Quality control product for gene detection as well as preparation method and application of quality control product

Abstract

The invention relates to the technical field of biology, in particular to a nucleic acid fragment for gene detection, a recombinant vector, a host cell and application. The invention provides a positive quality control product for multi-gene detection. The positive quality control substance mainly comprises positive quality control plasmids and a diluent, target sequences of the positive quality control plasmids are connected in series through blocking sequences, and the problem that the quality control substance in a multi-gene detection kit is formed by mixing a plurality of plasmids and needs to be cryopreserved is solved. The positive quality control plasmid is good in amplification effect, high in amplification efficiency and high in specificity, a diluent is optimized, and on the basis of the positive quality control plasmid, a quality control product prepared from the diluent is better in stability and more convenient to use, can be taken at any time when used and does not need to be repeatedly frozen and thawed.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to quality control products for gene detection, and preparation methods and applications thereof. Background Art

[0002] Genetic testing generally refers to DNA testing, that is, detecting DNA sequences at the genome level. Genetic testing can be used to reveal differences in the human genome or identify certain pathogens. For human genome testing, gene amplification testing can identify single-base mutations, deletions, insertions, and gene fusions of genes, etc., which are used to reveal differences in the human genome and identify genetic variations that may increase or decrease the risk of disease, thus playing an important role in understanding individual health status and disease risks. In terms of medical health, genetic testing can help understand whether there are genetic variations that may be inherited by offspring, and can help screen out embryos with normal chromosome structures to reduce the risk of genetic diseases. In addition, some gene mutations will not cause changes in human diseases, but will show differences in some medications. This difference can be reflected in three aspects: efficacy, dosage, toxic and side effects, etc. For pathogen detection, the infection type of pathogenic microorganisms can be clarified based on the results of genetic testing, such as bacteria, viruses, parasites, mycoplasma, chlamydia, streptococcus and other pathogenic microorganisms.

[0003] The positive quality control products in the existing gene detection kits are basically nucleic acids or plasmids containing target sequences. Different manufacturers insert the target sequence into the plasmid according to the target sequence detected by their nucleic acid detection products. Generally, multiple plasmids are mixed to obtain positive quality control products. At present, most manufacturers' quality control products are ancillary products of the test kits. They are stored at -20°C in accordance with the storage conditions of the reagents, which is inconvenient to use. In addition, if multiple targets are detected, multiple plasmids are mixed. There is a problem of different amplification efficiencies caused by different feed concentrations of different plasmids. Therefore, in the process of preparing quality control products, the mixing of multiple plasmids requires multiple concentration adjustments to ensure that the final amplification efficiency is consistent. The preparation process is time-consuming and labor-intensive. Therefore, there is an urgent need to provide a positive quality control product for gene detection with a simple production method and usage conditions and stable storage. Summary of the invention

[0004] In view of this, the technical problem to be solved by the present invention is to provide a quality control product for gene detection, a preparation method and application thereof.

[0005] The present invention provides a nucleic acid fragment, which includes a plurality of target sequences and a blocking sequence located between the target sequences;

[0006] The blocking sequence is not less than 10 bp;

[0007] The blocking sequence comprises a repeated base sequence of no less than 5 bp;

[0008] The blocking sequence cannot bind to the primer used for amplifying the target sequence;

[0009] The amplification primers include upstream amplification primers and downstream amplification primers.

[0010] Furthermore,

[0011] The repeated base sequence is located at the 5' end, 3' end or any position in the middle of the blocking sequence;

[0012] The blocking sequence is 10 to 100 bp.

[0013] One step closer,

[0014] The plurality is two or more than two, and the two or more includes 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, etc.;

[0015] The number of the blocking sequences is m, wherein m is an integer from 1 to 20; the number of the blocking sequences is the number of the target sequences minus 1.

[0016] In the present invention, the nucleic acid fragment may be linear or circular; may be single-stranded or double-stranded, which is not limited in the present invention; the nucleic acid fragment may be DNA or RNA, and the RNA may be formed into the DNA by reverse transcription, which is not limited in the present invention; in the specific embodiment of the present invention, it is in the form of DNA.

[0017] In the present invention, the blocking sequences used corresponding to different target sequences may be the same or different; in practical applications, multiple target sequences may be connected by multiple blocking sequences; the multiple blocking sequences may be the same or different, and the blocking sequences cannot bind to the primers used to amplify the target sequences; the binding includes specific binding and non-specific binding. Further, the term "binding" used in this specification means that single-stranded nucleic acids of complementary chains form double-stranded nucleic acids. Binding occurs when the complementarity between the two nucleic acid chains is completely matched, or binding can occur even if there are some mismatched bases.

[0018] Furthermore, in a specific embodiment of the present invention,

[0019] The nucleic acid fragments include nucleic acid fragment A and / or nucleic acid fragment B;

[0020] The nucleic acid fragment A includes a blocking sequence having a nucleotide sequence as shown in SEQ ID NO:7 and a target sequence having a nucleotide sequence as shown in SEQ ID NO:1 to SEQ ID NO:6;

[0021] The nucleic acid fragment B includes a blocking sequence having a nucleotide sequence as shown in SEQ ID NO:27 and a target sequence having a nucleotide sequence as shown in SEQ ID NO:24 to SEQ ID NO:26.

[0022] Furthermore,

[0023] The nucleotide sequence of the nucleic acid fragment A comprises: a target sequence as shown in SEQ ID NO: 1 to SEQ ID NO: 6, which is sequentially connected in series through a blocking sequence as shown in SEQ ID NO: 7;

[0024] The nucleotide sequence of the nucleic acid fragment B includes: a target sequence as shown in SEQ ID NO:24 to SEQ ID NO:26, which is sequentially connected in series through a blocking sequence as shown in SEQ ID NO:27.

