 4 Results of resequencing and re-identification of candidate gene associations for the ZmGB1 gene in different maize inbred lines.

[0040] Figure 5 Identification of nucleotide sequences that differ between sensitive materials (B73 and Zheng58); Part A shows the position of the identified deletion fragment ZmGB1-Del; Part B shows the sequence comparison of PCR fragments amplified from haplotype 1 (taking B73 as an example) and haplotype 2 (taking Zheng58 as an example), as well as the positions of primers ZmGB1-F1 and ZmGB1-R1 used to amplify the deletion fragment.

[0041] Figure 6 The results are from PCR amplification performed using a primer pair (primer pair I) in B73 and Zheng58.

[0042] Figure 7 The results show the comparison of the content and biomass of glycine betaine, a compound in maize inbred line hap1 (salt-tolerant) and hap2 (salt-sensitive). Detailed Implementation

[0043] The following embodiments are provided to better understand the present invention, but are not limited thereto. These embodiments are for illustrative purposes only and do not limit the scope of protection of the present invention in any way.

[0044] Unless otherwise specified, the equipment and reagents used in each embodiment are all commercially available.

[0045] Example 1: Cloning and Functional Analysis of Maize Salt Tolerance Gene

[0046] Salt tolerance varied significantly among different inbred lines, with different glycine betaine contents observed under 100 mM NaCl treatment. Using betaine content as a physiological indicator, genome-wide association analysis revealed a significant effector locus at position 87677578 on chromosome 3. This peak snp is located on gene ZmGB1, which encodes an aldehyde oxygenase. Figure 1 As shown in Part A.

[0047] To obtain ZmGB1 overexpressing plants, (1) based on the prediction of the ZmGB1 gene structure from the MaizeGDB website, the full-length gene (from start codon to stop codon) is 1729 bp, containing five exons and four introns, of which the coding region sequence is 921 bp in length (SEQ ID NO.1, the encoded protein sequence is SEQ ID NO.2), as shown below. Figure 2As shown. (2) In order to clone the full-length coding sequence of ZmGB1, salt-tolerant maize inbred line B73 seedlings that had grown for 10 days were used as material. Total RNA was extracted using the plant total RNA extraction kit (Cat.#DP432) of Tiangen Biotech (Beijing) Co., Ltd., and cDNA was obtained by reverse transcription using M-MLV reverse transcriptase of Promega (Beijing) Biotechnology Co., Ltd. ZmGB1-specific primers (forward primer ZmGB1-gene-F: AATACTATGATCCCCTACGCGACTGCG (SEQ ID No. 5); reverse primer ZmGB1-gene-R: AATACTTCAGGCACAAAAATATCTG (SEQ ID No. 5)). No. 6) was subjected to PCR amplification, and a product matching the expected size (933bp) was obtained. The PCR product was recovered and purified using the gel recovery kit (Cat.#DP105-3) of Tiangen Biotech (Beijing) Co., Ltd.; (3) The recovered PCR fragment and the pBCXUN-Myc vector digested with XcmⅠ were ligated, and the ligation product was transformed into E. coli. Colony PCR amplification was performed using the primers Ubip-seq-F (TTTTAGCCCTGCCTTCATACGC SEQ ID No. 7) and NosR-seq-R (AGACCGGCAACAGGATTCAATC SEQ ID No. 8) on the vector. Colonies with the target size band were detected by electrophoresis as positive clones. The corresponding bacterial solution was sent to Beijing Sanbo Yuanzhi Biotechnology Co., Ltd. for sequencing to obtain the correct pBCXUN-Myc-ZmGB1 vector ( Figure 1 (Part B) pBCXUN-Myc-ZmGB1 was transferred into Agrobacterium EHA105; (3) transgenic plants were obtained by embryo infection; (4) the expression level of ZmGB1 gene in the plants was detected. Figure 1 (Part C of the gene) was sequenced to identify transgenic positive plants. Ultimately, two overexpression materials of the ZmGB1 candidate gene (named ZmGB1) were obtained. OE -1 and ZmGB1 OE -2). For example... Figure 3 As shown in Part A, the plants overexpressing the ZmGB1 gene are no different from wild-type plants under normal conditions, but exhibit a more salt-tolerant phenotype under salt stress.

