Molecular marker linked with swelling gene of succulent stem of brassica oleracea and application of molecular marker

Abstract

The invention discloses a molecular marker linked with a succulent stem expansion gene of Brassica oleracea and application of the molecular marker, and belongs to the technical field of molecular breeding. According to the invention, a chromosome region linked with a succulent stem expansion gene of the Brassica oleracea is obtained on the basis of BSA population positioning by utilizing a Brassica oleracea breeding high-generation selfing line material and a globule material in an EMS mutant library of the Brassica oleracea breeding high-generation selfing line material, and a molecular marker is developed in a candidate region. One KASP molecular marker is designed according to single base mutation of candidate genes, the marker is used for carrying out genotype identification on 523 single plants, and the coincidence rate with phenotypes reaches 100%. The molecular marker can be directly used for molecular marker-assisted breeding of the brassica oleracea fleshy stem expanded plants, the breeding selection efficiency is improved, and the breeding process is accelerated; meanwhile, a foundation is laid for related researches such as cloning and functional verification of the expanded gene Bofse-1, growth and development of metamorphosis stems and the like.

Description

Technical Field

[0001] The invention belongs to the field of molecular breeding of Brussels sprouts and relates to a SNP molecular marker linked to fleshy stem swelling of Brussels sprouts and an application thereof. Background Art

[0002] Brussels sprouts (Brassica oleracea L.var.gongylodes), also known as kohlrabi, broccoli, and kale, are a variety of the Brassica oleracea species of the Cruciferae family (Zhang Feixue et al., 2020; Zhang Min et al., 2023). Brussels sprouts were introduced to my country in the 16th century. Its typical biological characteristics are fleshy stems that swell and shrink into a spherical or oblate shape. The epidermis is often green, green-white or purple. The bulbs are tender, sweet, and have a unique flavor. They have extremely high edible and nutritional value (Ding Xiaolei and Wang Siming, 2014).

[0003] The formation process of the fleshy stem of B. oleracea is very complex and is affected by the environment, endogenous hormone regulation, and genetic molecular regulation. At present, some progress has been made in the physiological research on the formation of fleshy stems of B. oleracea, but the research on molecular mechanisms is still in its infancy (Zhang Shuxia and Wu Xuyin, 1998). The anatomical study of the swelling process of the fleshy stem of B. oleracea shows that secondary thickening is the morphological basis of bulb formation. The thickening of the bulb lies in the expansion of the stem diameter, which increases with the expansion of the pith and cortex. The secondary meristem plays a leading role in the expansion of the bulb (Zheng Shenkun and Shen Haiyan, 1992). Among all the cabbage species, only B. oleracea has a swollen fleshy stem. At present, most of the research on B. oleracea focuses on the regulatory mechanism of skin color (Zhang et al., 2015; Rahim et al., 2018). There are few reports on the genetic variation of important agronomic traits such as the enlargement of the fleshy stem of Brussels sprouts, and the knowledge about Brussels sprouts is still shallow. Therefore, analyzing the genetic basis of the variation of the fleshy stem of Brussels sprouts can provide a basis for clarifying the formation mechanism of its fleshy stem and the evolutionary relationship of variants.

[0004] The applicant previously used EMS mutagenesis technology to obtain a Brussels sprouts mutant material Px1 with small fleshy stems (referred to as small bulbs), and constructed a segregating population using it and the wild-type Brussels sprouts inbred line K1 (referred to as large bulbs). Genetic analysis showed that the fleshy stem enlargement trait, i.e., the large bulb trait, is controlled by a pair of dominant single genes, and the large fleshy stem is dominant over the small fleshy stem. We named this gene Bofse-1.

[0005] Based on this, the present invention has carried out the location of the fleshy stem enlargement gene and the development of linked molecular markers.

[0006] References

[0007] Zhang Min, Huo Zhenguo, Zhang Yanmei, et al. 2023. New bulb cabbage variety "Cuibao No. 4" and its early spring mulching cultivation technology. Vegetables, 11: 59-61.

[0008] Zhang Feixue, Zhou Lili, Chen Liping, et al. 2020. Research status of bulgur cabbage in my country. Vegetables, 08: 36-39.