[0025] In the present invention, the blocking sequence matching the target sequence in nucleic acid fragment A is shown in SEQ ID NO: 7, which is 67 bp in length, does not bind to the amplification primer used for detecting the target sequence in nucleic acid fragment A, and has 9 repeated thymine ts at its 5' end;

[0026] In the present invention, the target sequence in the nucleic acid fragment A is a gene fragment of different types of CYP2C19, which has high homology and is used to develop a blocking sequence suitable for a target sequence with high homology. In a specific embodiment of the present invention, a blocking sequence of a nucleotide sequence as shown in SEQ ID NO:7 is used to connect different types of CYP2C19 target sequences (the length of the above target sequence is 501bp) in series to prepare a positive quality control plasmid, and a primer set and a probe for different types of CYP2C19 target sequences are used for detection. The test results show that without adding a blocking sequence and adding other blocking sequences (SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, the lengths of the above blocking sequences are 62bp, 61bp, 13bp, and 13bp, respectively; the 3' end of the blocking sequence of the nucleotide sequence of SEQ ID NO:8 has 11 repeated guanine g, the middle of the blocking sequence of the nucleotide sequence of SEQ ID NO:9 has 12 repeated adenine a, and the nucleotide sequence of SEQ ID NO:11 has 12 repeated adenines. The positive quality control plasmids (the blocking sequence of the nucleotide sequence described in NO:10 has 5 repeated thymine ts at the 5' end, and the blocking sequence of the nucleotide sequence described in SEQ ID NO:11 does not have repeated bases) have obvious differences in amplification efficiency between the wild type and the mutant type, and the amplification curve shows a re-jump phenomenon in the plateau phase. However, the plateau phase amplification curve after using the blocking sequence described in the present invention is normal, the amplification efficiency is good, and the specificity is strong.

[0027] In the present invention, the blocking sequence matching the target sequence in nucleic acid fragment B is shown in SEQ ID NO: 27, which is 62 bp in length, does not bind to the amplification primer used for detecting the target sequence in nucleic acid fragment A, and has 9 repeated guanine g at its 3' end;

[0028] In the present invention, the target sequence in the nucleic acid fragment B is a target sequence with high conservatism and strong specificity for Chlamydia trachomatis (CT), Neisseria gonorrhoeae (NG) and Ureaplasma (UU), and its homology is relatively low, and is used to develop a blocking sequence suitable for a target sequence with low homology. In a specific embodiment of the present invention, a blocking sequence of a nucleotide sequence as shown in SEQ ID NO: 27 is used to connect different pathogen target sequences in series to prepare a positive quality control plasmid. The test results show that the detection result of the blocking sequence is more accurate, the amplification efficiency is good, and the specificity is strong.

[0029] The present invention develops a nucleic acid fragment that can be used for gene detection. The nucleic acid fragment is recombined with the plasmid vector to form a recombinant vector. The recombinant vector is a positive quality control plasmid. The positive quality control plasmid includes a target sequence with relatively high conservatism and specificity and a blocking sequence for spacing the target sequence; the blocking sequence has low homology with the target sequence, and the blocking sequence cannot be combined with the primer used for amplification of the target sequence, thereby achieving the purpose of blocking amplification; in a specific embodiment of the present invention, the blocking sequence is optimized, and the amplification effect of the positive quality control product without adding the blocking sequence is poor, and the blocking amplification effect is not obvious when the blocking sequence is short (such as comparative example plasmid 1 and comparative example plasmid 2). The synthesis cost is increased when the sequence is too long, and the plasmid can generally only accommodate no more than 3kb of exogenous DNA. For the detection of multiple target sequences, the introduction of strings of nucleotides on the non-homologous sequence further limits the length of the blocking sequence. After many attempts, the present invention found that the amplification effect of the positive quality control product is best when the blocking sequence meets the following conditions at the same time: the length is 40 to 100bp, and the 5' end needs to contain 5 to 30 repeated base sequences.

[0030] The present invention provides a recombinant vector, which comprises the nucleic acid fragment of the present invention;

[0031] In a specific embodiment of the present invention, the target sequence and the blocking sequence are recombined with a vector to obtain a recombinant vector, and the recombinant vector is used as a positive quality control plasmid in the present invention; wherein the sum of the lengths of the target sequence and the blocking sequence is less than 3 kb. If the sum of the lengths of the target sequence and the blocking sequence is too large, the plasmid transformation process will be unstable and there will be a risk of plasmid loss;

[0032] Recombinant vector of the present invention refers to a recombinant nucleic acid vector, which is a recombinant DNA molecule, comprising a desired coding sequence and an appropriate nucleic acid sequence or element that is essential for the expression of an operably connected coding gene in a specific host organism. Known prokaryotes utilize promoters, enhancers and terminators. Once transformed into a suitable host, the vector can be replicated and play a role independently of the host genome, or, in some cases, self-integrated into the genome. In this specification, "plasmid" and "vector" can sometimes be interchanged and used, because plasmid is the most commonly used vector form. However, the present invention is intended to include such other forms of expression vectors, which play an equivalent role, which is known or will become known in the art, including but not limited to: plasmid, phage particle, viral vector and / or only potential genome insert. In a specific embodiment, the nucleic acid encoding the fusion protein provided by the present invention can be constructed in various eukaryotic expression vectors.

[0033] In the present invention, the sources of the plasmid vector include plants, animals, bacteria, fungi, bacteriophages, or viruses, which are not limited in the present invention.

[0034] Furthermore, the plasmid vector described in the present invention can be a cloning vector, an expression vector or other vector forms, and the present invention is not limited to this. In a specific embodiment of the present invention, the vector is a cloning vector, specifically a vector derived from bacteria, namely pUC57.

[0035] The present invention provides a host cell, which is transfected or transformed with the recombinant vector of the present invention; the recombinant vector constructed by recombinant DNA technology is used to transform or transfect the host cell, so that the recombinant vector can replicate competently in the host cell.

[0036] Furthermore, the transformation methods include chemical transformation and electrotransformation; the transfection methods include calcium phosphate coprecipitation, artificial liposome method, and viral transfection. The viral transfection includes adenovirus transfection, adeno-associated virus transfection, lentivirus transfection, and the like.

[0037] The host cell provided by the present invention may be derived from plants, animals, bacteria, fungi, bacteriophages or viruses, which are not limited by the present invention. In a specific embodiment of the present invention, the host cell is derived from bacteria, specifically Escherichia coli.

[0038] The present invention provides a detection composition, which comprises at least one of the following i) to iii) and the primers and probes for amplifying the target sequence in the nucleic acid fragment of the present invention:

[0039] i) the nucleic acid fragment of the present invention;

[0040] ii), the recombinant vector of the present invention;

[0041] iii) the host cell of the present invention.

[0042] The primers and probes used for amplifying the target sequence include at least one of the following two groups:

[0043] Group 1: a wild-type upstream primer of the nucleotide sequence shown in SEQ ID NO: X; a downstream primer of the nucleotide sequence shown in SEQ ID NO: (X+2), a probe of the nucleotide sequence shown in SEQ ID NO: (X+3) and a mutant upstream primer of the nucleotide sequence shown in SEQ ID NO: (X+1); X is 12, 16 and / or 20; and / or

[0044] Group 2: an upstream primer of the nucleotide sequence shown in SEQ ID NO: N, a downstream primer of the nucleotide sequence shown in SEQ ID NO: (N+1) and a probe of the nucleotide sequence shown in SEQ ID NO: (N+2), wherein N is 28, 31 and / or 34.

