Wheat plant height-related SNP locus 353A / C and its application

Abstract

The present invention discloses a single-nucleotide polymorphism (SNP) site associated with wheat plant height and its application. The SNP site corresponds to the 353rd base from the 5' end of the nucleotide sequence shown in SEQ ID NO.1 in the sequence listing. The nucleotide polymorphism at this site exhibits R=C or A. This site has two genotypes: homozygous C / C and homozygous A / A. The plant height of wheat materials with the C / C genotype is significantly higher than that of wheat materials with the A / A genotype. The SNP site of the present invention not only expands the genetic resource tools for wheat, but also has good and extensive application potential as verified by scientific research experiments and data statistics.

Description

Technical Field

[0001] This invention relates to the field of molecular biology, and in particular to a SNP site related to wheat plant height and its application. Background Technology

[0002] Wheat (Triticum aestivum L.) is one of the most important food crops in my country and the world, second only to rice and corn in yield, accounting for about 35% of the world's total food production and providing the largest source of protein for the human diet. With the rapid growth of the global population, there is a need to continuously increase wheat production to ensure global food supply. Plant height is an important agronomical trait affecting wheat yield. Therefore, identifying the loci or genes responsible for plant height is of great significance for marker-assisted selection in wheat breeding.

[0003] Wheat plant height is closely related to lodging resistance, thus affecting yield. Zhou et al. used a recombinant inbred line population resulting from the cross between Yangmai 158 and Xifeng to perform molecular mapping of QTLs affecting plant height. Chen et al. used the wild emmer wheat chromosome arm substitution line CASL7AS as the maternal parent and Zhejiang Agricultural Forestry 12 as the paternal parent to construct a high-density genetic map using a 55K SNP chip, and performed QTL analysis on wheat plant height. A total of 53 QTL loci were detected on chromosomes 1A, 3A, 5A, 7A, 1B, 3B, 4B, 5B, 7B, 2D, 4D, 6D, and 7D.

[0004] Although a large number of QTLs related to plant height have been identified, the genetic effects of most QTLs remain unclear, their phenotypic contribution is relatively small, and they exhibit poor repeatability across different years and environments. Therefore, most QTLs are difficult to apply to the genetic improvement of wheat plant height. In other words, developing stable major-effect SNP functional sites and, based on these, developing practically significant molecular markers for the molecular improvement of wheat plant height is of great importance. Summary of the Invention

[0005] The technical problem to be solved by this invention is to provide a SNP locus related to wheat plant height, and at the same time to conduct technical research and application expansion on its potential applications in wheat molecular breeding, agricultural yield increase and other fields.

[0006] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows.

[0007] The SNP site associated with wheat plant height, wherein the SNP site corresponds to the 353rd base from the 5' end of the nucleotide sequence shown in SEQ ID NO.1 in the sequence listing, and the nucleotide polymorphism at this site is R=C or A.

[0008] As a preferred embodiment of the present invention, when the nucleotide at the SNP site is C / C homozygous, the corresponding genotype is type A or type I; when the nucleotide at the SNP site is A / A homozygous, the corresponding genotype is type B or type II; and the plant height of type A or type I wheat is significantly greater than / candidate greater than the plant height of type B or type II wheat.

[0009] The SNP sites are used for theoretical research on the principles of wheat plant height development and / or for molecular regulatory pathway research on wheat plant height development. This includes: identifying, characterizing, and / or differentiating downstream effector molecules based on genotypic differences at the SNP sites to construct a wheat plant height molecular regulatory pathway. The effector molecules include, but are not limited to, messenger RNA, proteins, associated enzymes, various molecular regulatory components, and various molecular signaling components. Furthermore, based on the constructed wheat plant height molecular regulatory pathway, major or key regulatory nodes and their corresponding macromolecules or small molecule components are identified and confirmed.

[0010] The purpose of the SNP sites is to develop molecular markers based on the SNP sites and existing molecular biology techniques, and to further screen or assist in screening wheat plant height phenotype in the early stages of molecular marker-assisted selection breeding.

[0011] The purpose of the SNP locus is to regulate wheat plant height in the agricultural industry according to production needs, including: increasing or decreasing wheat plant height.

[0012] A gene detection kit for detecting the aforementioned SNP sites, the gene detection kit containing a PCR amplification specific primer combination and a specific restriction endonuclease, as well as template DNA, 2×Taqmix, dNTPs and other necessary components for gene detection.