[0048] Bioinformatics predicted that ZmGB1 encodes an aldehyde oxygenase. The content of glycine betaine, the main regulated compound of ZmGB1, was determined by metabolite content phenotypic assay. The specific experimental procedure was as follows: (1) Take the aerial parts of ZmGB1 overexpressing plants that have grown for 12 days, freeze them in liquid nitrogen and grind them; (2) Weigh two 100mg powders into 1.5ml centrifuge tubes, add 1ml MeOH to one tube and 1ml 75% MeOH to the other tube, and extract by low-temperature ultrasonication for 30min; (3) Take 700μl of each sample extracted by different extracts and mix them, shake them at low temperature for 1h; (4) After centrifugation, take 600μl of the liquid and put it into 1.5ml centrifuge tubes, and suspend it in a rotary evaporator for 3h; (5) Add 100μl 50% MeOH to each sample to reconstitute, filter the sample and run it through an instrument, and count the content of compounds in the sample. Figure 3 As shown in Part B, the glycine betaine compound content in the aboveground parts of plants overexpressing ZmGB1 was significantly increased. This indicates that the salt-tolerant gene aldehyde oxygenase GB1 is a candidate gene affecting the betaine content of plants.

[0049] Meanwhile, experiments measuring the biomass of ZmGB1-overexpressing plants showed that plants with higher glycine betaine content were more salt-tolerant. Figure 3 (Part C of the experiment). The specific experimental procedure is as follows: Take the aboveground parts of ZmGB1 gene-overexpressing plants that have grown for 12 days and weigh them fresh. Figure 3 As shown in section C, the aboveground biomass of plants overexpressing the ZmGB1 gene was significantly increased compared to the wild type. This indicates that the salt-tolerant gene ZmGB1 can regulate maize salt tolerance by controlling the synthesis of the compound glycine betaine under salt stress.

[0050] Example 2: Obtaining the natural variant fragment (ZmGB1-Del16) of the maize salt-tolerant QTL gene ZmGB1

[0051] Candidate gene association analysis was performed on the resequencing results of 160 inbred lines based on the SNP corresponding to the highest effect value of glycine betaine in the GWAS. Analysis of the genome sequences of the backbone inbred lines B73 and ZmGB1 in Zheng 58 revealed a significant correlation between Del16 (a 11994 bp deletion / insertion) and glycine betaine content. Figure 4As shown in Part A. Taking B73 and Zheng 58 as examples, the ZmGB1 gene was resequencing (sequencing was completed at Beijing Qingke Xinyue Biotechnology Co., Ltd.). By comparing the genome resequencing data of B73 and Zheng 58, a 11994bp deletion was found in the promoter of the ZmGB1 gene in inbred line B73, named ZmGB1-Del16 (related sequences of B73 and Zheng 58 are shown in SEQ ID NO.9 and SEQ ID NO.10, which contain part of the genome sequence). Based on the presence or absence of Del16, the 160 materials were divided into two haplotypes, Hap1 and Hap2.

[0052] q-PCR results showed significant differences in the transcriptional level of ZmGB1 between inbred lines containing Del16 and those without Del16. Figure 4 As shown in section E, Del16 caused changes in the transcriptional level of ZmGB1, which further affected the glycine betaine content and the salt tolerance of maize inbred lines.

[0053] Example 3: A fragment on the maize salt tolerance gene ZmGB1 is a molecular marker that is fully linked to ZmGB1-Del16.

[0054] Resequencing of 160 inbred lines and candidate gene association analysis revealed the existence of fragments ZmGB1M1 and ZmGB1-Del16, both fully linked to the snp Chr3_87676195 detected by resequencing. Candidate gene association results indicate that the actual site leading to ZmGB1 transcription is ZmGB1-Del16. However, due to the large size of this fragment, detection is difficult. Therefore, we used the naturally occurring variant ZmGB1M1, which is fully linked to it, to distinguish the haplotypes of ZmGB1.