[0045] Wherein, the primers and probes used for amplifying the target sequence in nucleic acid fragment A are as shown in group 1; the primers and probes used for amplifying the target sequence in nucleic acid fragment B are as shown in group 2;

[0046] The present invention provides a reagent combination, which includes at least one of the nucleic acid fragment, the recombinant vector, the host cell and / or the detection composition described in the present invention and a diluent;

[0047] The diluent comprises: 0.8-1.2M Taps, 1.0-3.0g / L preservative, 0.35-0.4g / L EDTA·2Na and / or 1.5-2.5g / L trehalose.

[0048] Furthermore, the preservative includes at least one of P300, P950 and / or NaN3.

[0049] Furthermore,

[0050] The diluent comprises: 0.8-1.2M Taps, 1.5g / L P950, 1g / L NaN3, 0.375g / L EDTA·2Na and 2g / L trehalose;

[0051] The present invention optimizes the diluent in the reagent combination. In a specific embodiment of the present invention, the test results show that when the solvent of the diluent is 1M Taps buffer, and the solute of the diluent includes 1.5g / L P950, 0.375g / L EDTA·2Na, and 2g / L trehalose, the detection result stability is the best, and the storage time has the least effect on the detection effect.

[0052] The present invention provides a method for multi-gene detection, which is to detect a sample using at least one of the following I) to V):

[0053] 1), the nucleic acid fragment of the present invention;

[0054] II), the recombinant vector of the present invention;

[0055] III), the host cell of the present invention;

[0056] IV), the detection composition of the present invention;

[0057] V), the reagent combination described in the present invention.

[0058] Furthermore, the PCR program for testing the samples was: 95°C for 2 minutes, 1 cycle; 95°C for 10 seconds, 60°C for 35 seconds, 45 cycles.

[0059] The present invention provides a positive quality control plasmid for CYP2C19 genotyping detection, wherein the positive quality control plasmid comprises a vector backbone and a nucleic acid fragment;

[0060] The nucleic acid fragment includes a target sequence and a blocking sequence located between the target sequences;

[0061] The nucleotide sequence of the blocking sequence is shown in SEQ ID NO:7;

[0062] The nucleotide sequence of the target sequence is shown in SEQ ID NO: 1 to SEQ ID NO: 6;

[0063] Furthermore, in the present invention, the nucleic acid fragment comprises:

[0064] The target sequences as shown in nucleotide sequences such as SEQ ID NO: 1 to SEQ ID NO: 6 are sequentially connected in series through the blocking sequence as shown in nucleotide sequence such as SEQ ID NO: 7;

[0065] Furthermore, in the positive quality control plasmid of the present invention,

[0066] The vector backbone is pUC57.

[0067] The present invention provides a detection composition for CYP2C19 genotyping, which comprises a positive quality control plasmid for CYP2C19 genotyping detection and a primer set and a probe with a nucleic acid fragment of the positive quality control plasmid for CYP2C19 genotyping detection as a target; the primer set and the probe with the nucleic acid fragment as a target comprise: a wild-type upstream primer with a nucleotide sequence as shown in SEQ ID NO: X; a downstream primer with a nucleotide sequence as shown in SEQ ID NO: (X+2), a probe with a nucleotide sequence as shown in SEQ ID NO: (X+3) and a mutant upstream primer with a nucleotide sequence as shown in SEQ ID NO: (X+1); wherein X is 12, 16 and / or 20;

[0068] The present invention provides a positive quality control plasmid for CT, NG, and UU gene detection, wherein the positive quality control plasmid comprises a vector backbone and a nucleic acid fragment;

[0069] The nucleic acid fragment includes a target sequence and a blocking sequence located between the target sequences;

[0070] The nucleotide sequence of the blocking sequence is shown in SEQ ID NO: 27;

[0071] The nucleotide sequence of the target sequence is shown in SEQ ID NO:24 to SEQ ID NO:26;

[0072] Furthermore, in the present invention, the positive quality control fragment includes:

[0073] The target sequences having the nucleotide sequences shown in SEQ ID NO:24 to SEQ ID NO:26 are sequentially connected in series through the blocking sequence having the nucleotide sequence shown in SEQ ID NO:27.

[0074] The present invention provides a detection composition for CT, NG, and UU genes, which includes a positive quality control plasmid for CT, NG, and UU gene detection and a primer set and a probe with a nucleic acid fragment of the positive quality control plasmid for CT, NG, and UU gene detection as a target; the primer set and the probe with the nucleic acid fragment as a target include: an upstream primer with a nucleotide sequence as shown in SEQ ID NO: N, a downstream primer with a nucleotide sequence as shown in SEQ ID NO: (N+1) and a probe with a nucleotide sequence as shown in SEQ ID NO: (N+2); wherein N is 28, 31 and / or 34.

[0075] Furthermore,

[0076] The 5' end of each probe is coupled to a fluorescent group, and the 3' end is coupled to a fluorescent quenching group;

[0077] The fluorescent group is selected from any one of FAM, HEX, VIC, ROX or CY-5;

[0078] The fluorescence quenching group is selected from any one of BHQ1, MGB or BHQ2.

[0079] Each probe has a different fluorescent group coupled to the 5' end, and each probe has a different fluorescent quenching group coupled to the 3' end.

[0080] The present invention provides a reagent combination, which comprises:

[0081] The positive quality control plasmid and diluent of the present invention; or

[0082] The detection composition and diluent of the present invention.

[0083] Furthermore,

[0084] The diluent comprises: 0.8-1.2M Taps, 1.0-3.0g / L preservative, 0.35-0.4g / L EDTA·2Na and / or 1.5-2.5g / L trehalose;

[0085] The preservative includes at least one of P300, P950 and / or 10% NaN3.

[0086] Further, 0.8-1.2 M Taps, 1.5 g / L P950, 1 g / L NaN3, 0.375 g / L EDTA·2Na and 2 g / L trehalose;

[0087] The present invention provides a method for multi-gene detection, which is to detect a sample using at least one of the following I) to IV):

[0088] 1), the positive quality control fragment of the present invention;

[0089] II), the positive quality control plasmid of the present invention;

[0090] III), the detection composition of the present invention;

[0091] IV), the reagent combination described in the present invention.

