Real-time fluorescent LAMP detection method for salmonella typhimurium

Abstract

The invention discloses a real-time fluorescent LAMP (loop-mediated isothermal amplification) detection method for salmonella typhimurium, and particularly relates to three groups of loop-mediated isothermal amplification primers designed on the basis of a salmonella typhimurium STM4495 gene, a kit containing the primer groups, and an LAMP detection method for detecting the salmonella typhimurium by using the kit. The detection method is convenient to operate, high in specificity and high in sensitivity, and rapid detection can be achieved at the constant temperature.

Description

Technical Field

[0001] The invention belongs to the field of biological detection, and specifically provides a real-time fluorescence LAMP detection method for Salmonella typhimurium. Background Art

[0002] At present, foodborne diseases caused by pathogenic bacteria have a high incidence and widespread prevalence worldwide, and are also one of the important public health issues in the world today. In my country, the number of foodborne disease incidents caused by Salmonella contamination ranks first among all bacterial foodborne disease incidents. There are many types of serotypes, among which Salmonella typhimurium is one of the common serotypes, which is widely present in the natural environment and human food and drinking water. It can cause food poisoning and enteritis diseases of varying degrees. It is the dominant serotype that causes foodborne disease outbreaks.

[0003] The detection of Salmonella Typhimurium adopts the traditional isolation and culture method. Although this method is mature, it still has problems such as long bacterial culture time and cumbersome operation, and lacks timeliness. At present, the rapid detection methods of Salmonella Typhimurium include immunological and molecular biological methods, as well as new detection methods based on interdisciplinary disciplines, such as biosensor technology, spectral technology, nanotechnology, etc. Among them, immunological methods have high requirements for equipment automation, and antibodies sometimes cross-react with similar antibodies, which affects the test results; some molecular biology and various new detection methods have limitations such as high reagent costs, reliance on a large number of laboratory precision instruments and equipment, and high professional and technical requirements for operators.

[0004] In summary, it is urgent to establish an on-site detection method for Salmonella typhimurium. Summary of the invention

[0005] The purpose of the present invention is to provide a real-time fluorescence LAMP detection method for Salmonella typhimurium, and to construct a detection primer pair and a kit for the STM4495 gene.

[0006] A first aspect of the present invention provides a LAMP primer set for Salmonella typhimurium, wherein the primer set is a primer set targeting a marker gene of Salmonella typhimurium, wherein the marker gene of Salmonella typhimurium is the STM4495 gene.

[0007] In another preferred embodiment, the primer set comprises a pair of outer primers and a pair of inner primers.

[0008] In another preferred embodiment, the primer set comprises a pair of outer primers, a pair of inner primers and a pair of loop primers.

[0009] In a second aspect of the present invention, a LAMP primer set for the STM4495 gene of Salmonella typhimurium is provided, wherein the primer set comprises a pair of outer primers, a pair of inner primers and a pair of loop primers, and the sequences of the primers are as follows:

[0010] STM4495-F3-b:ATTCTGCGCTGTCGGTATG,

[0011] STM4495-B3-b:CCCAGCTTTCCGGCTTTG;

[0012] STM4495-FIP-b: TAAGCTGTGGCAGCAGCTGAA-CTCGGCAAACATATCCC CCA,

[0013] STM4495-BIP-b: CAGATGCAGGCTCTCCTGC-AGATGGCCCGTCAGGATGA C;

[0014] STM4495-LF-b: CCACCAGCAGAACCAGACTG,

[0015] STM4495-LB-b: GCACGTCGCGGGTGAATA.

[0016] In a third aspect of the present invention, a LAMP primer set for the STM4495 gene of Salmonella typhimurium is provided, wherein the primer set for STM4495 comprises a pair of outer primers and a pair of inner primers, and the sequences of the primers are selected from the following group:

[0017] (1)STM4495-F3-a: GATAATTTCATCTTCAATTTCTGG,

[0018] STM4495-B3-a: AATTTTTGCGTGAGATATCGT;

[0019] STM4495-FIP-a: GCACTCCGGTTGTAAACATTAT-TTGTACTGAGGCTAAT TCACCAC,

[0020] STM4495-BIP-a:CGCAGCGTAAAGCAACTCATC-CAAAAGGGTTTGTTTTTGATG.