[0055] Primers ZmGB1-F1 (forward) and ZmGB1-R1 (reverse) were designed based on the flanking sequences of ZmGB1M1, forming primer pair I (ZmGB1-F1 / ZmGB1-R1). Using primer pair I as primers, genomic DNA from maize inbred lines Zheng 58 and W156 was used as templates for PCR amplification. The PCR system consisted of 20 μl of: 10 μl of 2×Super MultiplexPCR Mix, 1 μl of 10 μM Primer ZmGB1-F1, 1 μl of 10 μM Primer ZmGB1-R1, 1 μl of DNA, and 7 μl of diH2O. The PCR program was as follows: pre-denaturation at 94℃ for 2 min, denaturation at 94℃ for 30 s, annealing at 56℃ for 30 s, extension at 72℃ for 30 s, repeated 34 times from denaturation to extension, with a final extension at 72℃ for 5 min. The results showed that PCR amplification using maize inbred line B73 as a template yielded a 119 bp band with primer pair I (detailed sequence in SEQ ID NO.3); PCR amplification using total DNA from maize inbred line Zheng 58 as a template yielded a 110 bp band with primer pair I (detailed sequence in SEQ ID NO.4). Figure 6 As shown. Therefore, primer pair I can be used for molecularly assisted breeding of salt-tolerant maize, and the salt-tolerant molecular marker based on primer pair I is named ZmGB1M1. The sequences of each primer are as follows:

[0056] Primer ZmGB1-F1: GCAGACGTACGTAGGCAGAA;

[0057] Primer ZmGB1-R1: CTGTCTCAGCCCACGTCAT.

[0058] Example 4: Detecting salt tolerance in maize using salt-tolerant molecular markers

[0059] Fifty maize inbred lines (including some core maize inbred lines) were selected for testing. The detection method was as described in Example 3, using the primer pairs for detecting the salt-tolerant molecular markers of the present invention in Example 3, and PCR amplification was performed using the maize genomic DNA to be tested as a template. The results showed that the PCR product length of primer pair I for 25 inbred lines was 119 bp, indicating a salt-tolerant genotype; the PCR product length of primer pair I for the other 25 inbred lines was 110 bp, indicating a salt-sensitive genotype. The names of the inbred lines used and the identification results are shown in the table below:

[0060] Table 1. Results of inbred line identification

[0061]

[0062]

[0063] Under salt stress, the glycine betaine content in the leaves of salt-tolerant genotypes (hap1, with ZmGB1-Del16 deletion, and ZmGB1M1 as SEQ ID NO.3) was significantly higher than that of salt-sensitive genotypes (hap2, without ZmGB1-Del16 deletion, and ZmGB1M1 as SEQ ID NO.4); simultaneously, the biomass decline rate of salt-tolerant genotypes (hap1, with ZmGB1-Del16 deletion, and ZmGB1M1 as SEQ ID NO.3) was significantly lower than that of salt-sensitive genotypes (hap2, without ZmGB1-Del16 deletion, and ZmGB1M1 as SEQ ID NO.4). Related test results are as follows... Figure 7 As shown, this is consistent with the results of the salt-tolerant molecular marker identification.

Claims

1. A method for identifying whether a maize is salt tolerant, characterized in that, The method comprises: (1) extracting the genomic DNA of the corn to be tested; (2) amplifying the corn genomic DNA using the following primer pairs: Primer ZmGB1-F1: GCAGACGTACGTAGGCAGAA; Primer ZmGB1-R1: CTGTCTCAGCCCACGTCAT; (3) judging whether the corn to be tested is salt-tolerant according to the amplification results: if a 119bp fragment is amplified, the corn to be tested is salt-tolerant; if a 110bp fragment is amplified, the corn to be tested is salt-sensitive.

2. The method according to claim 1, wherein the nucleotide sequence of the 119bp fragment in step (3) is SEQ ID NO. 3, and the nucleotide sequence of the 110bp fragment is SEQ ID NO.

4.

3. The method according to claim 1, wherein the PCR system used for the amplification of step (2) is a 20 μl system comprising: 2xSuper Multiplex PCR Mix 10μl, 10μM Primer ZmGB1-F1 1μl, 10μM Primer ZmGB1-R1 1μl, the corn genomic DNA extracted in step (1) 1μl, diH2O 7μl; the PCR program used in step (2) is as follows: first, 94℃ pre-denaturation for 2min; then, 34 cycles of 94℃ denaturation for 30s, 56℃ annealing for 30s, and 72℃ extension for 30s; finally, 72℃ extension for 5min.

4. The use of the method according to any one of claims 1-3 in the breeding of salt-tolerant corn.