Application of Leymus chinensis U3 gene promoter proLcU3a

Abstract

The present invention discloses an application of a Leymus chinensis U3 gene promoter proLcU3a, and belongs to the field of biotechnology. The Leymus chinensis U3 gene promoter proLcU3a having a nucleotide sequence as shown in SEQ ID NO: 15 provided by the present invention has a promoter activity, can drive the transcription of sgRNA targeting the Leymus chinensis gene, thereby constructing a CRISPR-Cas9 gene editing system driven by the promoter proLcU3a to sgRNA transcription, and realize the editing of the Leymus chinensis gene, which can be applied in the technical fields of Leymus chinensis genetic transformation, molecular breeding, etc.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to a new application of a sheep grass U3 gene promoter (which belongs to a sheep grass RNA polymerase type III promoter, abbreviated as proLcU3a herein), especially in driving the transcription of sgRNA targeting sheep grass genes, constructing a CRISPR-Cas9 gene editing vector targeting and editing sheep grass genes, and in sheep grass genetic transformation and molecular breeding. Background Art

[0002] Leymus chinensis (Trin.) Tzvel. belongs to the genus Leymus of the Poaceae family and is a perennial rhizome plant. Leymus chinensis is widely distributed in Eurasia and is the main community-building species in the Eurasian grassland. It not only has high nutritional value, good palatability, strong rhizome penetration and invasion ability, can coil and hold the soil, and maintain water and soil, but also has excellent traits such as cold resistance, saline-alkali resistance, and drought resistance. It is a forage grass with important economic and ecological value. However, in production, Leymus chinensis generally has the "three lows" problem of low germination rate, low heading rate, and low fruiting rate. In addition, it has high heterozygosity, complex genome, and long generation cycle. It is difficult to quickly create new germplasm of Leymus chinensis through traditional hybrid breeding. Recently, with the rapid development of gene editing technology, we can use this technology to introduce mutations at specific positions in the Leymus chinensis genome to quickly and efficiently create new germplasm of Leymus chinensis and achieve Leymus chinensis germplasm improvement.

[0003] The CRISPR / Cas9 gene editing system consists of a single-stranded guide RNA (small guide RNA, sgRNA) and a Cas9 protein with nuclease function. It is a gene editing technology with important application potential. The sgRNA can guide the Cas9 enzyme to cut the target site in a targeted manner, thereby achieving precise editing of the target gene. At present, the CRISPR / Cas9 gene editing system has been widely used in important crops such as rice, corn, wheat, soybeans, and tomatoes, and has played an important role in increasing plant yields, improving plant quality, and enhancing plant resistance. Compared with the above-mentioned crops, the research and application of gene editing technology in forage are relatively lagging behind.

[0004] In order to improve the efficiency of gene editing, researchers have modified various components of the CRISPR / Cas9 gene editing system. The U3 / U6 promoter is an important component for driving sgRNA transcription, and the sgRNA transcription efficiency driven by it will affect the gene editing efficiency. For example, Lin Hao's research group used the MtU6 promoter of Medicago truncatula to drive the transcription of sgRNA targeting the PDS gene, achieving an editing efficiency of 10.35% in the T0 generation (Meng Y et al. Targeted mutagenesis by CRISPR / Cas9system in the model legume Medicago truncatula. Plant Cell Rep. 2017 Feb;36(2):371-374. doi: 10.1007 / s00299-016-2069-9. Epub 2016 Nov 11. PMID:27834007.). Although the U3 promoter has been successfully used in gene editing in many species, there are certain differences in U3 / U6 promoters between different species, and the transcriptional activity of heterologous driven sgRNA may be limited. In addition, there are often multiple U3 / U6 promoters in the same species, and their transcriptional activities may also vary. Therefore, cloning and applying suitable plant endogenous U3 / U6 promoters is of great significance to the establishment and improvement of the CRISPR / Cas9 gene editing system of this species.