[0092] The PCR program for further testing of the samples was: 95°C for 2 minutes, 1 cycle; 95°C for 10 seconds, 60°C for 35 seconds, 45 cycles.

[0093] The present invention provides a method for CYP2C19 genotyping detection, which uses the positive quality control plasmid for CYP2C19 genotyping detection and / or the detection composition for CYP2C19 genotyping and / or the reagent combination for detection according to the present invention.

[0094] The present invention provides a method for CT, NG, and UU gene detection, which utilizes the positive quality control plasmid for CT, NG, and UU gene detection described in the present invention, and / or a detection composition for CT, NG, and UU genes, and / or a reagent combination for detection.

[0095] The reagent combination of the present invention is a detection quality control reagent, which is used for quality control during gene detection. However, the quality control products currently used in clinical trial laboratories are basically ancillary products of listed nucleic acid detection products, and there are many unstable factors such as poor stability and large batch variation; and the quality control products of each manufacturer need to be stored at -20 ° C, which is inconvenient to use, and repeated freezing and thawing has a greater impact on the test results; in addition, it was found in the design and verification process of the plasmid that directly inserting multiple target gene sequences into the same plasmid will cause different amplification efficiencies of the target gene, and multiple joint amplification products of target genes appear in the late amplification period. The specific reason is that two target gene fragments are inserted into the plasmid, and the upstream primer of the gene of the first item and the downstream primer of the gene of the second item act together to amplify a long sequence in series, resulting in no plateau phase of amplification or a re-jump phenomenon of the amplification curve in the late amplification plateau phase. If multiple plasmids are designed according to the target sequences to be amplified, there is a problem of inconsistent amplification efficiency after mixing, and it is time-consuming and laborious to adjust the concentrations of different plasmids to ultimately make the amplification efficiency consistent in the adapted reaction system. Therefore, the present invention has developed an improved plasmid design method through multiple attempts, which can be used for quality control of multi-target gene detection and has broad application prospects in the field of biological detection. In the present invention, a positive quality control plasmid with multi-target pathogen sequences is developed for the detection of multiple pathogens.

[0096] The present invention provides a positive quality control product for multi-gene detection; the positive quality control product mainly comprises a recombinant plasmid (positive quality control plasmid) and a diluent, the target sequences of the recombinant plasmid are connected in series through a blocking sequence, thereby overcoming the problem that the quality control product in the multi-gene detection kit is a mixture of multiple plasmids and needs to be frozen for storage, and the test results show that the positive quality control plasmid of the present invention has good amplification effect, high amplification efficiency, and strong specificity, and the present invention optimizes the diluent, and the quality control product prepared by using the diluent on the basis of the positive quality control plasmid of the present invention has better stability, is more convenient to use, can be taken out as needed, and does not need to be repeatedly frozen and thawed. BRIEF DESCRIPTION OF THE DRAWINGS

[0097] Figure 1 Shows the 1*2 site amplification curve of the positive quality control product;

[0098] Figure 2 Shows the 2*2 site amplification curve of the positive quality control product;

[0099] Figure 3Shows the 3*2 site amplification curve of the positive quality control product;

[0100] Figure 4 Shows the 4*2 site amplification curve of the positive quality control product;

[0101] Figure 5 Shown is the 1*2 site amplification curve for the comparison quality control product;

[0102] Figure 6 The 2*2 site amplification curve of the control product is shown for comparison. DETAILED DESCRIPTION

[0103] The present invention provides quality control products for genetic testing, preparation methods and applications thereof, and those skilled in the art can refer to the contents of this article and appropriately improve the process parameters to achieve it. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications of this article without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0104] The present invention provides an improved plasmid design method to solve the problems existing in the prior art. Multiple gene sequences can be inserted into the plasmid, and the length of the target gene sequence is a base sequence of more than 150bp. The present invention also provides a blocking sequence, which introduces a blocking sequence between the target gene sequences inserted into the plasmid, and the sequence has the following characteristics: 1. The length is 10 to 100bp; 2. The blocking sequence cannot bind to the primer used for amplifying the target sequence; 3. The 5' end of the sequence must contain no less than 5 repeated base sequences, and the longest repeated bases shall not exceed 30. If the repeated sequence is too long, it is difficult to synthesize it with the existing nucleic acid synthesis process, and it is very likely to cause the sequence sequencing signal to be low and the sequencing to fail in the verification stage after synthesis.

[0105] During the amplification process, the two target gene sequences cannot be amplified in series due to the presence of the blocking sequence, thereby achieving the purpose of increasing specificity and improving amplification efficiency.

[0106] The present invention provides a quality control product of a gene detection reagent and a preparation method thereof. The quality control product comprises a plasmid containing a target gene sequence and a diluent. The quality control plasmid contains the target gene sequence. The diluent is composed of a preservative, EDTA·2Na, trehalose and Taps. The quality control product provided by the present invention has good stability, can be stably stored for 14 days at 37°C thermal acceleration, and can be stably stored for at least 14 months at 2-8°C, and the stability is significantly better than existing products. The quality control product designed by this method is consistent with the actual sample sequence, can be used as a standard quality control product, and has strong versatility; and the product has the advantages of low cost, high stability, easy storage and transportation, etc., is suitable for large-scale production at the industrial level, is easy to apply and promote, and has important value and application prospects.

[0107] Circular DNA synthesis: Determine the target sequence, first use PCR or chemical synthesis to obtain a linear DNA template, purify the template, and use a specific endonuclease to make a cut at a specific position of the template DNA. This cut is usually located at the origin of replication. After the cut is made, the DNA chain is divided into two, one is a fixed chain with a 5' phosphate end, and the other is a free chain with a 3' hydroxyl end. The replication initiation protein (such as RepA) binds to the 5' phosphate end at the cut and attracts the helicase to unwind the DNA double helix. At the same time, DNA polymerase uses the 3' hydroxyl end of the free chain as a primer and the unbroken chain as a template to start synthesizing a new DNA chain. With the continuous synthesis of DNA polymerase, the new chain continues to extend and roll around the fixed chain to form a ring structure. When the new chain is synthesized to a certain length, it will reconnect with the 5' phosphate end of the fixed chain at the origin of replication to form a complete circular DNA molecule. Finally, the synthesized circular DNA is purified by gel electrophoresis, centrifugation, and other methods.

