A portable field tobacco black shank pathogen rapid diagnosis and identification kit

Abstract

The application discloses a portable field tobacco black foot disease pathogen rapid diagnosis and identification kit and belongs to the technical field of tobacco black foot disease detection. The application discloses an upstream primer, a downstream modified primer and a multi-site modified probe, and the nucleotide sequences are respectively as shown in SEQ ID NO. 1-SEQ ID NO. 7. Meanwhile, the probe and the primer are used to prepare a kit for detecting the tobacco black foot disease, so that the problems that the current tobacco black foot disease pathogen detection is difficult to be performed in the field without complex equipment, the existing detection methods are complex to operate, the procedures are tedious and the sensitivity is low and the like are solved.

Description

Technical Field

[0001] This invention relates to the field of tobacco black shank disease detection technology, and in particular to a portable rapid diagnostic method for tobacco black shank disease in the field, as well as primers, probes and reagent kits. Background Technology

[0002] Tobacco black shank is caused by *Phytophthora parasitica* (also known as tobacco phytophthora, an oomycete, Latin name *Phytophthora parasitica* or *Phytophthora nicotianae*), a semi-living parasitic soil-borne rhizomatous disease that can infect tobacco plants from seedling to mature stages, affecting both roots and leaves. *Phytophthora parasitica* has a very wide host range, infecting more than 250 genera of plants, and control measures such as crop rotation have limited effectiveness. During the infection process, *Phytophthora parasitica* infects tobacco, causing black shank, with a difficult-to-detect incubation period. Once symptoms appear, the disease develops rapidly, and by the time obvious symptoms appear, it is often too late to save the plant with pesticides, frequently causing significant economic losses in tobacco cultivation. It is one of the major diseases in tobacco farming, making early diagnosis of tobacco black shank particularly important. Therefore, establishing efficient, rapid, and practical pathogen detection techniques is of great significance for the monitoring and diagnosis of tobacco black shank.

[0003] Recombinase Polymerase Amplification (RPA) technology is based on the T4 phage nucleic acid replication mechanism. Through the action of the T4 phage recombinase protein (uvsX), single-strand binding protein (SSB), and DNA polymerase (Bsu), an isothermal amplification reaction of nucleic acids is completed in vitro. Primer design is a key factor determining recombinase polymerase amplification. RPA primer design differs from general PCR primer design. Excessively long primers are prone to primer dimers and hairpin structures, while excessively short primers reduce the recombination rate, affecting amplification speed and detection sensitivity. Currently, there is no software to assist in primer screening, which presents a challenge. Therefore, the principles of primer design and screening require extensive experimentation to be established during the primer design stage.

[0004] Therefore, early and rapid diagnosis of tobacco black shank can provide an important basis for precise application of pesticides for the prevention and control of tobacco black shank, and is an important foundation for the promotion and application of green prevention and control technologies. Therefore, there is an urgent need for a method that can quickly detect tobacco black shank in the wild or in the field. Summary of the Invention

[0005] Therefore, the purpose of this invention is to provide a portable rapid diagnostic method for tobacco black shank in the field, as well as primers, probes and reagent kits, to solve the problems of complex operation, cumbersome procedures, low sensitivity and many false positives in the current detection of tobacco black shank.

[0006] A primer and probe for rapid detection of tobacco black shank disease, wherein the primer comprises an upstream primer and a downstream modified primer, the nucleotide sequences of the upstream primer are shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively, and the nucleotide sequences of the downstream modified primer are shown in SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6, respectively; and the nucleotide sequence of the probe is shown in SEQ ID NO.7.

[0007] Specifically, the nucleotide sequences of the upstream primers are as follows:

[0008] SEQ ID NO.1(NFO-PPM25F1):CAGTAGATCGAATCCTTGGAGGAGATCGTGT;

[0009] SEQ ID NO.2(NFO-PPM25F2):GTAGATCGAATCCTTGGAGGAGATCGTGTAT;

[0010] SEQ ID NO.3(NFO-PPM25F3):AGATCGAATCCTTGGAGGAGATCGTGTATCC;

[0011] The nucleotide sequence of the downstream modification primer is as follows:

[0012] SEQ ID NO.4(NFO-PPM25R1):GAAGCGCCAGTTGGCCTTTGTGAACAAGAAA;