[0005] Leymus chinensis is an important forage resource in my country. The establishment of a CRISPR / Cas9 gene editing system for Leymus chinensis will provide reliable technical support for basic research, variety improvement, and germplasm resource creation of Leymus chinensis, and provide support for the development and utilization of Leymus chinensis resources and the alleviation of the problem of forage shortage in my country. However, to date, there is still a lack of research on the Leymus chinensis U3 promoter, and there is no endogenous promoter with high transcriptional activity suitable for Leymus chinensis, which limits the application of the CRISPR / Cas9 gene editing system in basic research and germplasm innovation of Leymus chinensis. Therefore, finding and cloning the endogenous U3 promoter with high transcriptional activity in Leymus chinensis and constructing a CRISPR / Cas9 gene editing system suitable for Leymus chinensis have important research significance and application value for the study of Leymus chinensis functional genes and genetic breeding. Summary of the invention

[0006] In view of one or more problems existing in the prior art, the present invention cloned the RNA polymerase III type promoter proLcU3a of the endogenous U3 snRNA gene of Leymus chinensis for the first time in Leymus chinensis. After testing, the proLcU3a promoter has high transcriptional activity, can drive the efficient expression of its downstream U3 snRNA gene in Leymus chinensis, and can drive the transcription of sgRNA targeting Leymus chinensis genes (such as GW2 genes), which can be used to construct a CRISPR / Cas9 gene editing system targeting Leymus chinensis genes, thereby providing an efficient tool for genetic transformation and molecular breeding research of Leymus chinensis. The present invention is mainly implemented by the following technical solutions.

[0007] A first aspect of the present invention provides an application of a Leymus chinensis U3 gene promoter in driving the transcription of sgRNA targeting a Leymus chinensis gene, wherein the Leymus chinensis U3 gene promoter is named proLcU3a, and its nucleotide sequence is shown in SEQ ID NO:15.

[0008] In some embodiments, the Leymus chinensis gene may include but is not limited to the GW2 gene. In fact, the Leymus chinensis U3 gene promoter proLcU3a provided by the present invention can be used to drive the transcription of sgRNA targeting any gene of Leymus chinensis.

[0009] In some embodiments, the nucleotide sequence of the sgRNA targeting the Leymus chinensis GW2 gene is shown in SEQ ID NO:16.

[0010] A second aspect of the present invention provides a gene editing vector of Leymus chinensis, which may comprise a promoter proLcU3a with a nucleotide sequence as shown in SEQ ID NO:15.

[0011] In some embodiments, the Leymus chinensis gene editing vector may also include a Cas9 coding sequence and a sgRNA coding sequence targeting the Leymus chinensis gene, wherein the promoter proLcU3a drives the transcription of the sgRNA coding sequence.

[0012] In some embodiments, the Leymus chinensis gene may be a Leymus chinensis GW2 gene, and the nucleotide sequence of the sgRNA encoding sequence may be as shown in SEQ ID NO:16.

[0013] The third aspect of the present invention provides an isolated nucleic acid molecule, whose nucleotide sequence is shown in SEQ ID NO:15.

[0014] The use of the promoter proLcU3a mentioned in the first aspect of the present invention, or the sheepgrass gene editing vector described in the second aspect of the present invention, or the isolated nucleic acid molecule described in the third aspect of the present invention in targeted editing of sheepgrass genes, sheepgrass genetic transformation and sheepgrass molecular breeding also belongs to the content of the present invention.

[0015] The fourth aspect of the present invention provides a method for detecting the promotability of the promoter proLcU3a of the Leymus chinensis U3 gene, which may include the following operations:

[0016] (S1) constructing a gene editing vector of Leymus chinensis driven by promoter proLcU3a to transcribe sgRNA, which also contains a Cas9 expression element and a reporter gene expression element, and transferring the constructed gene editing vector into the bioplastids of Leymus chinensis for expression by PEG4000-mediated transient transformation of bioplastids of Leymus chinensis;

[0017] (S2) observing whether the ovine grassland bioplastids have fluorescence of the reporter group by fluorescence microscopy; and

[0018] (S3) extracting genomic DNA from the fluorescent sheep grassland bioplastids with a reporter group obtained in step (S2), amplifying the target gene fragment therefrom, and performing enzyme digestion on the fragment;

[0019] If the enzyme digestion result in step (S3) indicates that only a portion of the target gene fragment is completely digested, it indicates that the Leymus chinensis U3 gene promoter proLcU3a has promoter activity.