[0021] (2)STM4495-F3-c: ACTACCGCATCATACCGCT,

[0022] STM4495-B3-c: CTGATGCGCACGCTGAAG;

[0023] STM4495-FIP-c:GGAGCAGGAAGGCGATTTCCA-ACGCCTGCTGAATATAC GGA,

[0024] STM4495-BIP-c: TAGCGCTTCGAGAAACGCCT-TTGAACGCCAAAACGCTG G.

[0025] A fourth aspect of the present invention provides a LAMP detection kit for Salmonella typhimurium, wherein the detection kit comprises the primer set described in the second aspect of the present invention.

[0026] In another preferred example, the LAMP detection kit comprises the primer set described in the third aspect of the present invention.

[0027] In another preferred embodiment, the Salmonella typhimurium includes ATCC14028 and GIM1.237.

[0028] In another preferred example, in the primer set, the concentration ratio of the inner and outer primers is selected from the following group: 8:1, 4:1, 2:1, 1:1, 1:2, 1:4 and 1:8.

[0029] In another preferred example, the concentrations of the inner and outer primers are respectively: 16μM:2μM, 8μM:2μM, 4μM:2μM, 2μM:2μM, 2μM:4μM, 2μM:8μM, or 2μM:16μM.

[0030] In another preferred embodiment, in the primer set, the ratio of the concentration of inner and outer primers is 1:2.

[0031] In another preferred example, in the primer set, the concentration of the inner primer is 2 μM, and the concentration of the outer primer is 4 μM.

[0032] In another preferred example, in the primer set, the concentration of the loop primer is 4 μM.

[0033] In another preferred embodiment, the kit further comprises a 2× premix and a fluorescent dye.

[0034] In another preferred embodiment, the kit further comprises an amplification product capture probe.

[0035] In another preferred embodiment, the 2× premix solution includes DNA polymerase, dNTP and reaction buffer.

[0036] In another preferred embodiment, the DNA polymerase is Taq DNA polymerase.

[0037] In another preferred embodiment, the kit further comprises a positive control and / or a negative control.

[0038] In another preferred example, the positive control includes genomic DNA of a standard strain of Salmonella typhimurium, and the negative control includes ddH2O.

[0039] In another preferred embodiment, the standard strain of Salmonella typhimurium is Salmonella typhimurium strain ATCC14028.

[0040] In another preferred embodiment, the detection kit further comprises a label or instructions, wherein the label or instructions indicate that the detection kit is used for detecting Salmonella typhimurium.

[0041] The fifth aspect of the present invention provides a method for detecting Salmonella typhimurium using the kit described in the fourth aspect of the present invention, comprising the steps of:

[0042] (1) extracting nucleic acid to be tested from a sample;

[0043] (2) preparing a 25 μL reaction system, the reaction system comprising: 12.5 μL 2× reaction buffer, 0.5 μL 50× fluorescent dye, 2.5 μL 10× primer mixture, 7.5 μL ddH2O, and 2 μL nucleic acid to be tested;

[0044] (3) placing the reaction system in a fluorescent quantitative PCR instrument, and judging the detection result according to the amplification curve. If the amplification curve is "S"-shaped, it means that the sample contains Salmonella typhimurium; if the amplification curve is not "S"-shaped, it means that the sample does not contain Salmonella typhimurium.

[0045] In another preferred embodiment, the method for extracting the nucleic acid to be tested in the sample includes: a machine method and a boiling method.

[0046] In another preferred embodiment, the reaction system is carried out at 61° C.-69° C. for 30 minutes.

[0047] In another preferred embodiment, the reaction system is carried out at a temperature selected from the group consisting of 61°C, 63°C, 65°C, 67°C, or 69°C for 30 minutes.

[0048] In another preferred embodiment, the reaction system is carried out at 65° C. for 30 minutes.

[0049] In another preferred embodiment, the concentration range of the nucleic acid to be detected is ≥2.21×10 -6 ng / μL.

[0050] In another preferred embodiment, the minimum concentration of the nucleic acid to be detected is 2.21×10 -6 ng / μL.

[0051] In another preferred embodiment, the method is non-diagnostic and non-therapeutic.