[0013] The PCR amplification specific primer combination includes: primer pairs 1F and 1R consisting of SEQ ID NO.2 and SEQ ID NO.3 in the sequence listing, and / or primer pairs 2F and 2R consisting of SEQ ID NO.4 and SEQ ID NO.5 in the sequence listing; the specific restriction endonuclease is EcoRII.

[0014] The molecular marker combination associated with wheat plant height includes: molecular marker A obtained by amplifying the 5' end sequence from position 173 to 698 of SEQ ID NO.1 using primer pairs 1F and 1R; and / or molecular marker B obtained by amplifying the 5' end sequence from position 328 to 574 of SEQ ID NO.1 using primer pairs 2F and 2R.

[0015] Primer combinations for detecting the genotype of the SNP site specifically include: primer pairs 1F and 1R consisting of SEQ ID NO.2 and SEQ ID NO.3 in the sequence listing, and / or primer pairs 2F and 2R consisting of SEQ ID NO.4 and SEQ ID NO.5 in the sequence listing.

[0016] In the early stages of breeding, a method for identifying or assisting in the identification of wheat plant height involves designing primers to amplify any DNA fragment containing the SNP site in the genomic DNA of the wheat to be tested via PCR. The wheat genotype is then identified by enzyme digestion of the PCR amplification product. Based on the following correlation between genotype and phenotype, the wheat plant height phenotype is identified or assisted in its identification: when the nucleotide at the SNP site is C / C homozygous, the corresponding genotype is type A or type I; when the nucleotide at the SNP site is A / A homozygous, the corresponding genotype is type B or type II. Furthermore, the plant height of type A or type I wheat is significantly greater than / candidate wheat is greater than the plant height of type B or type II wheat.

[0017] The beneficial effects of adopting the above technical solution are as follows: The high-density gene data analysis of the wheat population by our research group linked multiple quantitative gene loci. Based on this, we further developed and confirmed SNP loci associated with wheat plant height that have the potential for multi-environmental stable major effects. Experiments have shown that by detecting these SNPs, wheat varieties with relatively high or low plant heights can be identified. These SNP loci provide gene resources and molecular markers for wheat genetic improvement, and further offer a new method for marker-assisted selection breeding of wheat, which is of great significance in the breeding of high-yielding wheat varieties and related research. Attached Figure Description

[0018] Figure 1 The results of electrophoresis detection of the SNP-developed dCAPS-labeled enzyme digestion products of this invention are shown below; wherein, lane M is the molecular weight standard; lane A is the band cleaved by EcoRII, and lane C is the band that cannot be cleaved by EcoRII.

[0019] Figure 2 The results are the analysis of two types, I and II, in the natural population and their correlation with plant height. Detailed Implementation

[0020] The following embodiments illustrate the present invention in detail. All raw materials and equipment used in this invention are commercially available products and can be directly obtained through market purchase. The wheat materials used in the following embodiments are all from the National Crop Germplasm Bank (http: / / icscaas.com.cn / jiguoku / zhongzhiku.htm), and material information can be found on the China Crop Germplasm Information Network, website: http: / / icgr.caas.net.cn.

[0021] It should be understood that, when used in this specification and the appended claims, the term "comprising" indicates the presence of a described feature, integral, step, operation, element, and / or component, but does not exclude the presence or addition of one or more other features, integrals, steps, operations, elements, components, and / or collections thereof. It should also be understood that, as used in this specification and the appended claims, the term "and / or" refers to any combination of one or more of the associated listed items and all possible combinations, and includes such combinations.

[0022] As used in this application specification and the appended claims, the term "if" may be interpreted, depending on the context, as "when," "once," "in response to determination," or "in response to detection." Similarly, the phrase "if determined" or "if detected [the described condition or event]" may be interpreted, depending on the context, as meaning "once determined," "in response to determination," "once detected [the described condition or event]," or "in response to detection [the described condition or event]."

[0023] Furthermore, in the description of this application and the appended claims, the terms "first," "second," "third," etc., are used only to distinguish descriptions and should not be construed as indicating or implying relative importance. References to "one embodiment" or "some embodiments" in this application mean that one or more embodiments of this application include a specific feature, structure, or characteristic described in connection with that embodiment. Therefore, the phrases "in one embodiment," "in some embodiments," "in other embodiments," "in still other embodiments," etc., appearing in different parts of this specification do not necessarily refer to the same embodiment, but rather mean "one or more, but not all, embodiments," unless otherwise specifically emphasized. The terms "comprising," "including," "having," and variations thereof mean "including but not limited to," unless otherwise specifically emphasized.