[0013] SEQ ID NO.5(NFO-PPM25R2):GCGCCAGTTGGCCTTTGTGAACAAGAAAGC;

[0014] SEQ ID NO.6(NFO-PPM25R3):CCAGTTGGCCTTTGTGAACAAGAAAGCTGATC;

[0015] The nucleotide sequence of the probe is as follows:

[0016] SEQ ID NO.7 (NFO probe):

[0017] ACTCCGAGGATTACGTAATCTTCACAGATGATGACGTAATCACTG;

[0018] Furthermore, the 5' end of the downstream modified primer is biotin-labeled, the 5' end of the probe is fluorescently labeled, and the probe further includes at least one of the following features:

[0019] (1) The intermediate sequence of the probe contains a nucleotide analog;

[0020] (2) The nucleotide analogues include tetrahydrofuran residues;

[0021] (3) The 3' end of the probe has a polymerase extension blocking group;

[0022] (4) The polymerase extension blocking group includes any one of the following: C3-spacer group, phosphate group, and dideoxynucleotide.

[0023] Preferably, the fluorescent label described in this invention is FAM.

[0024] The present invention discloses the application of one of the upstream primers and one of the downstream modified primers in combination with a probe for the detection of tobacco black shank disease, and the detection limit of pathogen DNA can reach 100 fg, with high sensitivity and accuracy.

[0025] Based on the above probes and primers, this invention also discloses a rapid detection method for tobacco black shank disease, the method being as follows:

[0026] DNA was extracted from the plant tissue to be tested to obtain a DNA extract. The DNA extract was then subjected to RPA amplification, and the results were read using an immunochromatographic gold lateral flow test strip. The RPA amplification reaction system consisted of 50 μL of DNA extract, 2 μL of 10 μM upstream primer, 2 μL of 10 μM downstream modification primer, 0.6 μL of 10 μM probe, 40.9 μL of Buffer A, 2.5 μL of Buffer B, and one tube of RPA amplification enzyme and exonuclease dry powder (Junuode, catalog number A4631). The reaction conditions were incubation at 30-45℃ for at least 15 min.

[0027] The RPA reaction amplification enzyme and exonuclease dry powder tubes contain recombinase protein, DNA polymerase, exonuclease nfo, and single-strand binding protein.

[0028] The detection method of the present invention is convenient, rapid and easy to use in the field for early detection of tobacco black shank disease.

[0029] The present invention also discloses a kit, which further includes lysis buffer, reaction solution a, reaction solution b, one tube of RPA reaction amplification enzyme and exonuclease dry powder, ultrapure water dilution solution, and test strips. The reaction solution a includes an upstream primer, a downstream modification primer, a probe, and Buffer A buffer; the reaction solution b includes Buffer B buffer.

[0030] Of course, to make operation more convenient, grinding rods, micropipettes, and centrifuge tubes are also included to facilitate grinding, aspirating, or loading of reactants.

[0031] Furthermore, the upstream primer is selected from one of the upstream primers with nucleotide sequences as shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively, and the downstream modification primer is selected from one of the downstream modification primers with nucleotide sequences as shown in SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6, respectively, and the nucleotide sequence of the probe is shown in SEQ ID NO.7.

[0032] The upstream and downstream modification primers added to the kit disclosed in this invention can be any of the disclosed upstream primers and any combination of downstream modification primers.

[0033] Furthermore, the lysis buffer is prepared from 3% PEG 2000, 24mM NaOH, and 2mM EDTA, with a total volume of 300μL; the reaction solution a has a total volume of 45.5μL, including 2μL of 10μM upstream primer, 2μL of 10μM downstream modification primer, 0.6μL of 10μM probe, and the remainder is Buffer A buffer; the ultrapure water dilution solution is 400μL, and the reaction solution b has a total volume of 2.5μL.

[0034] Furthermore, the method of using the reagent kit is as follows:

[0035] S1: Take the diseased plant tissue to be tested, add lysis buffer and grind it. After grinding, wait 2 minutes for full lysis, and the lysis time shall not exceed 5 minutes to obtain DNA extract.