[0052] In a sixth aspect of the present invention, a visualization detection kit for Salmonella typhimurium is provided, wherein the detection kit comprises the primer set described in the second aspect of the present invention.

[0053] In another preferred embodiment, the visualization detection kit further includes a color developer and a heating module.

[0054] In another preferred example, the color developer includes: a metal ion indicator, an acid-base indicator, and a dye color developer.

[0055] In another preferred embodiment, the heating module provides heating conditions for visual detection reactions.

[0056] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0057] Figure 1 This is the technical route of the present invention.

[0058] Figure 2 The electrophoresis ladder diagram is for screening the optimal primer set. Band M is Maker, and 1-8 is the strain number.

[0059] Figure 3 Figure 1 is a nucleic acid amplification diagram for specific verification. 1 and 2 are the standard strain numbers.

[0060] Figure 4 This is the electrophoresis diagram for specificity verification. M stands for Maker, and 1-8 stands for strain numbers.

[0061] Figure 5 This is the sensitivity nucleic acid amplification chart.

[0062] Figure 6 This is a sensitivity verification nucleic acid amplification diagram. M is Maker, and 1-8 is the strain number.

[0063] Figure 7 This is the actual sample machine method nucleic acid amplification curve. The light-colored curve in the figure is the stool sample of diarrhea patients.

[0064] Figure 8 The nucleic acid amplification curve was obtained by boiling the actual samples. DETAILED DESCRIPTION

[0065] The inventors have disclosed a real-time fluorescent LAMP detection method for Salmonella typhimurium after sufficient experiments. Specifically, the present invention designs three sets of loop-mediated isothermal amplification primers and a kit based on the STM4495 gene of Salmonella typhimurium, and uses the kit to detect the LAMP detection method of Salmonella typhimurium. The detection method is easy to operate, has strong specificity and high sensitivity, and can achieve rapid detection at a constant temperature. On this basis, the present invention is completed.

[0066] As a new type of nucleic acid amplification technology, LAMP can not only be used for the detection of Salmonella typhimurium, but also can be used to realize the visualization detection of many common pathogens such as Mycobacterium tuberculosis, Streptococcus pneumoniae, Vibrio parahaemolyticus, etc. As its various advantages are gradually known by researchers, it plays an important role in more and more fields. The present invention hopes to establish a simple, fast and accurate LAMP detection method for Salmonella typhimurium, which can meet the actual detection needs, improve the efficiency of pathogen identification in pathogenic microorganism laboratories, shorten the detection time limit, and meet the emergency detection guarantee needs of super-large city clustered epidemic disposal, major tasks or activities.

[0067] In order to improve and optimize the current detection methods, the present invention chooses to establish a rapid detection technology for Salmonella typhimurium based on real-time fluorescent loop-mediated isothermal amplification (RT-LAMP) detection technology, conducts consistency research with traditional isolation and culture detection results, and evaluates the diagnostic value of the rapid detection technology method. Improve the efficiency of laboratory pathogen identification of Salmonella typhimurium and shorten the detection time limit.

[0068] It should be understood that the specific methods and experimental conditions of the present invention are described below in various degrees of detail to provide a substantial understanding of the present invention. The definitions of certain terms used in this specification are provided below. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention belongs.

[0069] the term

[0070] Where a numerical range is provided, it is understood that each intermediate integer of the value, each tenth of each intermediate integer of the value, between the upper and lower limits of the range and any other intermediate values ​​in the specified range are included in the present invention unless the context clearly indicates otherwise. The upper and lower limits of these smaller ranges may be independently included in the smaller ranges and are also encompassed in the present invention, subject to any explicitly excluded limitations within the specified range. For example, "1 to 50" includes "2 to 25", "5 to 20", "25 to 50", "1 to 10", etc.

[0071] As used herein, the term "comprising" or "including (comprising)" may be open, semi-closed and closed. In other words, the term also includes "consisting essentially of" or "consisting of".

[0072] Salmonella Typhimurium

[0073] As the serotype that causes the most foodborne illnesses caused by Salmonella, Salmonella Typhimurium usually causes nausea and vomiting, and even fever or blood in the stool. Its clinical symptoms are very similar to those caused by other bacteria and viruses, making them difficult to identify. This poses a serious threat to the livestock and poultry farming industry and human public health safety.

