10K Low-Density SNP Chip for Dairy Cows Based on Targeted Capture Sequencing and Its Applications
By developing a cow 10K low-density SNP chip based on targeted capture sequencing, the problem of high detection cost of existing high-density chips is solved, and low-cost genotyping detection is achieved, which is suitable for large-scale applications, improving breeding efficiency and genetic progress.
Patent Information
- Application Number
- CN202411691647.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-25
- Publication Date
- 2025-06-24
- Estimated Expiration
- 2044-11-25
AI Technical Summary
The high cost of detection of existing high-density SNP chips limits the large-scale application of dairy cow genome selection technology in cow populations, especially in early breeding of reserve cows and the establishment of cow core populations.
A 10K low-density SNP chip based on targeted capture sequencing is developed, including a single-stranded nucleotide probe that specifically detects SNP sites and INDEL sites, and genotype detection is used to reduce detection costs using targeted sequencing technology.
It has achieved low-cost genotyping detection than existing high-density chips, which is suitable for large-scale applications, especially in the early breeding of reserve cows and the establishment of cow core groups, improving breeding efficiency and genetic progress.
Smart Images

Figure BDA0005151111990000061 
Figure BDA0005151111990000071 
Figure BDA0005151111990000081
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and in particular to a dairy cow 10K low-density SNP chip based on targeted capture sequencing and applications thereof. Background Art
[0002] SNP, short for Single Nucleotide Polymorphism, is a highly abundant and easily genotyped nucleotide polymorphism. SNP analysis is currently a crucial analytical tool for discovering and identifying key genes underlying complex traits, as well as for genome selection (GS).
[0003] The genomic selection process generally includes three steps: (1) establishing a reference population to ensure that the reference population has a complete pedigree record and that each individual has a known phenotypic record and genotypic data. Then, all SNP sites related to QTLs in the whole genome are linked to the detection and the effect value of each SNP or different chromosome segments is predicted; (2) establishing a candidate population, genotyping the candidate population to obtain the genotypic data of the individuals, and estimating the breeding value (GEBV) of each individual in the candidate population based on the SNP effect value obtained from the reference population; (3) selecting the individuals in the candidate population based on the obtained GEBV ranking. After the selected individuals in the candidate population complete the phenotypic performance test, they can be returned to the reference population to re-estimate the SNP effect value. This process is repeated to complete the update of the reference population and candidate population.
[0004] The key principle of genomic selection is to evaluate and select genetically superior individuals using high-density genome-wide markers (primarily single-nucleotide polymorphisms). This technology enables early and accurate selection of young bulls and replacement heifers independent of phenotypic information, shortening the dairy cattle breeding cycle from 5-6 years to approximately 2 years and significantly reducing the generation interval, thereby significantly reducing breeding costs and accelerating population genetic progress.
[0005] Since 2009, Illumina has developed two bovine genomic arrays: the Bovine SNP 50K array (containing 54,000 SNPs) and the Bovine HD array (containing 777,962 SNPs). Since 2014, Neogen has developed the Neogen 80K, Neogen 150K, and Neogen 100K bovine genomic SNP arrays. The inventors' team has also developed low- and medium-density arrays, such as 30K, 40K, and 126K, for Holstein cows. However, medium- and high-density SNP chips are primarily used for genomic assessment and reference population construction in young bulls (bulls do not produce milk, and frozen semen is promoted through artificial insemination technology for genetic improvement of cow herds. Therefore, the number of bulls is far less than that of cows. As of October 2024, there were 610 dairy bulls in my country). Testing is still relatively expensive. Currently, the unit price of genotyping for 40K, 126K, and 150K chips in China is approximately 180, 260, and 480 yuan, respectively, which hinders the large-scale application of GS in cow herds. Based on the current cost of DNA probe synthesis and high-throughput sequencing in China, the unit price of genotyping for 10K chips is only about 100 yuan, and the unit price is less than 100 yuan when testing larger samples, making it suitable for dairy farms (the national dairy cow herd is 12.33 million head). Therefore, the development of a low-density SNP chip for dairy cows is of great significance for the early selection and breeding of replacement dairy cows, the establishment of core herds of cows, the selection and mating of breeds, accelerating genetic progress, and improving feed management efficiency. Summary of the Invention
[0006] The purpose of the present invention is to provide a dairy cow 10K low-density SNP chip based on targeted capture sequencing and its application.
[0007] In a first aspect, the present invention claims a chip for detecting the genotype of a dairy cow.