[0024] Example 1: Specific primers and sequence analysis for amplifying the genomic fragment containing this wheat SNP.

[0025] The developed SNP should be located at position 353 from the 5' end of sequence listing 1; this site has two genotypes in the naturally occurring wheat population:

[0026] Genotype A: C

[0027] Genotype B: A

[0028] Based on the sequence differences in different wheat genomes, specific primers were designed for PCR amplification of DNA fragments containing the SNP site:

[0029] F1: TCTTGGGGTCGGTGATTACCGCCGATTACT; (SEQ ID NO.2)

[0030] R1: CTTTTGTCTTCTTTGGAGTATTGCTCCGAT; (SEQ ID NO.3)

[0031] F2: CCGCCTCCATCAGACCCTCGGCACC; (SEQ ID NO.4)

[0032] R2: ACGCTGGCAAGACAGTTAAATGTTT; (SEQ ID NO.5)

[0033] The target sequences for PCR amplification using primer pairs F1 and R1 are shown in Sequence 1 of the sequence listing, positions 173-698; the target sequences for PCR amplification using primer pairs F2 and R2 are shown in Sequence 1 of the sequence listing, positions 328-574. Enzyme digestion analysis showed that this polymorphism could be recognized by EcoRII.

[0034] Example 2: Establishment of PCR-restriction polymorphism detection and genotyping method

[0035] 1) Extract genomic DNA from the wheat to be tested;

[0036] 2) Using the genomic DNA from step 1) as a template, perform PCR amplification with primers F1 and R1. The PCR amplification system (10 μL) consists of: 3.5 μL ddH2O, 0.5 μL each of primer F1 (10 μmol / L) and primer R1 (10 μmol / L), 5 μL 2×Taqmix, and 0.5 μL template (20 ng / μL).

[0037] PCR amplification conditions were: 95℃ for 2 min; 95℃ for 30 s, 60℃ for 30 s, 72℃ for 1 min, for 30 cycles; 72℃ for 10 min, and stored at 16℃.

[0038] 3) Dilute the PCR product from step 2) 10 times and use it as a template for PCR amplification with primers F2 and R2. The PCR amplification system (20 μL) is as follows: ddH2O 7 μL, primer F2 (10 μmol / L) and primer R2 (10 μmol / L) 1 μL each, 2×Taq mix 10 μL, and template (20 ng / μL) 1 μL.

[0039] PCR amplification conditions were: 95℃ for 2 min; 95℃ for 30 s, 60℃ for 30 s, 72℃ for 20 s, for 34 cycles; 72℃ for 10 min; and storage at 16℃.

[0040] 4) Digest the PCR product obtained in step 3) with EcoRII to obtain the digested product. Perform 4% agarose gel electrophoresis to detect whether the PCR product was digested into two fragments. Determine and record the status of the wheat sample at the specified sites according to the following method:

[0041] If the enzyme digestion product consists of two fragments, then the wheat being tested is homozygous for A at the specified site (represented as A / A). Figure 1 Lane A in the swimming pool;

[0042] If the enzyme digestion product is a single fragment, then the wheat being tested is homozygous for C at the specified site (represented as C / C). Figure 1 Lane C in the swimming pool.

[0043] 5) Based on the results of step 4), wheat is classified into two types, I and II, at the stated site:

[0044] I: C / C (i.e., homozygous genotype A);

[0045] II: A / A (i.e., homozygous genotype B);

[0046] The part before the " / " represents the case on one homologous chromosome, and the part after the " / " represents the case on another homologous chromosome.

[0047] Example 3: Genotyping of natural populations using dCAPs markers and correlation analysis with plant height trait.

[0048] Each wheat variety in a natural population consisting of 323 hexaploid wheat was used as a test wheat variety. Genotyping was performed according to the method in step 2. The amplification products of some wheat varieties were randomly sequenced for verification. The results are shown in Table 1.

[0049] Table 1 shows the polymorphic sites in the natural wheat population.

[0050]

[0051]

[0052]

[0053]

[0054]

[0055] Example 4: Results of gene polymorphism loci in natural populations and their association with plant height

[0056] See appendix Figure 2 As shown in Table 2, the above-mentioned natural wheat populations were planted in dryland, irrigated, drought-heat, and hydrothermal areas at the Experimental Farm of the Institute of Crop Science, Chinese Academy of Agricultural Sciences (Shunyi, Beijing). Plant height of each wheat variety was investigated. A correlation analysis between plant height and the polymorphic loci was performed using Tassel 5.0 software. A mixed linear model + population structure (MLM+(Q+K)) method was selected for analysis, with P < 0.05 considered significant. The results are shown in Table 2 and the appendix. Figure 2 As shown.