[0074] LAMP

[0075] As used herein, the term "LAMP" is loop-mediated isothermal amplification (LAMP), which is a new gene amplification technology that is easy to operate, simple in equipment, and does not require thermal cycling. It is expected to replace molecular diagnosis based on PCR (Polymerase Chain Reaction, PCR) technology. LAMP technology has been applied to the detection of many common pathogens such as Mycobacterium tuberculosis, Streptococcus pneumoniae, and Vibrio parahaemolyticus.

[0076] At present, LMAP technology is not only used for the detection of viruses, bacteria, and parasites, but also extends to methods such as Multi loop mediated isothermal amplification (M-LAMP) and Real-time fluorescent loop-mediated isothermal amplification (RT-LAMP). In addition, LAMP has also been combined with other technologies such as LAMP-microfluidics technology, LAMP-LFD technology, nanogold LAMP labeling technology, microchip LAMP detection technology, LAMP-CRISPR technology, etc. It is expected that LAMP technology will be popularized for the detection of single nucleotide polymorphisms related to bacterial resistance to formulate the most effective antimicrobial drug treatment plan, provide new technical support in customs quarantine, disease control detection, combating smuggling crimes, and illegal transportation of animals and plants, and meet the needs of emergency accidents, severe infectious diseases, and large-scale quarantine. In the future, there will be LAMP technology with lower detection material costs, simpler operation steps, and higher accuracy, which will play a vital role in the field of detection technology.

[0077] LAMP detection kit for Salmonella typhimurium of the present invention

[0078] The present invention relates to a LAMP detection kit for Salmonella typhimurium, the detection kit comprising the primer set described in the second aspect of the present invention. The primer set comprises a pair of outer primers, a pair of inner primers and a pair of loop primers, wherein the concentration ratio of the inner and outer primers is 1:2. Preferably, the concentrations of the inner and outer primers are 2 μM and 4 μM respectively, and the concentration of the loop primer is 4 μM.

[0079] Preferably, the kit further comprises a 2× premix, a fluorescent dye, and an amplification product capture probe, wherein the 2× premix comprises a DNA polymerase, dNTPs, and a reaction buffer; and the DNA polymerase is Taq DNA polymerase.

[0080] Preferably, the kit further comprises a positive control and / or a negative control, the positive control comprises genomic DNA of a standard strain of Salmonella typhimurium, and the negative control comprises ddH2O; the standard strain of Salmonella typhimurium is the Salmonella typhimurium strain ATCC14028.

[0081] Visual detection kit for Salmonella typhimurium

[0082] The present invention also provides a visualization detection kit comprising the primer set of the present invention. The visualization detection kit utilizes a color developer, thereby being able to obtain detection results in real time and sensitively.

[0083] Preferably, the visualization detection kit further comprises a color developer and a heating module, wherein the heating module provides heating conditions for the visualization detection reaction, and the heating conditions are used for the amplification reaction of the nucleic acid to be detected.

[0084] Preferably, the color developer includes: a metal ion indicator, an acid-base indicator, and a dye color developer.

[0085] Metal ion indicators include hydroxynaphthol blue and HNB. In the LAMP amplification reaction, the continuous consumption of dNTPs will release a large amount of pyrophosphate ions, which will combine with magnesium ions in the reaction system to form precipitation, resulting in a decrease in the magnesium ion concentration in the solution. HNB is a metal indicator whose color will change with the change of magnesium ion concentration (from blue to purple or other colors).

[0086] The color development principle of acid-base indicators (such as phenol red) and dye color developers (such as bromothymol blue) is the same. A large number of hydrogen ions will be produced during the LAMP reaction, causing the pH of the reaction system to decrease. Both acid-base indicators and dye color developers will change color (such as from red to yellow) as the pH value of the solution changes.

[0087] The use of the above-mentioned color developers does not require additional equipment, is simple to operate, and the results can be observed quickly.

[0088] The main advantages of the present invention include:

[0089] (1) The present invention uses the STM4495 gene of Salmonella typhimurium as the target gene and designs three sets of primers to establish a rapid detection method based on RT-LAMP, among which SEQ ID NO: 7-SEQ ID NO: 14 is the optimal primer set.