[0036] S2: Add reaction solution a to the RPA reaction amplification enzyme and exonuclease dry powder tube, draw DNA extraction solution into the reaction tube, then draw reaction solution b to start the RPA reaction, and react at 30-45℃ for more than 15 minutes.

[0037] S3: Draw all the reaction solution into a tube containing diluent for dilution, insert the test strip into the tube, and read the result after 3-5 minutes.

[0038] Furthermore, the kit described in this invention is used in the detection of tobacco black shank disease.

[0039] Beneficial effects:

[0040] 1. The detection method disclosed in this invention has a detection limit of up to 100 fg for pathogen DNA. When the pathogen DNA content reaches 1 pg or more, the detection band (positive band) will be very obvious. Therefore, a smaller sample size is required, which can detect tobacco black shank disease at an earlier stage.

[0041] 2. The specific sequence segment targeted by the kit of the present invention will not match any other known genome sequences of any species. Test experiments show that the detection reaction of this kit has no cross-reaction with closely related species of Phytophthora parasitica and other common pathogens in tobacco. The detection accuracy of this kit under simulated field conditions is close to 100%.

[0042] 2. The portable tobacco black shank diagnostic kit prepared according to the above method has the advantages of simple and quick operation, no limitation on testing site, and no need for additional equipment. It also exhibits high sensitivity and specificity. Furthermore, the kit can be used at a reaction temperature between 30-45℃, requiring only hand contact to meet the temperature requirements, eliminating the need for additional temperature control equipment and facilitating convenient field testing.

[0043] 3. The kit disclosed in this invention optimizes the addition process of primers, probes, buffers and various enzymes, making the detection operation simpler and the entire detection can be completed within 15 minutes, which is relatively short. Attached Figure Description

[0044] Figure 1 : Reagent kit product image; including ① lysis buffer, ② reaction solution a, ③ reaction solution b, ④ dry powder tube, ⑤ diluent, ⑥ test strip, ⑦ disposable plastic grinding rod, ⑧ plastic micropipettes;

[0045] Figure 2 : Detection results after different combinations of upstream primers, downstream modified primers, and probes;

[0046] Figure 3 : Graphs showing test results under different temperature conditions;

[0047] Figure 4 : Specificity test of the reagent kit;

[0048] Figure 5 : Reagent kit detection sensitivity test;

[0049] Figure 6 Cross-reactivity test of closely related species of Phytophthora parasitica;

[0050] Figure 7 Detection status in field settings. Detailed Implementation

[0051] The present invention will now be described in detail with reference to specific embodiments and accompanying drawings:

[0052] Example 1: Gene Sequence, Probes and Primers

[0053] Specificity and sensitivity are two key indicators in pathogen detection technology. Many factors influence the specificity and sensitivity of nucleic acid detection, such as the quality of the nucleic acid in the sample, primer design, optimized reaction system ratios, and the specificity and copy number of the target sequence. A higher target sequence copy number generally results in higher sensitivity of the detection system based on it.

[0054] To find novel multicopy sequences suitable for *Phytophthora parasitica*, genome sequence alignment was performed using the *Phytophthora parasitica* reference genome (GenBank accession number GCA_000247585.2). BLASTN (v2.10.1) was used with default parameters for self-alignment to identify potential multicopy sequences. Two rounds of BLAST searches were conducted to screen for multicopy sequences. Genome comparisons retained sequences longer than 150 bp with two or more high confidence values ​​(E-value < 0.01). Overlapping multicopy sequences were then combined using bedtools (v2.30.0), and potential multicopy sequences were collected using samtools (1.9) based on these folded regions. Finally, the multicopy sequences were used as query sequences in the NCBI database for BLAST alignment with genomes of all known species to obtain highly specific multicopy sequences.

[0055] Following the multicopy-specific sequence screening procedure described above, a multicopy-specific sequence was obtained. This sequence is 193 bp in length, has a copy number of 13 in the *Phytophthora parasitica* genome, and sequence alignment shows that it is specifically present only in the *Phytophthora parasitica* genome. The obtained multicopy-specific sequence is as follows:

[0056] CAGTAGATCGAATCCTTGGAGGAGATCGTGTATCCAAATGATTGCATCATGCCGATCCACTCCGA GGATTACGTAATCTTCACAGATGATGACGTAATCACTGACGCGCCGTCGTCGACCACGAGTCTCAGGGC TGGATCGGGTCACTTCCCATCGATCAGCTTTCTTGTTCACAAAGGCCAACTGGCGCTTC.