[0020] In some embodiments, the target gene may be the GW2 gene, and the nucleotide sequence of the sgRNA is shown in SEQ ID NO:16.

[0021] The fifth aspect of the present invention also provides a gene editing vector of Leymus chinensis for detecting the promoter activity of the Leymus chinensis U3 gene promoter proLcU3a, which comprises an sgRNA expression element, a Cas9 expression element and a reporter group expression element, wherein in the sgRNA expression element, the transcription of sgRNA is driven by the promoter proLcU3a. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is the expression abundance of Leymus chinensis U3 snRNA in leaves, roots and panicles. The color gradient represents the snRNA log2FPKM, red represents high expression abundance, and green represents low expression abundance.

[0023] Figure 2 Schematic diagram of the plasmid structure of the gene editing vector of Leymus chinensis driven by proLcU3a.

[0024] Figure 3 The results are shown for PEG-mediated transient transformation of sheep grassland bioplastids.

[0025] Figure 4 This is the result of XbaI restriction digestion of the PEG-mediated amplification product of the fragment where GW2-sgRNA is located in the DNA of sheep grassland bioplastids. DETAILED DESCRIPTION

[0026] The present invention is further described below in conjunction with specific embodiments. It should be understood that the specific embodiments are only used to further illustrate the present invention, rather than to limit the content of the present invention.

[0027] In the following, only some exemplary embodiments are briefly described. As those skilled in the art will appreciate, the described embodiments may be modified in various ways without departing from the spirit or scope of the present invention. Therefore, the drawings and descriptions are considered to be exemplary and non-restrictive in nature.

[0028] The methods used in the following examples are all conventional methods unless otherwise specified. For specific steps, please refer to: Molecular Cloning: A Laboratory Manual (Sambrook, J., Russell, David W., Molecular Cloning: A Laboratory Manual, 3rd edition, 2001, NY, Cold Spring Harbor).

[0029] The methods for obtaining various biological materials described in the examples are only to provide a method for obtaining them in an experiment to achieve the specific disclosed purpose, and should not be a limitation on the source of the biological materials of the present invention. In fact, the sources of the biological materials used are extensive, and any biological materials that can be obtained without violating laws and moral ethics can be replaced and used according to the instructions in the examples. The experimental materials used in the following examples, unless otherwise specified, were purchased from conventional biochemical reagent stores.

[0030] The nucleotides involved in the following examples can all be synthesized using existing techniques.

[0031] Example 1: Screening of U3 gene promoters suitable for the CRISPR / Cas9 gene editing system of Leymus chinensis.

[0032] (1) Based on the conservation of U3 snRNA among different species (e.g., rice, corn, wheat, etc.), the rice U3 snRNA sequences OsU3-112939126 (SEQ ID NO:1), OsU3-112938835 (SEQ ID NO:2), OsU3-112937254 (SEQ ID NO:3), OsU3-112936241 (SEQ ID NO:4), the corn U3 snRNA sequences ZmU3-111591087 (SEQ ID NO:5), ZmU3-111590776 (SEQ ID NO:6), ZmU3-111590390 (SEQ ID NO:7), ZmU3-111590056 (SEQ ID NO:8), the wheat U3 snRNA sequence TridiU3-119360009 (SEQ ID NO:9), the NO:9), TridiU3-119351147 (SEQ ID NO:10), TridiU3-119342521 (SEQ ID NO:11), and TridiU3-119327179 (SEQ ID NO:12) were compared with the small RNAseq sequences of Leymus chinensis measured in the applicant's laboratory in the early stage (BLAST). The FPKM value of U3 snRNA in Leymus chinensis was calculated to determine the expression level (i.e., expression abundance) of U3 snRNA encoded at multiple different sites in the genome of Leymus chinensis in the leaves, panicles, and roots of Leymus chinensis. The results are as follows Figure 1 As shown, red represents high expression of the corresponding U3 snRNA, and green represents low expression of the corresponding U3 snRNA. Figure 1 The results show that only a few loci in Leymus chinensis encode U3 snRNAs that are highly expressed in different tissues of Leymus chinensis. This result indicates that the promoters of these U3 snRNAs have high transcriptional activity in cells of different tissues of Leymus chinensis and can effectively drive the transcription of downstream U3 snRNAs. However, among these U3 snRNAs, only Figure 1 The U3snRNA indicated by the arrow (named LcU3a snRNA in this article) can be amplified in the following step (2) to obtain its upstream promoter region. Therefore, the following operation is aimed at obtaining the upstream promoter region of LcU3a snRNA and verifying its promoter activity.