[0008] The chip for detecting the genotype of dairy cows claimed in the present invention is a dairy cow 10K low-density SNP chip based on targeted capture sequencing, comprising:
[0009] (A1) a single-stranded nucleotide probe for specifically detecting a SNP site; the SNP site is one of the 11,352 SNP sites listed in Table 2;
[0010] (A2) a single-stranded nucleotide probe for specifically detecting an INDEL site; the INDEL site is one of the six INDEL sites listed in Table 3;
[0011] The position information of the 11,352 SNP sites described in Table 2 and the 6 INDEL sites described in Table 3 were determined based on alignment with the dairy cow genome reference sequence, which is the Bos_taurus UMD3.1 version (Bos_taurus-Ensembl genome browser 112).
[0012] The position information of each target site (including target site 1 and target site 2) mentioned below is also determined by comparison based on the reference sequence of the dairy cow genome (Bos_taurus UMD3.1 version).
[0013] Furthermore, in (A1), a total of 11,352 single-stranded nucleotide probes were used. For each SNP site, a target site (a 110-bp sequence) was selected within 110 bp upstream and downstream of the location of the SNP site on the dairy cow genome (Bos_taurus UMD3.1 version), the target site encompassing the SNP site, and a probe was designed for the target site, the nucleotide sequence of the probe being reverse complementary to the nucleotide sequence of the target site.
[0014] Furthermore, in (A2), there are a total of 6 pairs of single-stranded nucleotide probes. For each INDEL site, a target 1 (target 1 is a 110 bp sequence) is selected from the 110 bp upstream of the location of the INDEL site on the dairy cow genome (Bos_taurus UMD3.1 version). Target 1 does not cover the INDEL site. An upstream probe is designed for target 1, and the nucleotide sequence of the upstream probe is reverse complementary to the nucleotide sequence of target 1. A target 2 (target 2 is a 110 bp sequence) is selected from the location of the INDEL on the dairy cow genome (Bos_taurus UMD3.1 version) and within 110 bp downstream thereof. Target 2 covers all or part of the nucleotides in the INDEL site. A downstream probe is designed for target 2, and the nucleotide sequence of the downstream probe is reverse complementary to the nucleotide sequence of target 2.
[0015] Furthermore, in (A1), the starting position and ending position of the target corresponding to each of the 11352 single-stranded nucleotide probes are shown in Table 2. The 11352 single-stranded nucleotide probes include the probe shown in SEQ ID No. 1.
[0016] Furthermore, in (A2), in the six pairs of single-stranded nucleotide probes, the start position and end position of target 1 corresponding to the upstream probe in each pair of probes, and the start position and end position of target 2 corresponding to the downstream probe are as shown in Table 3. The six pairs of single-stranded nucleotide probes include a pair of probes consisting of the upstream probe shown in SEQ ID No. 2 and the downstream probe shown in SEQ ID No. 3.
[0017] It should be noted that, given the specific location of the target within a reference genome and its version number, it is very easy for those skilled in the art to obtain the specific sequence information of each probe. Due to space limitations, the specific sequence information of each probe is not presented in this article.
[0018] Furthermore, in the chip, each of the single-stranded nucleotide probes is modified with biotin.
[0019] Correspondingly, the chip further comprises magnetic beads modified with streptavidin.
[0020] In one embodiment of the present invention, the chip is a liquid-phase probe hybridization chip.
[0021] In a second aspect, the present invention claims protection for the use of the chip described in the first aspect above in dairy cow breeding.
[0022] Furthermore, the breeding is molecular marker-assisted breeding, specifically genomic selection breeding.
[0023] In a third aspect, the present invention claims protection for the use of the chip described in the first aspect above in genotyping detection of dairy cows.
[0024] In a fourth aspect, the present invention claims protection for the use of the chip described in the first aspect above in identifying the relationship of dairy cows.
[0025] In a fifth aspect, the present invention claims protection for the use of the chip described in the first aspect above in the preparation of a product for diagnosing genetic defects in dairy cows.
[0026] In each of the above related aspects, the dairy cows can be Holstein cows.
[0027] The molecular markers in the targeted capture sequencing-based 10K low-density dairy cow microarray provided by this invention primarily come from three types of loci: the first type, 153 SNPs significantly associated with important dairy cow traits (including milk production, body shape, and health traits) discovered and identified in previous research by the inventors' team; the second type, 199 parentage testing loci (three of which overlap with the first type) and 34 genetic defect loci; and the third type, 10,975 SNPs selected from existing commercial dairy cow genome microarrays based on detection rate, gene frequency, positional uniqueness, genotype filling principle, and genomic distribution based on a large-scale reference population constructed in my country. These three categories contain a total of 11,358 loci.