[0108] The test materials used in the present invention are all common commercial products and can be purchased on the market. The present invention is further described below in conjunction with the embodiments:

[0109] Example 1 Positive quality control product for CYP2C19 gene detection reagent

[0110] The positive quality control product for CYP2C19 genotyping detection is a plasmid containing CYP2C19*2 wild-type sequence, CYP2C19*2 mutant sequence, CYP2C19*3 wild-type sequence, CYP2C19*3 mutant sequence, CYP2C19*17 wild-type sequence, CYP2C19*17 mutant sequence and blocking sequence. The plasmid vector uses a commonly used mature standard vector. The plasmid vector used in the present invention is pUC57. The target sequence is as follows:

[0111] CYP2C19*2 wild-type sequence:

[0112] gattatcatctttgattctcttgtcagaattttctttctcaaatcttgtataatcagagaattactacacatgtacaataaaaatttccccatcaagatat

[0113] acaatatattttatttatatttatagttttaaattacaaccagagcttggcatattgtatctatacctttattaaatgcttttaatttaataaattattgttttct

[0114] cttagatatgcaataattttcccactatcattgattatttcccgggaacccataacaaattacttaaaaaccttgcttttatggaaagtgatattttgg

[0115] agaaagtaaaagaacaccaagaatcgatggacatcaacaaccctcgggactttattgattgcttcctgatcaaaatggagaaggtaaaatgtt

[0116] aacaaaagcttagttatgtgactgcttgcgtatttgtgattcattgactagttttgtgtttactacggatgtttaacaggtcaaggagtaatgcttgagaag(SEQ ID NO:1);

[0117] CYP2C19*2 mutant sequence:

[0118] gattatcatctttgattctcttgtcagaattttctttctcaaatcttgtataatcagagaattactacacatgtacaataaaaatttccccatcaagatat

[0119] acaatatattttatttatatttatagttttaaattacaaccagagcttggcatattgtatctatacctttattaaatgcttttaatttaataaattattgttttct

[0120] cttagatatgcaataatttcccactatcattgattatttcccaggaacccataaaattaaaaccttgctttttatggaaagtgatattttgg

[0121] agaaagtaaaagaacaccaagaatcgatggacatcaaccctcgggactttattgattgctctgatcaaaatggagaaggtaaaatgtt

[0122] aacaaaagcttagttatgtgactgcttgcgtatttgtgattcattgactagttttgtgtctacggatgtttaacaggtcaaggagtaatgcttgagaag(SEQ ID NO:2);

[0123] CYP2C19*3:

[0124] acttaaaatttctaaactattattatctgttaaaaatgaagtgttttatatctaatgtttactcatatttaaaattgttccaatcatttagcttcaccc

[0125] tgtgatcccactttcatcctgggctgtgctccctgcaatgtgatctgctccattattccagaaacgtttcgattataaagatcagcaatttcttaa

[0126] cttgatggaaaaattgaatgaaaacatcaggattgtaagcaccccctggatccaggtaaggccaagttttttgcttcctgaaaccacttaca

[0127] gtctttttttctgggaaatccaaaattctatattgaccaagccctgaagtacatttttgaatactacagtcttgcctagacagccatggggtgaata

[0128] tctggaaaagatggcaaagttctttattttatgcacaggaaatgaatatcccaatatagatcaggcttctaagcccattagctccctgatcagtgttttttccactaa(SEQ ID NO:3);

[0129] CYP2C19*3 mutant sequence:

[0130] acttaaaatttctaaactattattatctgttaacaaatatgaagtgttttatatctaatgtttactcatattttaaaattgtttccaatcatttagcttcaccc

[0131] tgtgatcccactttcatcctgggctgtgctccctgcaatgtgatctgctccattattttccagaaacgtttcgattataaagatcagcaatttcttaa

[0132] cttgatggaaaaattgaatgaaaacatcaggattgtaagcaccccctgaatccaggtaaggccaagttttttgcttcctgagaaaccacttaca

[0133] gtctttttttctgggaaatccaaaattctatattgaccaagccctgaagtacatttttgaatactacagtcttgcctagacagccatggggtgaata

[0134] tctggaaaagatggcaaagttctttattttatgcacaggaaatgaatatcccaatatagatcaggcttctaagcccattagctccctgatcagtgttttttccactaa(SEQ ID NO:4);

[0135] CYP2C19*17 wild-type sequence:

[0136] tcagttacactgagcgtttcccctctgcagtgatggagaagggagaactcttattttttctcatgagcatctctggggctgttttccttagataaat

[0137] aagtggttctatttaatgtgaagcctgttttatgaacaggatgaatgtggtatatattcagaataactaatgtttggaagttgttttgttttgctaaaa

[0138] caaagttttagcaaacgattttttttttcaaatttgtgtcttctgttctcaaagcatctctgatgtaagagataatgcgccacgatgggcatcagaag

[0139] acctcagctcaaatcccagttctgccagctatgagctgtgtggcaccaacaggtgtcctgttctcccagggtctcccttttcccatttgaaatata

[0140] aaaaataacaattcctgccttcacgtgtttttttagggggttaaatggtaaaggtgtttatatctgctaaggtaatttacttgatatatgtttggttattgaagatatatg(SEQ ID NO:5);

[0141] CYP2C19*17 mutant sequence:

[0142] tcagttacactgagcgtttcccctctgcagtgatggagaagggagaactcttattttttctcatgagcatctctggggctgttttccttagataaat

[0143] aagtggttctatttaatgtgaagcctgttttatgaacaggatgaatgtggtatatattcagaataactaatgtttggaagttgttttgttttgctaaaa

[0144] caaagttttagcaaacgattttttttttcaaatttgtgtcttctgttctcaaagtatctctgatgtaagagataatgcgccacgatgggcatcagaag

[0145] acctcagctcaaatcccagttctgccagctatgagctgtgtggcaccaacaggtgtcctgttctcccagggtctcccttttcccatttgaaatata

[0146] aaaaataacaattcctgccttcacgtgtttttttagggggttaaatggtaaaggtgtttatatctgctaaggtaatttacttgatatatgtttggttattgaagatatatg (SEQ ID NO: 6);

[0147] The positive quality control plasmid is a plasmid containing the sequence of CYP2C19*2 wild type-blocking sequence-CYP2C19*2 mutant-blocking sequence-CYP2C19*3 wild type-blocking sequence-CYP2C19*3 mutant-blocking sequence-CYP2C19*17 wild type-blocking sequence-CYP2C19*17 mutant;

[0148] Experimental group blocking sequence 1: tttttttttctgatacgaatggcttcaaaattttataaacataccaattcatgaatagtagtaaccg (SEQ ID NO: 7);

[0149] Experimental group blocking sequence 2: cgaatggcttcaaaattttataaacataccaattcatgaatagtagtaaccggggggggggg (SEQ ID NO: 8);