[0057] Candidate primers and probes were designed with the assistance of software such as Primer5, and the resulting sequences are shown in the sequence listing SEQ ID NO.1-SEQ ID NO.7. The downstream modified primers had a biotin label at the 5' end, and the probes were labeled with FAM fluorescence at the 5' end. The probe's middle sequence contains tetrahydrofuran residues, and the 3' end has a spacerC3 blocking group, as detailed in Table 1.

[0058] Table 1

[0059]

[0060] Example 2: Diagnostic methods and kits

[0061] Based on the upstream primers, downstream modified primers, and probes disclosed in Example 1, a rapid diagnostic method and kit for tobacco black shank disease for field use were developed.

[0062] The detection method is as follows:

[0063] DNA extract from the diseased plant tissue to be tested was added to the reaction system for RPA amplification, and the results were read using an immunochromatographic gold lateral flow test strip.

[0064] Specifically, such as Figure 1 The kit shown consists of the following components:

[0065] ① Lysis buffer: 3% PEG 2000 + 25mM NaOH + 2mM EDTA, total volume 300μL;

[0066] ②Reaction solution a: upstream primer (10μM, 2μL), downstream modification primer (10μM, 2μL), probe (10μM, 0.6μL), commercial RPA reaction buffer A (Junuode, catalog number A4631, 40.9μL), total volume 45.5μL;

[0067] ③Reaction solution b: Commercial RPA reaction buffer B (Junuode, catalog number A4631, 2.5μL);

[0068] ④ Dry powder tubes: RPA reaction amplification enzyme and exonuclease dry powder tubes composed of recombinant protein (uvsX), DNA polymerase Bsu, exonuclease nfo and SSB (finished product purchased from Junuode, product number A4631). After being prepared into dry powder, it is more stable and convenient for transportation and storage.

[0069] ⑤ Diluent: 400 μL of sterile ultrapure water;

[0070] ⑥ Test strips: Commercial "double antibody sandwich" immunochromatographic test strips for 6-FAM and Biotin (finished product purchased from Milenia Biotec, catalog number MGHD1);

[0071] ⑦ Disposable plastic grinding rods;

[0072] ⑧ Plastic micro-pissors.

[0073] The specific instructions for using the kit are as follows:

[0074] (1) Take about 0.05g of the diseased plant tissue to be tested, about half the size of a fingernail, add lysis buffer and grind. After grinding and lysis, wait 2 minutes for complete lysis (the lysis time should not exceed 5 minutes) to obtain DNA extract.

[0075] (2) Add reaction solution a to the dry powder tube, use a pipette to extract DNA extraction solution (the liquid is drawn to the thin black line of the pipette) into the reaction tube, and after drawing reaction solution b into the reaction tube, perform the RPA reaction. Hold the tube with your hand or put it in your pocket to keep the temperature above 30-45℃ for 15 minutes.

[0076] ( ) Use a pipette to draw all the reaction solution into a 1.5 mL tube containing diluent for dilution. Insert the test strip (with the arrow end immersed in the liquid) into this tube and read the result after 3-5 minutes.

[0077] If both the C line and T line on the lateral flow chromatography test strip show bands, the sample is positive; if the C line shows a band but the T line does not, the sample is negative.

[0078] The reagent kit disclosed in this invention has the advantages of being portable, easy to operate, not limited by the testing site, and requiring no additional equipment, making it very suitable for use in the field or in the wild.

[0079] Example 3: Detection of Tobacco Black Shank Disease with Different Primer Combinations

[0080] Referring to the detection method in Example 2, Phytophthora parasitica genomic DNA was used as the reaction template (1 ng), the reaction time was 15 min, and the reaction temperature was 37 °C. The detection of RPA combined with immunogold flow chromatography was compared under different primer combinations (upstream primer and downstream modified primer were combined respectively, while the probe remained unchanged).