[0028] The 10K low-density genome chip provided by the present invention has lower detection costs than existing high-density chips, and therefore will inevitably be more widely used in practical applications. Experiments have shown that compared with existing 40K, 126K, and 150K chips, the 10K chip of the present invention has consistent detection performance in terms of SNP detection rate, polymorphism detection, individual genotype detection rate, and genetic assessment accuracy. The chip of the present invention can be applied to the whole genome selection of dairy cows and the identification of genetic defects, which is of great significance for the early selection and breeding of replacement dairy cows, the establishment of core groups of cows, the selection and matching of breeds, the acceleration of genetic progress, and the improvement of feed management efficiency. BRIEF DESCRIPTION OF THE DRAWINGS
[0029] Figure 1 This is a flow chart of the design and preparation of the chip of the present invention.
[0030] Figure 2 The figure shows the distribution of 11,352 SNP sites on dairy cow chromosomes.
[0031] Figure 3 The results are a comparison of the genomic genetic assessment accuracy of the chip of the present invention and other existing chips. DETAILED DESCRIPTION
[0032] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.
[0033] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.
[0034] Example 1. Design and preparation of a 10K low-density SNP chip for dairy cows based on targeted capture sequencing
[0035] Figure 1 This is a flow chart of the design and preparation of the chip of the present invention.
[0036] 1. Acquisition of the first type of sites
[0037] Research has shown that adding SNPs significantly associated with target traits to the SNP array can improve the accuracy of genomic selection. Therefore, it is essential to include sites reflecting the genetic background of the Chinese Holstein dairy herd. The inventors added 153 SNPs significantly associated with important traits of Chinese Holstein dairy cows (including milk production, body conformation, and health) to the 10K array using multi-omics techniques, including genome-wide association analysis, resequencing, transcriptomics, and metabolomics.
[0038] The first category of sites are SNPs numbered SNP200 to SNP349, as well as SNP52, 56, and 173 (these three sites overlap with the second category of sites listed in Table 2). The detailed process of obtaining the SNP sites associated with each trait is as follows:
[0039] 1. Milk production traits
[0040] Milk production traits are the most important economic traits of dairy cows, including milk yield, milk fat content, milk protein content, milk fat rate, milk protein rate and milk fatty acid content.
[0041] (1) Analysis of genetic effects of candidate genes
[0042] The main genes affecting milk production traits in dairy cows discovered so far include DGAT1, GHR, ABCG2, and EEF1D. The inventors' team also previously identified other key functional genes, including AKT3, PKLR, SEC13, ACAT1, ACOX2, ADIPOQ, ALDH18A1, AMDHD2, APOA2, APOB, APOC4, CLINT1, CYP2C18, CYP3A5, CYP7A1, DH1, EHHADH, ETFA, FBP2, GLUL, HADH, HADHB, HSD17B2, IDH2, LDHA, MAT2A, NPL, PCK1, PM20D1, PP4C, PRKACA, SUCLA2, APOP4, APOP5, GYS2, LDHB, NGFR, NR0B2, PC, PPP2R2B, and SLC22A7.
[0043] Genetic effect analysis was further conducted on a total of 947 Chinese Holstein cows from 22 farms and 45 bull families at Beijing Shounong Livestock. Sequencing of frozen semen pools identified 135 single-nucleotide polymorphisms (SNPs), which were then genotyped using targeted genotyping (GBTS). Single-marker and haplotype association analyses were performed between these SNPs and five milk production traits (milk yield, milk fat content, milk fat percentage, milk protein content, and milk protein percentage) using the MIXED procedure of SAS software and an animal model (see below).
[0044] y=μ+hys+b×M+G+a+e
[0045] where y is the phenotypic value of milk production traits (individual 305-day milk production, milk fat content, milk protein content, milk fat rate and milk protein rate), μ is the overall mean, hys is the production year and season utility, b is the regression coefficient of the covariate M, M is the calving age effect, G is the genotype / haplotype combination effect, a is the individual random additive genetic effect and e is the random residual effect.
[0046] Single marker and haplotype association analyses revealed that all 135 SNPs were significantly associated with one or more milk production traits (P < 0.05, P < 0.01), with either allele substitution effects or additive genetic effects (P < 0.05, P < 0.01). Among these significant SNPs, 126 were included in the 10K microarray.
[0047] 2. Body shape traits
[0048] Methods: The Bovine SNP50 bovine whole-genome SNP chip was used to detect the individual genotypes of 1,314 Chinese Holstein cattle from Beijing Shounong Livestock. A genome-wide association analysis was performed using the LASSO model (detailed model below) for 29 somatotype traits (including size, body height, front segment, chest width, body depth, loin strength, rump width, rump angle, bone texture, hoof angle, hind limb side view, udder depth, udder texture, central suspensory ligament, anterior chamber attachment, anterior teat position, teat length, hind attachment height, hind attachment width, hind teat position, and angularity), as well as 8 functional scoring traits including total score, capacity, milking characteristics, rump, limbs and hooves, fore udder, hind udder, and milking system.
[0049] The 10K chip included 16 significant SNP sites that were significantly associated with body shape traits.