[0150] Experimental group blocking sequence 3: cgaatggcttcaaaattttataaaaaaaaaaaaacataccaattcatgaatagtagtaaccg (SEQ ID NO: 9);

[0151] Experimental group blocking sequence 4: tttttctgat (SEQ ID NO: 10);

[0152] Comparative example blocking sequence 1: atgcgactgacta (SEQ ID NO: 11);

[0153] The experimental group plasmid 1 is a plasmid containing CYP2C19*2 wild type-experimental group blocking sequence 1-CYP2C19*2 mutant-experimental group blocking sequence 1-CYP2C19*3 wild type-experimental group blocking sequence 1-CYP2C19*3 mutant-experimental group blocking sequence 1-CYP2C19*17 wild type-experimental group blocking sequence 1-CYP2C19*17 mutant sequence;

[0154] The experimental group plasmid 2 is a plasmid containing CYP2C19*2 wild type-experimental group blocking sequence 2-CYP2C19*2 mutant-experimental group blocking sequence 2-CYP2C19*3 wild type-experimental group blocking sequence 2-CYP2C19*3 mutant-experimental group blocking sequence 2-CYP2C19*17 wild type-experimental group blocking sequence 2-CYP2C19*17 mutant sequence;

[0155] The experimental group plasmid 3 is a plasmid containing CYP2C19*2 wild type-experimental group blocking sequence 3-CYP2C19*2 mutant-experimental group blocking sequence 3-CYP2C19*3 wild type-experimental group blocking sequence 3-CYP2C19*3 mutant-experimental group blocking sequence 3-CYP2C19*17 wild type-experimental group blocking sequence 3-CYP2C19*17 mutant sequence;

[0156] Experimental group plasmid 4 is a plasmid containing CYP2C19*2 wild type-experimental group blocking sequence 4-CYP2C19*2 mutant-experimental group blocking sequence 4-CYP2C19*3 wild type-experimental group blocking sequence 4-CYP2C19*3 mutant-experimental group blocking sequence 4-CYP2C19*17 wild type-experimental group blocking sequence 4-CYP2C19*17 mutant sequence;

[0157] Comparative example plasmid 1 is a plasmid containing CYP2C19*2 wild type-comparative example blocking sequence 1-CYP2C19*2 mutant-comparative example blocking sequence 1-CYP2C19*3 wild type-comparative example blocking sequence 1-CYP2C19*3 mutant-comparative example blocking sequence 1-CYP2C19*17 wild type-comparative example blocking sequence 1-CYP2C19*17 mutant sequence;

[0158] Comparative Example Plasmid 2 is a plasmid containing the sequence of CYP2C19*2 wild type--CYP2C19*2 mutant-CYP2C19*3 wild type-CYP2C19*3 mutant-CYP2C19*17 wild type-CYP2C19*17 mutant;

[0159] The primers and probes used to detect the three sites of CYP2C19*2 (abbreviated as *2), CYP2C19*3 (abbreviated as *3), and CYP2C19*17 (abbreviated as *17) are as follows:

[0160] *2 Wild-type upstream primer: actatcattgattatttcacg (SEQ ID NO: 12); *2 Mutant upstream primer: ccactatcattgattatttcaca (SEQ ID NO: 13); *2 Downstream primer: caataaagtcccgagggtt (SEQ ID NO: 14); *2 Probe: FAM-aaccttgcttttatggaaagtgatattttgga-BQ1 (SEQ ID NO: 15);

[0161] *3 Wild-type upstream primer: catcaggattgtaagcacccccttg (SEQ ID NO: 16); *3 Mutant upstream primer: catcaggattgtaagcaccccctta (SEQ ID NO: 17); *3 Downstream primer: gtcaatatagaattttggatttc (SEQ ID NO: 18); *3 Probe: HEX-aggtaaggccaagttttttgcttcctgagac-BQ1 (SEQ ID NO: 19);

[0162] *17 wild-type upstream primer: atttgtgtcttctgttctcaaatc (SEQ ID NO: 20); *17 mutant upstream primer: aatttgtgtcttctgttctcaaatt (SEQ ID NO: 21); *17 downstream primer: gaccctggggaacaggac (SEQ ID NO: 22); *17 probe: ROX-acctcagctcaatcccagttctgccagcta-BQ2 (SEQ ID NO: 23);

[0163] The reaction solution formula 1 is shown in Table 1:

[0164] Table 1. Reaction solution formula

[0165] Wild-type reaction system Mutation reaction system Initial concentration Dosage μL PCR Buffer PCR Buffer 10× 8 <![CDATA[MgCl2]]> <![CDATA[MgCl2]]> 25mM 5 dNTPs dNTPs 25mM 0.8 *2 Wild-type upstream primer *2 Mutant upstream primer 100μM 0.1 *2 downstream primer *2 downstream primer 100μM 0.1 *2 probes *2 probes 100μM 0.08 *3 Wild-type upstream primer *3 Mutant upstream primer 100μM 0.1 *3 downstream primer *3 downstream primer 100μM 0.1 *3 probes *3 probes 100μM 0.08 *17 Wild-type upstream primer *17 mutant upstream primer 100μM 0.1 *17 downstream primer *17 downstream primer 100μM 0.1 *17 probes *17 probes 100μM 0.08 Taq enzyme Taq enzyme / 1.5 <![CDATA[H2O]]> <![CDATA[H2O]]> / 3.86

[0166] The detection steps are as follows:

[0167] After the positive quality control plasmid is synthesized, it is diluted with the diluent provided by the present invention and its copy number is calibrated by digital PCR (the digital PCR calibration of the plasmid copy number is to ensure that different plasmids are diluted to the same concentration and compared with the nucleic acid sample, so that the comparison and detection of the CT value is more intuitive, and it is also possible not to compare with the nucleic acid concentration, directly dilute several plasmids by the same multiple, and compare the plasmid detection results). At the same time, CYP2C19*2 heterozygous nucleic acid samples, CYP2C19*3 heterozygous nucleic acid samples, and CYP2C19*17 heterozygous nucleic acid samples are prepared. CYP2C19*2 heterozygous nucleic acid samples of known concentration are used for digital PCR calibration. After obtaining the corresponding relationship between nucleic acid sample copies (copies) and concentration (ng / μL), the three types of nucleic acid samples are diluted to 10 ng / μL, and the positive plasmid is diluted to the copy number corresponding to 10 ng / μL of CYP2C19*2 heterozygous nucleic acid as a positive quality control product.