[0033] (2) Using Leymus chinensis genomic DNA as a template, the promoter region 850 bp upstream of LcU3a snRNA was amplified by designing primers F and R (as shown below):

[0034] F: CTGTTTTTGTAAAGTGTCTGTTGG (SEQ ID NO:13)

[0035] R: GAGACGCGGCAGATAGAAGCACG (SEQ ID NO: 14).

[0036] (3) PCR cloning was performed in a 50 μL system using KOD FX high-fidelity enzyme (TOYOBO Code. No: KFX-101) to obtain PCR amplification products. The PCR amplification reaction procedure was as follows: 95°C pre-denaturation for 2 min, 98°C denaturation for 10 s, 58°C annealing for 30 s, 68°C extension for 30 s, 35 cycles, and 68°C final extension for 5 min. PCR amplification reaction system: template: 1 μL; primer F (10 μM): 1.5 μL; primer R (10 μM): 1.5 μL; 2x PCR buffer for KOD FX: 25 μL; 2 mM dNTPs: 10 μL; KOD FX: 1 μL; ddH2O: 10 μL.

[0037] (4) The amplified product obtained in step (3) was cloned into the pEasy Blunt vector (Full Gold Code No: CB101-01), transformed into Escherichia coli DH5α, and the recombinant single clone was selected for sequencing to obtain the Leymus chinensis U3 gene promoter with a length of 850 bp, named proLcU3a, whose nucleotide sequence is shown in SEQ ID NO:15.

[0038] Example 2: Activity verification of the Leymus chinensis U3 gene promoter proLcU3a.

[0039] (1) Construction of a vector for verifying the activity of the proLcU3a promoter, including the following operations.

[0040] (1.1) Design the following primers to connect proLcU3a-GW2 sgRNA (GW2 sgRNA driven by proLcU3a promoter (nucleotide sequence CCAGGAUGGGGUAUUUCUAG (SEQ ID NO: 16)) with pJIT163-Cas9-GFP vector (see Shan et al Nat Biotechnol. 2013 Aug;31(8):686-8. doi: 10.1038 / nbt.2650) by homologous recombination:

[0041] F1:GACGGGGATCGCATGCTGTTTTGTAAAGTGTCTGTTG (SEQ ID NO:17)

[0042] R1: CTAGAAATACCCCATCCTGGTGCTCGTGCTTTCTATCTGCC (SEQ ID NO: 18)

[0043] F2: CCAGGATGGGGTATTTCTAGgttttagagctagaaatagc (SEQ ID NO: 19)

[0044] R2: GATTCCGAGATATCGaaaaaaagcaccgactcggtgc (SEQ ID NO: 20).

[0045] (1.2) Using the proLcU3a clone-positive strain as a template, primers F1 and R1 were used for amplification, and the fragment was recovered as fragment 1; using the pJIT163-Cas9-GFP vector as a template, primers F2 and R2 were used for amplification, and the fragment was recovered as fragment 2; fragment 1, fragment 2 and the pJIT163-Cas9-GFP vector fragment after SphI digestion were fully mixed with the homologous recombinase, and connected at 50°C for 1 hour to obtain the proLcU3a-driven sheepgrass gene editing vector (targeted editing of the sheepgrass GW2 gene), named pLcU3a-GW2-pJIT163-Cas9-GFP (also known as LcU3a¬_pJIT163-Cas9-GFP), and its plasmid structure schematic diagram is shown in the figure. Figure 2 As shown, it is also used as a proLcU3a promoter activity detection vector, which contains sgRNA and Cas9 encoding genes driven by the Leymus chinensis U3 promoter proLcU3a, and also introduces a GFP element as a reporter gene.