[0050] 3. Health traits
[0051] (1) Immunoglobulin
[0052] A herd of 588 Chinese Holstein cattle from Beijing Shounong Livestock was used as the research subjects. Colostrum, serum, and hair samples were collected within 24 hours after calving. Immunoglobulin and albumin concentrations in colostrum and serum were measured using ELISA kits, and genotyping was performed using the Neogen 150K chip. Based on GCTA software, the heritability estimates for colostrum and serum IgG, IgA, IgM, and albumin concentrations ranged from 0.08 to 0.48. With the exception of serum IgG1 and IgG2 concentrations, most immunoglobulin concentrations had medium to high heritabilities (0.12 to 0.48). A genome-wide association analysis based on a mixed linear model using GCTA software was performed. Six SNPs included in this chip were significantly associated with colostrum and serum IgG, IgG2, and IgM concentrations (P < 3.08E-6).
[0053] (2) Susceptibility / resistance to paratuberculosis
[0054] A total of 945 dairy cows from Beijing Shounong Animal Husbandry were selected as the research population. A case-control strategy was used to conduct a genome-wide association study on paratuberculosis susceptibility / resistance. Individual genotyping was performed using the Bovine 50K chip and the Neogen 150K chip. The serum paratuberculosis antibody OD value was used as the phenotype (185 cows were positive and 760 cows were negative). The two datasets (50K and 150K chip intersection data vs. low-density filled to high-density dataset) were used for genome-wide association analysis using GRAMMAR-GC and ROADTRIPS software. The two methods detected 14 and 18 genome-wide significant SNPs, respectively, that were significantly associated with paratuberculosis susceptibility / resistance in Holstein cows (P < 5×10 -5 ). Five SNP sites significantly associated with paratuberculosis susceptibility / resistance were added to the 10K chip.
[0055] 2. Acquisition of the Second Type of Sites
[0056] 1. Paternity testing
[0057] In dairy cattle breeding, accurate pedigree records are crucial for accurately estimating individual breeding values and accelerating population genetic progress. Pedigree errors are common in dairy farms, making paternity testing and pedigree correction using genetic markers crucial. The International Society of Animal Genetics (ISAG) has researched and recommended 199 SNPs (numbered SNP1 to SNP199 in Table 2) for cattle paternity testing (to facilitate research and communication between laboratories worldwide), and therefore, these SNPs have been incorporated into this array.
[0058] 2. Genetic defects
[0059] Genetic defects in dairy cows mainly include spinal deformity syndrome CVM, leukocyte adhesion deficiency BLAD, uridylate synthase deficiency and citrullinemia, which can lead to early miscarriage in cows, death of calves, and reduced survival rate, causing huge economic losses to the dairy cattle farming industry. By adding genetic defect gene sites to the SNP chip, it is possible to simply, quickly and accurately identify and screen whether individual dairy cows carry recessive harmful genes with genetic defects, thereby reducing the frequency of harmful genes in the population through early elimination or scientific breeding and matching, and improving the quality of my country's dairy cattle population. Therefore, 26 common cattle genetic defect-causing mutation sites were added to this chip, a total of 34 sites, including 28 SNP sites and 6 INDEL sites (Note: INDEL sites in the present invention generally refer to sequence changes of more than 2bp, including insertions, deletions and substitutions). The site information comes from the main cattle genetic defect sites included in the OMIA database.
[0060] Table 1. Common mutation sites causing genetic defects in cattle
[0061] Starting position of the site (corresponding number) Genetic defects in cattle Starting position of the site (corresponding number) Genetic defects in cattle Chr1:1277227(SNP354) HH4 Chr14:9487845(SNP6631) Familial goiter Chr1:69756880(SNP640) Uridine monophosphate synthase deficiency Chr15:77667136(SNP7285) Donkey hoof disease Chr1:145114963(SNP960) Bovine leukocyte adhesion deficiency Chr15:77675440(SNP7286) Donkey hoof disease Chr3:9479761(SNP1605) Dominant red Chr15:77682052(SNP7287) Donkey hoof disease Chr3:43412427(SNP1740) Spinal Deformity Syndrome Chr15:77686731(SNP7288) Donkey hoof disease Chr3:43418851(SNP1741) Spinal Deformity Syndrome Chr16:39523051(SNP7472) Trimethylaminourea Chr5:27545478(SNP2703) Epidermolysis bullosa Chr19:44695843(SNP8420) Spherocytosis Chr5:63150400(SNP2841) HH1 Chr24:57298883(SNP9824) Protoporphyria Chr6:23540228(SNP3178) Mannan poisoning Chr29:43611783(SNP10805) Glycogen storage disease type V Chr6:89196592(SNP3445) Pulmonary hypoplasia Chr1:1768587(SNP11342) No horns Chr7:13956640(SNP3627) alpha-mannosidosis Chr16:29773628(SNP11343) HH6 Chr7:13957949(SNP3628) alpha-mannosidosis Chr15:77675516-77675517(INDEL4) Mule hoof disease / syndactyly Chr7:65080197(SNP3844) Myoclonus Chr23:13833871-13833872(INDEL5) Cow spider leg syndrome Chr8:95410507(SNP4457) HH3 Chr5:57641332(INDEL6) Cow spider leg syndrome Chr10:62054844(SNP5236) Marfan syndrome Chr11:77959000(INDEL1) cholesterol deficiency Chr10:62141462(SNP5237) Marfan syndrome Chr21:21184870-21188198(INDEL2) Short spine syndrome Chr11:100802781(SNP5833) Citrullinemia Chr9:93222102-93311988(INDEL3) HH5
[0062] Note: "Corresponding number" refers to the SNP site number in Table 2 or the INDEL number in Table 3.