[0090] (2) The RT-LAMP detection method for Salmonella typhimurium established in the present invention has a short detection time. At 65°C, the ratio of internal and external primer concentrations reaches 1:2, and the required detection time is 30 minutes, which is significantly lower than the time required for detection using traditional RT-PCR.

[0091] (3) The RT-LAMP detection method for Salmonella typhimurium established in the present invention has strong specificity and high sensitivity, and the minimum concentration of nucleic acid is 2.21×10 -6 ng / μL can be detected.

[0092] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or under conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are weight percentages and weight parts.

[0093] 1. Materials and Equipment

[0094] 1.1 Experimental strains

[0095] Selection Salmonella typhimurium, Salmonella enteritidis, Shigella dysenteriae, Plesiomonas shigelloides, Aeromonas hydrophila, Vibrio parahaemolyticus, and Escherichia coli are standard strains, and the strain information is (Table 1).

[0096] Table 1 Standard strains and sources

[0097]

[0098] 1.2 Main Reagents

[0099] The LAMP primer set screening reaction system required for this study (NEB, USA); Microbank magnetic bead preservation tube (bioMérieux, France); MacConkey plate (OXOID, UK); Columbia blood plate (Shanghai CHROMagar Microbiology Technology Co., Ltd., China); sterile saline (bioMérieux, France).

[0100] 1.3 Main instruments

[0101] The instruments used in this study were Roche LightCycler 480 real-time fluorescence quantitative PCR instrument (Roche Diagnostics GmbH, Germany), Qubit (Thermo Fisher Scientific, USA), Qsep 400 nucleic acid protein analyzer (BIOptic, China), and Roche nucleic acid extraction instrument (Roche Diagnostics GmbH, Germany).

[0102] 2. Experimental Methods

[0103] This research method is based on the RT-LAMP technology to design an experiment on Salmonella typhimurium, and optimize and adjust the experimental scheme ( Figure 1 ).

[0104] 2.1 Primer design and synthesis

[0105] Literature was searched, target genes were selected, and Primer Explorer V5 and NEB online primer design software were used to preliminarily screen related genes according to the principles of LAMP primer design. The NCBI BLASTn function was used to verify the specificity of the primer set, and a total of 7 primer sets were screened (Table 2). The required primer sets were synthesized by Shanghai Berger Biotech Co., Ltd.

[0106] Table 2 Salmonella typhimurium primers

[0107]

[0108]

[0109] 2.2 Screening of the optimal primer set 2.2.1 Recovery of standard strains

[0110] Inoculate standard strains 1 to 8 on Columbia blood plates and culture at 37°C for 12-16 hours. Use a pipette to take 300 μL of saline into an EP tube. Use the pipette tip to scrape all strains from the bacterial lawn in zones 1 and 2 of the plate and add them to saline. Mix well to make a bacterial suspension. Take 200 μL of the bacterial suspension into the Roche nucleic acid extraction reaction plate and put it on the machine. Store the extracted 50 μL nucleic acid sample in a -20°C refrigerator for later use.

[0111] 2.2.2 Reaction system configuration

[0112] The total volume of the amplification system was 25 μL (Table 3), and its components included 2×Master Mix (12.5 μL), 50×fluorescent dye (0.5 μL), 10×primer mixture (2.5 μL), ddH2O (7.5 μL), and template (2 μL). The ratio of the inner and outer primers in the primer mixture was 8:1, with the inner primer concentration being 16 μM, the outer primer concentration being 2 μM, and the loop primer concentration being 4 μM. The templates were the 8 groups of standard strain nucleic acids extracted in 2.2.1.

[0113] Table 3 Amplification system

[0114]

[0115] 2.2.3 Real-time fluorescence amplification and electrophoresis

[0116] Turn on the Roche LightCycler 480 real-time fluorescence quantitative PCR instrument to preheat and check the instrument performance. After adding the configured system to the prepared reaction tube, place it in the corresponding position of the instrument sample slot and record the placement order. Perform fluorescence amplification at 65°C for 30 minutes according to the amplification program. After the reaction is completed, observe the amplification curve and record its Ct value.

[0117] After preparing the standard to calibrate the Qubit, the concentration of the amplified product genome was measured and made to be less than 60 ng / μL.