[0057] Table 2. Results of gene polymorphism loci and their association with plant height in natural populations.

[0058]

[0059] The association analysis results in Table 2 show that the differences in plant height between the two types formed by the natural population of 323 hexaploid wheat accessions shown in Table 1 were statistically significant (P < 0.05). Specifically, wheat of type I had a higher plant height than wheat of type II. In several environments, the plant height of wheat materials of type I was 12.102 cm, 11.177 cm, 11.560 cm, 10.819 cm, 9.141 cm, 10.927 cm, 11.088 cm, and 14.079 cm taller than wheat of type II, respectively. This study of the natural population indicates that type I is a superior genotype for increasing wheat plant height.

[0060] In the above embodiments, the descriptions of each embodiment have different focuses. For parts that are not described in detail or recorded in a certain embodiment, please refer to the relevant descriptions of other embodiments.

[0061] As can be seen from the above embodiments, in the study of this application, through genetic variation analysis of a natural wheat variant population, multiple SNPs were found. The core SNP, which is significantly associated with wheat plant height, is located at position 353 from the 5' end of SEQ ID NO.1 in the sequence listing.

[0062] This SNP has two genotypes: genotype A / I (CC) and genotype B / II (AA). Association analysis showed that among the homozygous types of these two genotypes, the plant height was: wheat homozygous for genotype A > wheat homozygous for genotype B.

[0063] This invention also provides a dCAPS marker for detecting the SNP. Experiments have shown that wheat varieties with higher plant height can be identified by detecting the SNP. This invention provides a new method for molecular marker-assisted selection breeding of wheat, which can effectively improve the efficiency of molecular breeding and accelerate the wheat breeding process, and has important significance in the breeding of high-yielding wheat varieties and research.

[0064] The above-described embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention, and should all be included within the protection scope of the present invention.

Claims

1. Use of primers for detecting SNP sites, characterized in that: The SNP site corresponds to the 353rd base from the 5' end of the nucleotide sequence shown in SEQ ID NO. 1 in the sequence listing, and the nucleotide polymorphism at this site is R=C or A; when the nucleotide at the SNP site is homozygous for C / C, the corresponding genotype is type A or type I; when the nucleotide at the SNP site is homozygous for A / A, the corresponding genotype is type B or type II; and the plant height of type A or type I wheat is significantly greater than that of type B or type II wheat; The primers specifically include: primer pair 1F and 1R composed of SEQ ID NO. 2 and SEQ ID NO. 3 in the sequence list, and primer pair 2F and 2R composed of SEQ ID NO. 4 and SEQ ID NO. 5 in the sequence list; PCR amplification is performed on a DNA fragment containing the SNP site in the wheat genomic DNA to be tested using these primers, and the obtained PCR product is used to Eco The enzyme digestion products are obtained by RII digestion and electrophoresis is performed. If the enzyme digestion product is two fragments, the wheat genotype to be tested is A / A; if the enzyme digestion product is one fragment, the wheat genotype to be tested is C / C; The use is to screen or assist in screening wheat plant height phenotypes in the early stages of molecular marker-assisted selection breeding, and then regulate wheat plant height according to production needs in the agricultural industry. The regulation includes: increasing wheat plant height or reducing wheat plant height.

2. A method for identifying or assisting in identifying wheat plant height in the early stages of breeding, characterized in that: Based on the SNP site of claim 1, in the early stage of molecular marker-assisted selection breeding, the primers of claim 1 are used to perform PCR amplification on the DNA fragment containing the SNP site in the wheat genomic DNA to be tested, and the obtained PCR product is used Eco RII enzyme digestion is performed to obtain the enzyme digestion product for electrophoresis. If the enzyme digestion product is two fragments, the wheat genotype to be tested is A / A; if the enzyme digestion product is one fragment, the wheat genotype to be tested is C / C; and the wheat plant height phenotype is identified or assisted in identification based on the following correlation between genotype and phenotype: when the nucleotide at the SNP site is homozygous for C / C, the corresponding genotype is type A or type I; when the nucleotide at the SNP site is homozygous for A / A, the corresponding genotype is type B or type II, and the plant height of type A or type I wheat is significantly greater than that of type B or type II wheat.

Images