[0063] 3. Acquisition of the third type of SNP loci
[0064] A large, high-quality reference population is a crucial foundation and essential step in genomic selection. Since 2008, the inventors' team has constructed my country's only dairy cow genomic selection reference population, currently comprising 23,000 cows. The SNP chips used for genotyping individual genotypes in this reference population were all sourced from abroad, including 50K (5,811 cows), 80K (1,535 cows), 100K (5,000 cows), and 150K (10,591 cows). Therefore, the SNP chips used in this reference population must have high genotype imputation accuracy compared to the chip data from this reference population to enable accurate genomic assessment of the cow population.
[0065] Genomic selection assumes tight linkage between markers and QTLs, resulting in a uniform distribution of markers across the genome, maximizing the capture of QTLs influencing traits, thereby improving the accuracy of genotype inference and genomic assessment. Genotype imputation methods impute missing genotypes based on inferred haplotypes (allele combinations that are linked between adjacent markers on the same chromosome). The basic process is as follows: first, haplotypes are constructed using individuals with a high marker density, as well as family information and linkage disequilibrium between populations. Next, markers on the chip to be imputed are matched with markers in the haplotypes.
[0066] Factors that affect chip genotype filling accuracy include: minimum allele frequency, marker density, reference population size, and filling method. Therefore, a 170Kb sliding window was set on the chromosome to screen 50K, 126K, and 150K commercial bovine genomic chip loci, ultimately identifying 10,975 third-category SNP loci (i.e., the remaining SNP loci in addition to the first and second category SNP loci listed in Table 2).
[0067] After the above screening, the present invention obtained a total of 11,358 sites of the above three types, including 11,352 SNP sites (Table 2) and 6 INDEL sites (Table 3). The distribution of the 11,352 SNP sites on the dairy cow chromosomes is as follows: Figure 2 shown.
[0068] For each SNP, a target site was selected within 110 bp upstream and downstream of the SNP site in the dairy cow genome reference sequence (Bos taurus UMD version 3.1). This target site encompassed the SNP site, and a probe was designed for this target site. The nucleotide sequence of the probe was the reverse complement of the nucleotide sequence of the target site. Information on the 11,352 targets targeting these 11,352 SNP sites is shown in Table 2.
[0069] For each INDEL locus, a target 1 (upstream target) was selected within 110 bp upstream of the INDEL locus on the dairy cow genome reference sequence (Bos_taurus UMD version 3.1). Target 1 (upstream target) did not encompass the INDEL locus. An upstream probe was designed for Target 1, with the nucleotide sequence of the upstream probe being reverse complementary to the nucleotide sequence of Target 1 (upstream target). A target 2 (downstream target) was selected within 110 bp downstream of the INDEL locus on the dairy cow genome reference sequence. Target 2 (downstream target) encompassed all or part of the nucleotides in the INDEL locus. A downstream probe was designed for Target 2, with the nucleotide sequence of the downstream probe being reverse complementary to the nucleotide sequence of Target 2 (downstream target). Information on the six target pairs targeting the six INDEL loci is shown in Table 3.