[0118] Use Qsep400 Nucleic Acid Protein Analyzer to determine nucleic acid integrity. Before using the instrument, check whether a marker is needed. Alignment Marker volume is 30μL, add 10-15μL mineral oil seal, Size Marker volume is 30μL, add 10-15μL mineral oil seal, dilute the buffer 10 times, adjust the sample to be tested to the optimal concentration range (1.5-2ng / μL) with dilution buffer, the volume is 15-20μL, add it to a 200μL reaction tube, and put the sample and buffer into the instrument at the same time, load the card holder, and start running the program to determine the integrity of the DNA. After the reaction is completed, select the optimal primer set by observing the distribution of the ladder bands.

[0119] 2.3 Optimization of LAMP reaction conditions

[0120] 2.3.1 Optimization of internal and external primer concentrations

[0121] Using Salmonella typhimurium (ATCC14028) nucleic acid as template, set 7 internal and external primer concentration ratios to optimize the reaction conditions of the optimal primer set screened in 2.2, namely 8:1, 4:1, 2:1, 1:1, 1:2, 1:4 and 1:8; and the internal and external primer concentrations were 16μM:2μM, 8μM:2μM, 4μM:2μM, 2μM:2μM, 2μM:4μM, 2μM:8μM and 2μM:16μM, respectively. According to the amplification procedure, fluorescence amplification was performed at 65°C for 30 minutes, and each experiment was repeated 3 times. Finally, the optimal internal and external primer concentration ratio was determined by the fluorescence value of the amplification curve and the presence or absence of specific amplification.

[0122] 2.3.2 Optimization of reaction temperature

[0123] Using Salmonella typhimurium (ATCC14028) nucleic acid as a template, five reaction temperatures were set, namely 61°C, 63°C, 65°C, 67°C, and 69°C, to optimize the reaction conditions of the optimal primer set screened in 2.2. The inner and outer primer concentration ratio was the optimal inner and outer primer concentration ratio screened in 2.3.1. Each experiment was repeated 3 times, and the optimal reaction temperature was determined by the fluorescence value of the amplification curve and the presence or absence of specific amplification.

[0124] 2.4 Specificity Verification

[0125] The optimal primer set and reaction conditions selected in 2.2 and 2.3 were specifically verified. The nucleic acids of 6 non-target strains and 2 target strains were used as templates, and 3 replicate wells were set for each strain. 2 μL of template was added to each reaction well, 2 μL of ddH2O was added to the negative control, and a blank control was set. The experiment was repeated at least 3 times. After the reaction was completed, the results were judged based on the amplification curve and electrophoresis diagram.

[0126] 2.5 Sensitivity Verification

[0127] The sensitivity of the optimal primer set and reaction conditions selected in 2.2 and 2.3 was verified. The nucleic acid of the target pathogen was extracted, and its nucleic acid concentration and integrity were determined. ddH2O was used for 10-fold gradient dilution, with a total of 8 dilution gradients, namely 2.21×10 -3 , 2.21×10 -4 , 2.21×10 -5 , 2.21×10 -6 , 2.21×10 -7 , 2.21×10 - 8 , 2.21×10 -9 , 2.21×10 -10ng / μL, prepare the LAMP reaction system and package it, add the DNA template, repeat each experiment at least 3 times, judge the results according to the amplification curve and electrophoresis diagram, and repeat each experiment at least 3 times.

[0128] 2.6 Actual sample verification

[0129] Three samples (sampling numbers 11039, 11828, and 4087) that had been confirmed as positive for Salmonella typhimurium by traditional detection methods (biochemical tests + serum agglutination) were directly extracted for nucleic acid by machine and boiling methods without pathogen culture, and then tested by the LAMP method. The results were judged based on the amplification curves.

[0130] Example 1: Screening of the optimal primer set

[0131] After the nucleic acid of the target strain (strain number 1-2) was amplified by 7 sets of primers (i.e. primers A1-A7 in 2.2.1), obvious waterfall-shaped ladder bands were observed by electrophoresis. The non-target strains (strain number 3-8) all had a few ladder-shaped bands ( Figure 2 ). Comparing the 7 groups of electrophoresis images, the waterfall-shaped bands of the target strain in group A2 were the most obvious, while the non-target strains did not show obvious waterfall-shaped bands, indicating that group A2 had the best specificity ( Figure 2 (b)), primer group A2 was selected as the optimal primer group for subsequent experimental verification.