[0168] Comparative example plasmid 2 (comparative quality control product 2) is a plasmid containing a combination of wild-type and mutant sequences of three sites of CYP2C19, and does not contain a blocking sequence; experimental group plasmid 1 (positive quality control product 1) is a plasmid inserted with experimental group blocking sequence 1; experimental group plasmid 2 (positive quality control product 2) is a plasmid inserted with experimental group blocking sequence 2; experimental group plasmid 3 (positive quality control product 3) is a plasmid inserted with experimental group tissue sequence 3; experimental group plasmid 4 (positive quality control product 4) is a plasmid inserted with experimental group tissue sequence 4; comparative example plasmid 1 (comparative quality control product 1) is a plasmid inserted with comparative example blocking sequence 1. The specific dilution method is the same as above, and the diluted samples are used as quality control products 1 to 5.

[0169] Use the above reaction system to prepare amplification reagents, wild-type reaction tube: wild-type upstream primer, downstream primer, probe, mutant reaction tube: mutant upstream primer, downstream primer, probe. Add 20μL of reagent and 10μL of nucleic acid sample to the PCR reaction tube, then carefully cover the PCR tube cap and centrifuge quickly for a few seconds. Place the PCR reaction tube in the real-time PCR instrument. Real-time PCR reaction is performed on Jena qTOWER 3 The PCR reaction was performed on a G IVD nucleic acid amplification instrument according to the following program: the first stage was 95°C for 2 minutes, 1 cycle; the second stage was 95°C for 10 seconds, 60°C for 35 seconds, 45 cycles.

[0170] The test results are shown in Table 2 and Figure 1 to Figure 6, WM is the value of Ct(W)-Ct(M). The results show that the wild-type and mutant amplification efficiencies of the plasmid without the blocking sequence inserted (comparative quality control product 2) and the plasmid with the comparative blocking sequence 1 inserted (comparative quality control product 1) are significantly different, and the amplification curve shows a re-jump phenomenon in the plateau phase. The amplification results of the plasmids with the blocking sequences 1 to 4 of the examples (positive quality control products 1 to 4) are close to those of the nucleic acid samples, and the plateau amplification curve is normal, indicating that the quality control product of the present invention has good amplification efficiency and strong specificity.

[0171] Table 2. Comparison of nucleic acid sample test results with different positive quality control products

[0172]

[0173] Example 2 Stability Verification of Quality Control Products Prepared with Different Dilutions

[0174] A total of 6 diluent quality control products were evaluated for their stability, and their specific compositions are shown in Table 3. The diluents were prepared according to the diluent formula in Table 3, and diluted according to the positive plasmid concentration in Example 1 to obtain comparative examples 1 to 6, wherein the difference between comparative examples 1 to 6 and the quality control products in Example 1 is only the different diluent formulas, and the other components and conditions are the same. The above quality control products were placed at 37°C for 3 days, 7 days, and 14 days to evaluate the stability of the quality control products, and compared with the Ct value detected on day 0 (the difference in the Ct value detected on day 0 is recorded as k), and the formula with the smallest Ct difference change was screened out, and the evaluation data is shown in Table 4.

[0175] Table 3. Formulas of different quality control dilution solutions

[0176]

[0177] Table 4. Accelerated validation of quality control products prepared with different dilutions at 37°C

[0178]

[0179]

[0180] The results showed that after the quality control product configured with the diluent provided in Example 1 was accelerated at 37°C for 14 days, the Ct values ​​of the three targets compared with those on day 0 were significantly smaller than those in Comparative Examples 1 to 6, indicating that the quality control product configured with the diluent provided in the present invention has the highest thermal acceleration stability.

[0181] Example 3 Real-time stability verification of positive quality control products

[0182] The prepared CYP2C19 positive quality control product of Example 1 was placed in an environment of 2-8°C for real-time stability assessment, starting from day 0, and assessed for 0, 2, 4, 6, 9, 12, and 14 months, respectively, and 3 positive quality control products were taken at each time point. The results show that the quality control product prepared by the present invention can be stably stored for at least 14 months under an environmental condition of 2-8°C, is easy to store, and avoids the influence of repeated freezing and thawing on the quality control results during use.

[0183] Table 5. Real-time stability of positive quality control products

[0184]

[0185]

[0186] Example 4 Positive quality control product for CT / NG / UU gene detection reagent

[0187] The positive quality control product for the multiple detection reagents of Chlamydia trachomatis (CT), Neisseria gonorrhoeae (NG) and Ureaplasma (UU) is a plasmid containing the CT / NG / UU conservative region sequence and the blocking sequence. The plasmid vector uses the standard vector pUC57. The target sequence is as follows:

[0188] CT target sequence:

[0189] attagtatttgccgctttgagttctgcttcctccttgcaagctctgcctgtggggaatcctgctgaaccaagccttatgatcgacggaattctgtg

[0190] ggaaggtttcggcggagatccttgcgatccttgcgccacttggtgtgacgctatcagcatgcgtgttggttactacggagactttgttttcgac cg (SEQ ID NO: 24);

[0191] NG target sequence:

[0192] gcctatgcctgcttgggcggcaatcaacagggaaaacggcggcgcacaccttgcctatgcgctttccgcgcctgtgctgacggcggaata

[0193] cggtggggagacaaaaagccctgcgctatcttgctgcacttgaagcagcatataaggcgaaattgcgcggtgatgtgggctttgtatcgctga (SEQ ID NO: 25);

[0194] UU target sequence:

[0195] tgtggtcttaagattcacgaagactgaggggcaacaggaaacgctattgacttagcattaacagttgctgaaaaaactgatgtagctgttgcta

[0196] tccatacagatacattaaacgaagcaggatttgttgaacatacaattgctgcaatgaaaggacgtacaatccacgcttaccatacagaaggt (SEQ ID NO: 26);

[0197] Blocking sequence: atgcctagactgatcttgcccttattaacacattcctaaagctttagtagactggggggggg (SEQ ID NO: 27);

[0198] The positive plasmid is a plasmid containing the CT target sequence-blocking sequence-NG target sequence-blocking sequence-UU target sequence;

[0199] The primers and probes used to detect Chlamydia trachomatis, Neisseria gonorrhoeae, and Ureaplasma (ct / ng / uu) are as follows:

[0200] CT upstream primer: ggaatcctgctgaacca (SEQ ID NO: 28); CT downstream primer: gtaaccaacacgcatgct (SEQ ID NO: 29); CT probe: FAM-gatcgacggaattctgtgggaaggtttcggc-BQ1 (SEQ ID NO: 30);