[0070] Table 2. The start and end positions of the 11,352 SNP sites and their targets in the dairy cow reference genome UMD3.1
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108]
[0109]
[0110]
[0111]
[0112]
[0113]
[0114]
[0115]
[0116]
[0117]
[0118]
[0119]
[0120]
[0121]
[0122]
[0123]
[0124]
[0125]
[0126]
[0127]
[0128]
[0129]
[0130]
[0131]
[0132]
[0133]
[0134]
[0135]
[0136]
[0137]
[0138]
[0139]
[0140]
[0141]
[0142]
[0143]
[0144]
[0145]
[0146]
[0147]
[0148]
[0149]
[0150]
[0151]
[0152]
[0153]
[0154]
[0155]
[0156]
[0157]
[0158]
[0159]
[0160]
[0161]
[0162]
[0163]
[0164]
[0165]
[0166]
[0167]
[0168]
[0169]
[0170]
[0171]
[0172]
[0173]
[0174]
[0175]
[0176]
[0177]
[0178]
[0179]
[0180]
[0181]
[0182]
[0183]
[0184]
[0185]
[0186]
[0187]
[0188]
[0189]
[0190]
[0191]
[0192]
[0193]
[0194]
[0195]
[0196]
[0197]
[0198]
[0199]
[0200]
[0201]
[0202]
[0203]
[0204]
[0205]
[0206]
[0207]
[0208]
[0209]
[0210]
[0211]
[0212]
[0213]
[0214]
[0215]
[0216]
[0217]
[0218]
[0219]
[0220]
[0221]
[0222]
[0223]
[0224]
[0225]
[0226]
[0227]
[0228]
[0229]
[0230]
[0231]
[0232]
[0233]
[0234]
[0235]
[0236] Note: The positional information of the 11,352 SNP sites and their targets in the table are determined based on the comparison with the dairy cow genome reference sequence (Bos_taurus UMD3.1 version). The nucleotide information in the "SNP wild-type nucleotide" column in the table is consistent with the corresponding nucleotides in the Bos_taurus UMD3.1 version.
[0237] In Table 2, from left to right, there are multiple groups of data consisting of SNP number, SNP position, SNP wild-type nucleotide, SNP mutant nucleotide, target starting position and target ending position, indicating the chromosome where the corresponding SNP site and its corresponding target are located and their specific positions. Among them, the characters before the ":" in "SNP position" indicate the chromosome number, and the characters after the ":" are the specific positions of the SNP site on the chromosome. For example, "Chr1" represents chromosome 1, and "135098" represents the specific position of chromosome 1 in the UMD3.1 version of the dairy cow reference genome. "SNP wild-type nucleotide" is the nucleotide type of the SNP site in the UMD3.1 version of the dairy cow reference genome, and "SNP mutant nucleotide" is the nucleotide type after the "SNP wild-type nucleotide" of the SNP site is mutated. For example, if SNP350 corresponds to position 135098 of chromosome 1 of the dairy cow reference genome UMD3.1 version, and its nucleotide type is A or G, the starting position and ending position of the target of SNP350 are positions 135016 and 135125 of chromosome 1 of the dairy cow reference genome UMD3.1 version, respectively. The nucleotide sequence of the target of SNP350 is (3'-5'): AATCTTCCTCCGTATTAAGAATACGGTTGTTTACAACCT CTTGGTG ACCAGATCCCTTAGAAATTTGGGATTAATATGTACTGGTTACTGGGAATAAAGTACAAGTCAGTGGA (reverse complementary sequence of SEQ ID No. 1), and the nucleotide sequence of the single-stranded DNA probe targeting SNP350 is (5'-3'): TTA GAAGGCATAATTCTTATGCCAACAAATGTTGGAGAACCACTGGTCTAGGGAATCTTTAAACCCTAATTATACATGACCAATGACCTTATTTCATGTTCAGTCACCT (SEQ ID No. 1).
[0238] Table 3. The start and end positions of the six INDEL sites and their targets in the dairy cow reference genome UMD3.1
[0239]
[0240] Note: The positional information of the six INDEL loci and their targets in the table are determined based on the alignment of the dairy cow genome reference sequence (Bos_taurus UMD3.1 version). The sequence information in the "INDEL wild type" column in the table is consistent with the corresponding nucleotides in the Bos_taurus UMD3.1 version.