[0132] Example 2: Optimization of LAMP reaction conditions

[0133] (1) Optimization of internal and external primer concentrations: The results showed that all seven internal and external primer concentration ratios had obvious specific amplification and when the concentration was 1:2, the Ct was the smallest, indicating that the amplification effect was the best, indicating that the optimal reaction concentration ratio was 1:2 (Table 4).

[0134] Table 4 Optimized Ct values ​​of LAMP reaction concentration

[0135]

[0136] (2) Optimization of reaction temperature

[0137] The results showed that specific amplification occurred in all five groups at different temperatures, and the Ct value was the smallest at 65°C, indicating that the amplification effect was the best and the time was the shortest. Therefore, the optimal temperature for the amplification reaction was 65°C (Table 5).

[0138] Table 5 LAMP reaction temperature optimization Ct value

[0139]

[0140] Example 3: Specificity Verification

[0141] After three repeated experiments, the results showed that under the reaction conditions of 65℃ for 30 min, only the target strain had two obvious specific amplifications, while the non-target strains did not show obvious specific amplifications ( Figure 3 , Table 6). The target strains all had obvious waterfall-shaped trapezoidal bands, while the non-target strains did not have obvious waterfall-shaped trapezoidal bands ( Figure 4 ). This indicates that the primer set A2 is specific to Salmonella typhimurium and can be used for the specific detection of Salmonella typhimurium.

[0142] Table 6 LAMP specificity verification Ct value

[0143]

[0144] Example 4: Sensitivity Verification

[0145] After three repeated experiments, the results showed that the amplification curve and Ct size results ( Figure 5 , Table 7). The results show that 2.21×10 -3 , 2.21×10 -4 , 2.21×10 -5 , 2.21×10 -6 ng / μL have nucleic acid amplification curves and fluorescence values, and the electrophoresis diagrams have waterfall-shaped ladder bands ( Figure 6 ). This indicates that its sensitivity can reach 2.21×10 -6 ng / μL.

[0146] Table 7. LMAP sensitivity verification Ct values

[0147]

[0148] Example 5: Actual sample verification results

[0149] Three strains of Salmonella typhimurium were detected by both the machine method and the boiling method ( Figure 7 , Figure 8 ).

[0150] Table 8 Ct values ​​verified by actual samples

[0151]

[0152] discuss

[0153] In this study, seven sets of primers were designed with STM4495, STM4497, and flic genes of Salmonella typhimurium as target genes. The optimal primer set for the STM4495 gene was selected through screening, and a rapid detection method of RT-LAMP was established by optimizing the reaction conditions. This method is simple and fast to operate, has strong specificity and high sensitivity, and can achieve rapid on-site detection at a constant temperature, which is of great significance for the rapid screening of food and major epidemics.

[0154] Compared with the qPCR method, the RT-LAMP method only requires a constant temperature reaction for 30 minutes for fluorescence amplification, while most RT-PCR reactions take about 60 minutes. Studies have shown that 4.97pg / mL can be detected in Salmonella typhimurium by LAMP, but the sensitivity of RT-LAMP in this study is relatively low, which may be related to the addition of an indicator. In 2010, Wastling et al. found that the addition of calcein may reduce the sensitivity of LAMP. This is because the use of calcein will cause deviations in the concentration of Mg2+ in the reaction system, which will lead to errors in the results. At low concentrations of Mg 2+ Under these conditions, the enzyme activity decreased and the amount of product decreased. 2+ When the concentration is too high, non-specific reactions will occur. Calcein inhibits the LAMP reaction to a certain extent, and the interaction between calcein and double-stranded DNA may lead to a decrease in reaction sensitivity.

[0155] The main advantages of RT-LAMP technology are: in addition to the sample opening operation, the fully closed tube operation can effectively avoid false positives caused by amplification product contamination. False positive results of RT-LAMP are often caused by aerosol contamination, which is a problem barrier of RT-LAMP technology. The main reason may be that the sensitivity of RT-LAMP detection technology is high and it is easily affected by aerosols diffused into the reaction system. In order to prevent the occurrence of false positive results, the operation in the fume hood should be selected during the experimental operation, the reaction product should be handled in time after the reaction is completed, and the pipette tip should be frequently replaced during the preparation of the reaction system. The RT-LAMP detection method for Salmonella typhimurium established in this study has high sensitivity, strong specificity, and short detection time. The entire experimental process from DNA extraction to detection completion only takes about 1 hour, which effectively shortens the detection time and has low inspection costs. It is simple to operate and is convenient for large-scale detection.