[0081] The primer combinations used in the experiment are as follows:

[0082] The results obtained using primer-free, PPM25-F1+PPM25-R1, PPM25-F1+PPM25-R2, PPM25-F1+PPM25-R3, PPM25-F2+PPM25-R1, PPM25-F2+PPM25-R2, PPM25-F2+PPM25-R3, PPM25-F3+PPM25-R1, PPM25-F3+PPM25-R2, and PPM25-F3+PPM25-R3 are as follows. Figure 2 As shown.

[0083] The analysis results show that any different upstream primers and downstream modified primers are suitable for the detection of Phytophthora parasitica, and the T-band is obvious. This indicates that the primers disclosed in this invention can flexibly pair upstream primers and downstream modified primers.

[0084] Example 5: Detection of Tobacco Black Shank Disease at Different Reaction Temperatures

[0085] Following the method described in Example 2, Phytophthora parasitica genomic DNA was used as the reaction template (1 ng), the reaction time was 15 min, and the primer combination PPM25-F1+PPM25-R1 was selected. The reaction was verified to be feasible at temperatures ranging from 30-45℃. The RPA reaction temperatures were set to 25℃, 30℃, 35℃, 40℃, and 45℃, and the results are as follows. Figure 3 As shown.

[0086] The analysis results show that the RPA reaction can proceed well within the reaction temperature range of 30-45℃, indicating that the detection method disclosed in this invention is applicable to different outdoor environments. Considering that the temperature range of 23-35℃ is during the onset of tobacco black shank disease, the method of covering the reaction tube with the hand can be used to provide a suitable RPA reaction temperature.

[0087] Example 6: Specificity Test

[0088] The method used in Example 2 employed a primer combination of PPM25-F1 and PPM25-R1, a reaction temperature of 37°C, and a DNA template of 1 ng for specificity experiments. The first three pathogens were *Phytophthora parasitica* isolated from different regions, followed by specificity experiments for *Corynesporacassioha* (tobacco leaf spot pathogen), *Ralstonia solanacearum* (tobacco bacterial wilt pathogen), *Alternaria alternate* (tobacco red spot pathogen), *Colletotrichum micotianae* (tobacco anthracnose pathogen), *Thielaviopsis basicola* (tobacco root black rot pathogen), and *Pseudomonas syringaepv. tabaci* (tobacco wildfire pathogen). For the detection of the tobacco black shank pathogen, pathogens isolated from three different regions were used, and the results are as follows: Figure 4 As shown.

[0089] The analysis results show that the selected detection sequences, primers, and probes are highly specific. They do not match sequences in the genomes of any other species besides *Phytophthora parasitica*, indicating that the detection method of this invention specifically detects *Phytophthora parasitica* and will not produce false positives when detecting other common tobacco diseases. This demonstrates that the primers and probes are highly specific and only targeted at detecting *Phytophthora parasitica*.

[0090] Example 7: Cross-reactivity test in closely related species of Phytophthora parasitica

[0091] To further clarify the specificity of the diagnostic kit for detecting *Phytophthora parasitica*, we selected five other closely related species of *Phytophthora parasitica* for cross-reactivity testing. For example... Figure 5 As shown, from left to right, the first three are *Phytophthora parasitica* isolated from different regions, followed by five different *Phytophthora* species: *Phytophthorainfestans*, *Phytophthora capsici*, *Phytophthora sojae*, *Phytophthora palmivora*, and *Phytophthora cactorum*.

[0092] The analysis results show that the diagnostic kit of the present invention only detected positive bands in Phytophthora parasitica, and there was no cross-reaction in other closely related species, which further demonstrates that the diagnostic kit has high specificity.

[0093] Example 8: Sensitivity Test

[0094] Referring to the method in Example 2, RPA amplification was performed using different concentrations of Phytophthora parasitica genomic DNA as reaction templates. The reaction time was set to 15 min and the reaction temperature to 37 °C. The template amounts were 10 ng, 1 ng, 100 pg, 10 pg, 1 pg, 100 fg, 10 fg, and NTC (without genomic template). The results are as follows. Figure 6 As shown.

[0095] The analysis results show that the detection limit for Phytophthora parasitica disclosed in this invention is 100 fg, and the detection band is very obvious when the genomic template is 1 pg or more.