[0241] In Table 3, from left to right, there are multiple sets of data, including INDEL number, INDEL position, INDEL wild type, INDEL mutant type, target start position and target end position (each INDEL has a pair of target start position and target end position), indicating the chromosome where the corresponding INDEL site and its corresponding pair of targets (upstream target and downstream target) are located and their specific positions. Among them, the characters before the ":" in "INDEL position" indicate the chromosome number, and the characters after the ":" are the specific positions of the SNP site on the chromosome. For example, "Chr1" represents chromosome 11, and "77959000" represents the specific position of chromosome 11 in the dairy cow reference genome UMD3.1 version. "INDEL wild type" is the nucleotide information of the INDEL site in the dairy cow reference genome UMD3.1 version, and "INDEL mutant type" is the nucleotide information of the INDEL site after the "INDEL wild type" is mutated. For example, if INDEL1 corresponds to position 77959000 of chromosome 11 of the dairy cow reference genome UMD3.1, the wild type has a G at this position, and the mutant has a 1.3 kb insertion at this position. The start and end positions of the upstream target of INDEL1 are positions 77958835 and 77958944 of chromosome 11 of the dairy cow reference genome UMD3.1, respectively. The start and end positions of the downstream target of INDEL1 are positions 77958946 and 77959055 of chromosome 11 of the dairy cow reference genome UMD3.1, respectively. The nucleotide sequence of the upstream target of INDEL1 is (3'-5'): TTTTATATACATATACACGACTATAAATAGTT TTTGTTACATTTTTCTTTTATCATTTTTCCTCCGACGTTTCGGTGGATCGGATACCGAGTGCCATCTCTTCCCTGGGA (reverse complementary sequence of SEQ ID No. 2), and the nucleotide sequence of the single-stranded DNA probe targeting the upstream target of INDEL1 is (5'-3'): AAAATATATGTATATGTGCTGATATTTATCAAAAACAATGTAAAAAGAAAATAGTAAAAAGGAGGCT GCAAAGCCACCTAGCCTATGGCTCACGGTAGAGAAGGGACCCT (SEQ ID No. 2).The nucleotide sequence of the downstream target of INDEL1 is (3'-5'): CCACTGGTAGGAGAGAGACGTGGTCCATGCTGGAGTTCGACCGACAAGGACTTCCGT TCGTTCAAGATGAAATGGGTCTCTTTCTTCTCGGATTTGTGTAGGAGTTGTAG (reverse complementary sequence of SEQ ID No. 3), and the nucleotide sequence of the single-stranded DNA probe targeting the downstream target of INDEL1 is (5'-3'): GGTGACCATCCTC TCTCTGCACCAGGTACGACCTCAAGCTGGCTGTTCCTGAAGGCAAGCAAGTTCTACTTTACCCAGAGAAAGAAGAGCCTA AACACATCCTCAACATC (SEQ ID No. 3).
[0242] It should be noted that, given the specific location of the target within a reference genome and its version number, it is very easy for those skilled in the art to obtain the specific sequence information of each probe. Due to space limitations, the specific sequence information of each probe is not presented in this article.
[0243] 4. Chip Preparation and Usage
[0244] The principle of liquid phase chip is to design probes near the target mutation site and hybridize with the target fragment region of the genome. After elution, amplification and library construction, all captured gene fragments are subjected to second-generation sequencing to obtain the genotype of the target mutation site.
[0245] The specific steps are as follows: (1) First, a gDNA library is constructed for the material to be tested. According to the principle of DNA complementarity, a probe covering the target variation site (including the 11,352 SNP sites in Table 2 of the present invention and the 6 INDEL sites in Table 3) is designed at each site to be tested, and the target probe (i.e., the probe for a total of 11,358 sites in Tables 2 and 3 of the present invention) is modified with biotin labeling; (2) The biotin-modified probe is hybridized with the genomic target region in the PCR solution to form a double strand; (3) The biotin-modified probe is molecularly adsorbed on magnetic beads coated with streptavidin to capture the target site hybridized with the probe; (4) The captured target sequence is eluted, the target site is amplified, and high-depth sequencing is performed to obtain the genotype of the target variation site.
[0246] Liquid-phase chips capture labeled probes in suspended solutions, overcoming the technical shortcomings of solid-phase chips such as poor repeatability, slow reaction rate, and poor flexibility. They have the advantages of high throughput, low cost, simple and fast operation, and flexible use.
[0247] Example 2: Application of the 10K low-density SNP chip for dairy cows based on targeted capture sequencing
[0248] To verify the practical effectiveness of the 10K low-density SNP chip for dairy cows based on targeted capture sequencing prepared in Example 1 of the present invention, the present invention selected 203 Holstein cows for simultaneous testing of 10K (the present invention, for the procedure, see Step 4 of Example 1), 40K, 126K, and 150K chips. The 10K chip SNP detection rate, polymorphism detection, individual genotype detection rate, and comparative validation analysis were analyzed. Among them, the 40K chip developed by the inventors' team, the 126K chip developed by China Agricultural University in collaboration with the Beijing Dairy Center and Huazhi Biotechnology Co., Ltd., and the Neogen 150K chip are existing commercial chips.
[0249] First, PLINK software was used to perform a quality analysis of the chip genotype data from 203 dairy cows. The results showed that the average SNP detection rate of the 10K chip was 97.70%, and the average site polymorphism information content was 0.345. The average SNP detection rates of the 40K, 126K, and 150K chips were 97.2%, 99.3%, and 98.3%, respectively. The 10K chip of the present invention shared 10,090, 11,331, and 11,125 sites with existing commercial 40K, 126K, and 150K chips, respectively, with genotyping concordance rates of 98.92%, 96.23%, and 97.18%, respectively. These results indicate that the performance of the 10K chip of the present invention meets the requirements of genomic genetic assessment, and the site polymorphism performance is good, consistent with the genetic background of the Chinese dairy cow population.