[0156] With the development of science and technology in the future, the development of LAMP technology will become more and more perfect. With the different requirements for samples, the application of LAMP technology will become more and more extensive in the future, and it has broad prospects. This technology is bound to better serve many fields such as molecular biology research.

[0157] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A LAMP primer set for Salmonella typhimurium, characterized in that: The primer set is a primer set for the marker gene of Salmonella typhimurium, wherein the marker gene of Salmonella typhimurium is the STM4495 gene.

2. A LAMP primer set for the STM4495 gene of Salmonella typhimurium, characterized in that: The primer set includes a pair of outer primers, a pair of inner primers and a pair of loop primers, and the sequences of the primers are as follows: STM4495-F3-b:ATTCTGCGCTGTCGGTATG, STM4495-B3-b:CCCAGCTTTCCGGCTTTG; STM4495-FIP-b: TAAGCTGTGGCAGCAGCTGAA-CTCGGCAAACATATCCC CCA, STM4495-BIP-b:CAGATGCAGGCTCTCCTGC-AGATGGCCCGTCAGGATGA C; STM4495-LF-b: CCACCAGCAGAACCAGACTG, STM4495-LB-b: GCACGTCGCGGGTGAATA.

3. A LAMP primer set for the STM4495 gene of Salmonella typhimurium, characterized in that: The primer set for STM4495 comprises a pair of outer primers and a pair of inner primers, and the sequences of the primers are selected from the following group: (1)STM4495-F3-a: GATAATTTCATCTTCAATTTCTGG, STM4495-B3-a: AATTTTTGCGTGAGATATCGT; STM4495-FIP-a: GCACTCCGGTTGTAAACATTAT-TTGTACTGAGGCTAAT TCACCAC, STM4495-BIP-a:CGCAGCGTAAAGCAACTCATC-CAAAAGGGTTTGTTTTTGATG. (2)STM4495-F3-c: ACTACCGCATCATACCGCT, STM4495-B3-c:CTGATGCGCACGCTGAAG; STM4495-FIP-c:GGAGCAGGAAGGCGATTTCCA-ACGCCTGCTGAATATAC GGA, STM4495-BIP-c: TAGCGCTTCGAGAAACGCCT-TTGAACGCCAAAACGCTG G.

4. A LAMP detection kit for Salmonella typhimurium, characterized in that: The detection kit comprises the primer set according to claim 2.

5. The kit according to claim 4, characterized in that The concentration ratio of the primer set is as follows: the concentration ratio of the inner and outer primers is 1:

2.

6. The kit according to claim 4, characterized in that The kit also includes a 2× premix and a fluorescent dye.

7. The kit according to claim 4, characterized in that The kit further comprises a positive control and / or a negative control, wherein the positive control comprises genomic DNA of a standard strain of Salmonella typhimurium, and the negative control comprises ddH2O.

8. A method for detecting Salmonella typhimurium using the kit according to claim 4, characterized in that: Includes steps: (1) extracting nucleic acid to be tested from a sample; (2) preparing a 25 μL reaction system, the reaction system comprising: 12.5 μL 2× reaction buffer, 0.5 μL 50× fluorescent dye, 2.5 μL 10× primer mixture, 7.5 μL ddH2O, and 2 μL nucleic acid to be tested; (3) placing the reaction system in a fluorescent quantitative PCR instrument, and judging the detection result according to the amplification curve. If the amplification curve is an "S" type, it means that the sample contains Salmonella typhimurium; if the amplification curve is not an "S" type, it means that the sample does not contain Salmonella typhimurium.

9. The method according to claim 8, characterized in that The reaction system was carried out at 65°C for 30 minutes, and the minimum concentration of the nucleic acid to be tested was 2.21×10 -6 ng / μL.

10. A visual detection kit for Salmonella typhimurium, characterized in that: The detection kit comprises the primer set according to claim 2.

Images