[0046] (2) The PEG4000-mediated transient transformation method of sheep grassland bioplastids was used to verify the activity of proLcU3a. The specific operation steps are as follows.

[0047] (2.1) Cut the leaves of two-week-old Leymus chinensis seedlings into 1 mm pieces, place them in a small beaker, prepare enzymatic solution (Cellulase R-10 (Cellulase R-10, Yakult Pharmaceutical Industry Co., Ltd. Code. No: L0012) 0.3 g, Macerozyme R-10 (Yakult Pharmaceutical Industry Co., Ltd. Code. No: L0021) 0.15 g, Mannitol (Mannitol) 2.1844 g, MES (Methyl Ester Sulfonate, Sigma-Aldrich Code. No: M2933) 0.04264 g) to 20 mL, adjust the solution pH to 5.8 with KOH, place in a water bath at 55℃ for 10 min, add CaCl2 0.02 g, BSA (bovine serum albumin) 0.02 g), and enzymatically hydrolyze for about 3 hours at room temperature, 50-70 rpm, in the dark. h; add 1 / 2 volume of W5 solution (154 mM NaCl, 125 mM CaCl2, 5 mM KCl and 4 mM MES, pH 5.7) to a small beaker to dilute the enzymatic hydrolysate containing protoplasts, rinse the 100-mesh filter with W5 solution, filter the enzymatic hydrolysate to remove undissolved leaves (be gentle), rinse the leaves in the filter with 1 / 2 volume of W5 solution, and collect the filtrate.

[0048] (2.2) Divide the filtrate into 50 mL centrifuge tubes and centrifuge at 100-200 g (acceleration set to 1 or 2) for 2 min to precipitate the protoplasts. Remove the supernatant as much as possible and gently resuspend the protoplasts in ice-cold W5 solution. Incubate on ice for 30 min.

[0049] (2.3) Centrifuge slowly at 100-200 g (acceleration set to 1 or 2) for 3 min at room temperature to allow the protoplasts to settle at the bottom of the tube. Remove as much W5 solution as possible without losing the protoplasts, and then resuspend the protoplasts with an appropriate amount of MMG solution (1 M Mannitol 4 mL, 1 M MgCl2 0.15 mL, 200 mM MES 0.2 mL).

[0050] (2.4) Take a new 2.0 mL centrifuge tube, add 20 μg of the successfully constructed proLcU3a-driven gene editing vector (pLcU3a-GW2-pJIT163-Cas9-GFP) and 100 μL of protoplasts (obtained in step (2.3)), and mix gently.

[0051] (2.5) Add 100 μL of PEG4000 solution and gently invert the tube to mix thoroughly; induce transformation at room temperature in the dark for 20-30 min.

[0052] (2.6) Dilute the transformation mixture with 1 mL of W5 solution at room temperature, then gently invert the tube to mix thoroughly to terminate the transformation reaction. Centrifuge at 100 g for 5 min at room temperature, remove the supernatant, and repeat once.

[0053] (2.7) Add 200 μL of W5 solution and gently resuspend the protoplasts. Induce the protoplasts overnight at 25°C in the dark for about 48 h. Observe the protoplasts of the sheep grassland using a fluorescence microscope (488 nm) to see if they have GFP green fluorescence. The results are as follows: Figure 3 As shown in the figure, BF and GFP represent the results obtained by taking pictures in the bright field (BF) and green fluorescent protein channel (GFP) in the same field of view, respectively. That is, BF represents all the protoplasts in the field of view, and GFP represents the protoplasts that can emit green fluorescence (i.e., the vector is successfully transformed) in the field of view. This result shows that the protoplast transformation efficiency is high (>50%).