[0201] NG upstream primer: gcgctttccgcgcctgtgc (SEQ ID NO: 31); NG downstream primer: cgcaatttcgccttatatgct (SEQ ID NO: 32); NG probe: HEX-gcggaatacggtgggagacaaaaagccct-BQ1 (SEQ ID NO: 33);

[0202] UU upstream primer: cttagcattaacagttgctga (SEQ ID NO: 34); UU downstream primer: gtggattgtacgtcctttcat (SEQ ID NO: 35); UU probe: ROX-gatgtagctgttgctatccatacagataca-BQ2 (SEQ ID NO: 36);

[0203] 1. Verification of quality control products for CT, NG, and UU gene detection reagents: Positive samples were diluted with the diluent provided by the present invention and digital PCR was performed to calibrate their copy number, and diluted to 10 7 100 copies / ml was used as a weak positive quality control. The amplification reagent was prepared using the reaction system in Table 6 (reaction solution formula 2). 20 μL of the reagent and 10 μL of the nucleic acid sample were added to the PCR reaction tube, and the real-time PCR reaction was performed on a Jena qTOWER 3 The PCR reaction was performed on a G IVD nucleic acid amplification instrument, and the PCR reaction program was as follows: the first stage, 95°C for 2 minutes, 1 cycle; the second stage, 95°C for 10 seconds, 60°C for 35 seconds, 45 cycles. The test results are shown in Table 7, and the weak positive quality control products can be accurately detected.

[0204] Table 6. Reaction solution formula 2

[0205] Reaction system concentration Dosage μL PCR Buffer 10× 8 <![CDATA[MgCl2]]> 25mM 5 dNTPs 25mM 0.8 CT upstream primer 100μM 0.1 CT downstream primer 100μM 0.1 CT probe 100μM 0.08 NG upstream primer 100μM 0.1 NG downstream primer 100μM 0.1 NG probe 100μM 0.08 UU upstream primer 100μM 0.1 UU downstream primer 100μM 0.1 UU Probe 100μM 0.08 Taq enzyme / 1.5 <![CDATA[H2O]]> / 3.86

[0206] Table 7. Verification of quality control products for CT, NG, and UU gene detection reagents

[0207]

[0208] 2. Real-time stability verification of CT / NG / UU quality control products

[0209] Table 8. Stability verification of quality control products for CT / NG / UU gene detection reagents

[0210]

[0211]

[0212] The prepared CT, NG, and UU positive quality control products of Example 4 were placed in an environment of 2 to 8°C for real-time stability assessment, starting from day 0, and assessed for 0, 2, 4, 6, 9, 12, and 14 months, respectively, and 3 positive quality control products were taken at each time point. The results show that the quality control products prepared by the present invention can be stably stored for at least 14 months under an environmental condition of 2 to 8°C, are easy to store, and avoid the influence of repeated freezing and thawing on the quality control results during use.

[0213] The quality control product design method and the quality control product prepared by the diluent provided by the present invention have simple storage conditions and strong applicability. The plasmids designed according to different sequences can be applied to the quality control of gene detection reagents of different samples. The product designed by the method has low cost, good stability, is easy to store and transport, has simple production conditions, can be applied to large-scale production at the industrial level, and is easy to apply and promote.

[0214] The above are only preferred embodiments of the present invention. It should be pointed out that, for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A nucleic acid fragment, characterized in that including a plurality of target sequences and a blocking sequence located between the target sequences; The blocking sequence is not less than 10 bp; The blocking sequence comprises a repeated base sequence of no less than 5 bp; The blocking sequence cannot bind to the primer used for amplifying the target sequence; The amplification primers include upstream amplification primers and downstream amplification primers.

2. The nucleic acid fragment according to claim 1, characterized in that The repeated base sequence is located at the 5' end, 3' end or any position in the middle of the blocking sequence.

3. The nucleic acid fragment according to any one of claims 1 to 2, characterized in that The blocking sequence is 10 to 100 bp.

4. The nucleic acid fragment according to any one of claims 1 to 3, characterized in that The nucleic acid fragments include nucleic acid fragment A and / or nucleic acid fragment B; The nucleic acid fragment A includes a blocking sequence having a nucleotide sequence as shown in SEQ ID NO:7 and a target sequence having a nucleotide sequence as shown in SEQ ID NO:1 to SEQ ID NO:6; The nucleic acid fragment B includes a blocking sequence having a nucleotide sequence as shown in SEQ ID NO: 27 and a target sequence having a nucleotide sequence as shown in SEQ ID NO: 24 to SEQ ID NO:

26.

5. The nucleic acid fragment according to claim 4, characterized in that The nucleotide sequence of the nucleic acid fragment A comprises: a target sequence as shown in SEQ ID NO: 1 to SEQ ID NO: 6, which is sequentially connected in series through a blocking sequence as shown in SEQ ID NO: 7; The nucleotide sequence of the nucleic acid fragment B includes: a target sequence as shown in SEQ ID NO:24 to SEQ ID NO:26, which is sequentially connected in series through a blocking sequence as shown in SEQ ID NO:

27.

6. A recombinant vector, characterized in that Containing the nucleic acid fragment according to any one of claims 1 to 5.

7. A host cell, characterized in that Transfect and / or transform the recombinant vector as described in claim 6.

8. A detection composition, characterized in that The method comprises at least one of the following i) to iii) and a primer and a probe for amplifying the target sequence in the nucleic acid fragment according to any one of claims 1 to 5: i), the nucleic acid fragment according to any one of claims 1 to 5; ii), the recombinant vector according to claim 6; iii) The host cell according to claim 7.

9. A reagent combination, characterized in that The method comprises at least one of the nucleic acid fragment according to any one of claims 1 to 5, the recombinant vector according to claim 6, the host cell according to claim 7 and / or the detection composition according to claim 8 and a diluent.

10. The reagent combination according to claim 9, characterized in that: The diluent comprises: 0.8-1.2M Taps, 1.0-3.0g / L preservative, 0.35-0.4g / L EDTA·2Na and / or 1.5-2.5g / L trehalose.

11. The reagent combination according to claim 10, characterized in that: The preservative includes at least one of P300, P950 and / or NaN3.

12. A method for multi-gene detection, characterized in that: The sample is tested using at least one of the following I) to V): I), the nucleic acid fragment according to any one of claims 1 to 5; II), the recombinant vector according to claim 6; III), the host cell according to claim 7; IV), the detection composition according to claim 8; V) The reagent combination according to any one of claims 9 to 11.

Images