[0250] Secondly, for the validation group of 203 dairy cows, based on the genome selection reference group (23,000 heads) described in Example 1, the 10K (present invention), 40K, 126K and 150K genotype data were filled to the 50K level using Beagle5.4, and the filling accuracy of different types of chips was calculated. The results showed that the filling accuracy of the 10K chip of the present invention was 95.90%, slightly lower than the medium and high density chips (99.05% to 99.23%), and higher than the internationally used dairy cow low-density chip - Illumina 3K (filling accuracy of 89.60%) and 7K (filling accuracy of 94.20%), meeting the needs of early selection of replacement dairy cows, construction of cow core groups, selection and matching, accelerating genetic progress, and improving feed management efficiency.
[0251] Finally, a validation group of 203 Holstein cows was selected based on a 23,000-head genome-selected reference population. The GBLUP model was used to perform genomic genetic evaluation of nine traits, including milk production, milk fat percentage, milk protein percentage, milk fat content, milk protein content, total body score, lactation system score, limb system score, and somatic cell score. The evaluation accuracy of different chip types was calculated. The results showed that the 10K chip genomic genetic evaluation accuracy was 0.6190-0.7352, which was basically consistent with the accuracy of other commercial chips (Table 4 and Figure 3 ).
[0252] Table 4. Comparison of Genomic Genetic Assessment Accuracy
[0253] Traits 10K 40K 126K 150K MY 0.6676 0.6916 0.6723 0.6830 FP 0.7071 0.7311 0.7131 0.7233 PP 0.7352 0.7587 0.7428 0.7514 FY 0.6503 0.6741 0.6545 0.6652 PY 0.6469 0.6709 0.6508 0.6618 CONF 0.6268 0.6507 0.6297 0.6420 MS 0.6217 0.6458 0.6244 0.6369 FL 0.7015 0.7261 0.7077 0.7191 SCS 0.6190 0.6420 0.6208 0.6334
[0254] Note: MY: milk yield; FP: milk fat percentage; PP: milk protein percentage; FY: milk fat content; PY: milk protein content; CONF: total body score; MS: lactation system score; FL: limb system score; SCS: somatic cell score.
[0255] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that further improvements can be made to the present invention. In short, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including changes that depart from the disclosed scope in this application and are made using conventional techniques known in the art.
Claims
1. Chips for detecting Holstein cow genotypes, including: (A1) Single-stranded nucleotide probe for specific detection of SNP sites; The SNP sites are the 11352 SNP sites in Table 2; Table 2, and, (A2) a single-stranded nucleotide probe for specifically detecting an INDEL site; the INDEL site is the 6 INDEL sites in Table 3; Table 3, The position information of the 11352 SNP sites in Table 2 and the 6 INDEL sites in Table 3 were determined based on the comparison of the reference sequence of the dairy cow genome, which is the Bos_taurus UMD3.1 version.
2. The chip according to claim 1, characterized in that: In (A1), there are a total of 11352 single-stranded nucleotide probes; for each SNP site, a target site is selected within 110bp upstream and downstream of the location of the SNP site on the cow genome reference sequence, and the target site covers the SNP site. A probe is designed for the target site, and the nucleotide sequence of the probe is reverse complementary to the nucleotide sequence of the target site.
3. The chip according to claim 2, characterized in that: In (A1), the starting position and the ending position of the target corresponding to each of the 11352 single-stranded nucleotide probes are as shown in Table 2 of claim 1; and / or In (A2), there are a total of 6 pairs of single-stranded nucleotide probes; in the 6 pairs of single-stranded nucleotide probes, the starting position and the ending position of the target 1 corresponding to the upstream probe in each pair of probes and the starting position and the ending position of the target 2 corresponding to the downstream probe are as shown in Table 3 as described in claim 1.
4. The chip according to any one of claims 1 to 3, characterized in that: The single-stranded nucleotide probe is modified with biotin.
5. The chip according to any one of claims 1 to 3, characterized in that: The chip also includes magnetic beads modified with streptavidin.
6. The chip according to any one of claims 1 to 3, characterized in that: The chip is a liquid phase probe hybridization chip.
7. Use of the chip according to any one of claims 1 to 6 in Holstein cow breeding.
8. Use of the chip according to any one of claims 1 to 6 in genotyping detection of Holstein cows.
9. Use of the chip according to any one of claims 1 to 6 in identifying the kinship of Holstein cows.
10. Use of the chip according to any one of claims 1 to 6 in the preparation of a product for diagnosing genetic defects in Holstein cows.
Citation Information
Patent Citations
Cattle 12K SV liquid phase chip and design method and application thereof
CN116144794A
Low-density dairy cow whole genome 30K SNP chip and application thereof
CN116356041A