[0054] (3) The genomic DNA of the protoplasts of sheep grassland was extracted by the CTAB method, and the fragment containing GW2-sgRNA in the protoplast DNA was amplified using specific primers F3 (GCATGTACTTTGATTGTTTGC (SEQ ID NO: 21)) and R3 (GTTCTACCATGAGCTTCTGC (SEQ ID NO: 22)). The PCR product was digested with restriction endonuclease XbaI to observe its digestion. The results are shown in Figure 2. Figure 4 As shown, LcU3a-GW2 represents the experimental group, that is, the results of amplification and enzyme digestion of DNA extracted from protoplasts transformed with the pLcU3a-GW2-pJIT163-Cas9-GFP vector, and CK represents the control group, that is, the results of amplification and enzyme digestion of DNA extracted from protoplasts not transformed with the vector. It can be seen that only part of the GW2 fragment in the DNA from the protoplasts of the experimental group was completely digested (see the results of the three bands represented by the second lane), and the uncut part was the GW2 fragment where gene editing occurred, which proves that proLcU3a has promoter activity, which can be used to drive the transcription of sgRNA targeting Leymus chinensis genes (such as GW2 genes) in the CRISPR-Cas9 gene editing vector, thereby targeting and editing the gene.

[0055] According to the basic theory of molecular biology, a promoter can drive the transcription of downstream genes, and its transcriptional activity is determined by the sequence of the promoter itself, rather than the sequence of the downstream gene it drives. U3 or U6 promoters are a type of promoter sequence that can be recognized by PolIII polymerase and transcribe downstream small RNAs (including small interfering RNA, short hairpin RNA, and guideRNA, etc.) (Ma, Hongming et al. "Pol III promoters to express smallRNAs: delineation of transcription initiation." Molecular Therapy-NucleicAcids 3 (2014).), and U3 / U6 promoters in different species are widely used in gene editing to drive the transcription of sgRNAs targeting different genes (Kor, Sakshi Dharmendra et al. "RNA Pol III promoters—Keyplayers in precisely targeted plant genome editing." Frontiers in Genetics 13(2023): 989199.). Therefore, based on the above-mentioned demonstration that proLcU3a has promoter activity and can be used to drive the transcription of sgRNA targeting the GW2 gene of Leymus chinensis in the CRISPR-Cas9 gene editing vector, the Leymus chinensis proLcU3a promoter can also be used to drive the transcription of sgRNA targeting other genes of Leymus chinensis.

[0056] In summary, the present invention obtains the RNA polymerase III type promoter proLcU3a of the Leymus chinensis U3 snRNA gene, and verifies that it has a promoter activity, which can be used to drive the transcription of sgRNA targeting the Leymus chinensis gene, and thus a CRISPR-Cas9 gene editing system driven by the proLcU3a promoter to sgRNA transcription can be constructed. Therefore, the promoter proLcU3a provided by the present invention can be used in the CRISPR-Cas9 gene editing system, and can provide an efficient and accurate gene editing tool for genetic transformation, germplasm innovation, and rapid germplasm improvement research of Leymus chinensis.

[0057] Finally, it should be noted that the above is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. An application of a Leymus chinensis U3 gene promoter in driving the transcription of sgRNA targeting a Leymus chinensis gene, wherein the Leymus chinensis U3 gene promoter is named proLcU3a, and its nucleotide sequence is shown in SEQ ID NO:

15.

2. The use according to claim 1, wherein the Leymus chinensis gene includes the GW2 gene; wherein the nucleotide sequence of the sgRNA targeting the Leymus chinensis GW2 gene is shown in SEQ ID NO:

16.

3. A gene editing vector of Leymus chinensis, comprising a promoter proLcU3a whose nucleotide sequence is shown in SEQ ID NO:

15.

4. The gene editing vector of Leymus chinensis according to claim 3, further comprising a Cas9 coding sequence and a sgRNA coding sequence targeting the Leymus chinensis gene, wherein the promoter proLcU3a drives the transcription of the sgRNA coding sequence.

5. The gene editing vector of Leymus chinensis according to claim 4, wherein the Leymus chinensis gene is the Leymus chinensis GW2 gene, and the nucleotide sequence of the sgRNA coding sequence is shown in SEQ ID NO:

16.

6. A promoter proLcU3a of Leymus chinensis U3 gene, whose nucleotide sequence is shown in SEQ ID NO:

15.

7. Use of the promoter proLcU3a mentioned in the application described in claim 1 or 2, or the sheepgrass gene editing vector described in any one of claims 3-5, or the sheepgrass U3 gene promoter proLcU3a described in claim 6 in targeted editing of sheepgrass genes, sheepgrass genetic transformation and sheepgrass molecular breeding.

Images