[0096] Example 9: Equipment-free detection experiment of artificially inoculated disease samples

[0097] To verify the effectiveness of the kit in practical field use, the method described in Example 2 was used to detect pathogens in the root and stem tissues of six tobacco plants artificially inoculated with Phytophthora parasitica in the field without any additional equipment. The results are as follows: Figure 7 As shown.

[0098] The analysis results show that, from left to right, the samples are: negative control, and disease samples 1-6. The results indicate that all disease samples showed clear bands with a 100% detection accuracy.

[0099] The above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the present invention, and all such modifications and substitutions should be covered within the scope of the claims of the present invention. Technical aspects, shapes, and structures not described in detail in this invention are all well-known technologies.

Claims

1. A rapid detection method for tobacco black shank disease, characterized in that, The method is as follows: DNA was extracted from the plant tissue to be tested to obtain a DNA extract. The DNA extract was subjected to RPA amplification reaction, and the results were read using an immunochromatographic gold lateral flow test strip. The RPA amplification reaction system consisted of 50 μL, including 2 μL of DNA extraction buffer, 2 μL of 10 μM upstream primer, 2 μL of 10 μM downstream modification primer, 0.6 μL of 10 μM probe, 40.9 μL of Buffer A, 2.5 μL of Buffer B, and RPA amplification enzyme and exonuclease dry powder tubes; the reaction conditions were incubation at 30-45℃ for at least 15 min. The nucleotide sequence of the upstream primer is shown in SEQ ID NO.1, the nucleotide sequence of the downstream modified primer is shown in SEQ ID NO.4, and the nucleotide sequence of the probe is shown in SEQ ID NO.

7. The downstream modified primer has a biotinylated 5' end, the probe has a fluorescent 5' end, and the probe further includes at least one of the following features: (1) The intermediate sequence of the probe contains tetrahydrofuran residues; (2) The 3' end of the probe has a polymerase extension blocking group; The polymerase extension blocking group includes any one of the following: C3-spacer group, phosphate group, and dideoxynucleotide.

2. The detection method according to claim 1, characterized in that, The fluorescent label is FAM.

3. A rapid detection kit for tobacco black shank disease, characterized in that, The kit also includes lysis buffer, reaction solution a, reaction solution b, RPA reaction amplification enzyme and exonuclease dry powder tubes, ultrapure water dilution solution, and test strips. Reaction solution a includes upstream primer, downstream modification primer, probe, and Buffer A buffer; reaction solution b includes Buffer B buffer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO.1, the nucleotide sequence of the downstream modified primer is shown in SEQ ID NO.4, and the nucleotide sequence of the probe is shown in SEQ ID NO.

7. The downstream modified primer has a biotinylated 5' end, the probe has a fluorescent 5' end, and the probe further includes at least one of the following features: (1) The intermediate sequence of the probe contains tetrahydrofuran residues; (2) The 3' end of the probe has a polymerase extension blocking group; The polymerase extension blocking group includes any one of the following: C3-spacer group, phosphate group, and dideoxynucleotide.

4. The reagent kit according to claim 3, characterized in that, The fluorescent label is FAM.

5. The reagent kit according to claim 3, characterized in that, The lysis buffer was prepared with 3% PEG 2000, 24mM NaOH, and 2mM EDTA, with a total volume of 300μL; the reaction solution a had a total volume of 45.5μL, including 2μL of 10μM upstream primer, 2μL of 10μM downstream modification primer, 0.6μL of 10μM probe, and the remainder was Buffer A; the ultrapure water dilution solution was 400μL; and the reaction solution b had a total volume of 2.5μL.

6. The reagent kit according to claim 3, characterized in that, The method of using the kit is as follows: S1: Take the diseased plant tissue to be tested, add lysis buffer and grind it. After grinding, wait 2 minutes for full lysis, and the lysis time shall not exceed 5 minutes to obtain DNA extract. S2: Add reaction solution a to the RPA reaction amplification enzyme and exonuclease dry powder tube, draw DNA extraction solution into the reaction tube, then draw reaction solution b to start the RPA reaction, and react at 30-45℃ for more than 15 minutes. S3: Draw all the reaction solution into a tube containing ultrapure water diluent for dilution, insert the test strip into the tube, and read the result after 3-5 minutes.

7. The use of the kit according to any one of claims 3-6 in the detection of tobacco black shank.

Images