[0009] Ding Xiaolei, Wang Siming. 2014. A study on the cultivation and spread of Brussels sprouts in northern China. Chinese Agricultural History, 33(6): 25-36, 20.

[0010] Zhang Shuxia, Wu Xuyin. 1998. Study on the changes of fresh and dry weight and fertilizer requirement of Brussels sprouts. Journal of Hebei Agricultural-Technical Normal University, 02: 27-30.

[0011] Zhang Y, Hu Z, Zhu M, et al. 2015. Anthocyanin Accumulation and Molecular Analysis of Correlated Genes in Purple Kohlrabi (Brassica oleraceavar.gongylodes L.). Journal of agricultural and food chemistry, 63(16): 4160-4169.

[0012] Rahim M, Robin A, Natarajan S, et al. 2018. Identification and Characterization of Anthocyanin Biosynthesis-Related Genes in Kohlrabi. Appl Biochem Biotechnol, 184(4): 1120-1141. Summary of the invention

[0013] The primary purpose of the present invention is to provide a molecular marker linked to a fleshy stem enlargement gene for the large and small bulb phenomenon of bulbous cabbage, thereby providing a new approach for the screening of large-bulb plants.

[0014] The second object of the present invention is to provide the application of the above molecular markers in molecular marker breeding of cabbage, which is mainly used to identify or assist in identifying the plant traits of large and small bulbs of cabbage.

[0015] The third object of the present invention is to provide a method for identifying the plant traits of Brussels sprouts.

[0016] The fourth object of the present invention is to provide a kit for identifying the size of the bulb traits of Brussels sprouts and a reagent for detecting the presence of the molecular marker in the localization of the Brussels sprouts enlargement gene Bofse-1.

[0017] In order to achieve the above object, the technical solution of the present invention is as follows:

[0018] A molecular marker linked to the fleshy stem enlargement gene of Brussels sprouts is a mutation from G to A at nucleotide position 43133013 on chromosome 3 of Brussels sprouts.

[0019] Furthermore, the genotypes corresponding to the molecular markers are: A:A is a genotype with a spherule phenotype, G:A and G:G are genotypes without a spherule phenotype.

[0020] Furthermore, the primers designed for the mutation site (Bo-PX labeling) are as follows:

[0021] Forward primer Primer_Al1eleX (BoPX-1): GAAGGTGACCAAGTTCATGCTTGGTGATTCTTAGCGGCTATTCTG; (SEQ ID NO. 1);

[0022] Forward primer Primer_AlleleY (BoPX-2): GAAGGTCGGAGTCAACGGATTTGGTGATTCTTAGCGGCTATTCTA (SEQ ID NO. 2);

[0023] Reverse primer Primer_Common: CATTCATCATCGCTGTAATCTCCG (SEQ ID NO. 3);

[0024] Furthermore, two forward primers are connected to different fluorescent linker sequences FAM and HEX, respectively.

[0025] The linker sequences are:

[0026] FAM: GAAGGTGACCAAGTTCATGCT (SEQ ID NO.4);

[0027] HEX:GAAGGTCGGAGTCAACGGATT(SEQ ID NO.5);

[0028] The fluorescent linker sequence is FAM or HEX (synthesized by LGC). Preferably, the forward primer BoPX-1 connected with the FAM fluorescent linker sequence is GAAGGTGACCAAGTTCATGCTTGGTGATTCTTAGCGGCTATTCTG; the forward primer BoPX-2 connected with the HEX fluorescent linker sequence is GAAGGTCGGAGTCAACGGATTTGGTGATTCTTAGCGGCTATTCTA.

[0029] The second object of the present invention is to provide the application of the above-mentioned molecular marker, which is linked to the fleshy stem enlargement gene and can identify or assist in identifying the plant traits of large and small bulbs of Brussels sprouts at the molecular level, that is, by using the molecular marker through further PCR amplification, the large and small bulb types of Brussels sprouts can be determined at the budding stage or seedling stage, thereby accelerating the breeding process. Those skilled in the art can understand that, for example, by detecting the presence of the molecular marker of the present invention to determine whether a certain Brussels sprout is a large bulb or a small bulb, it can be used for the screening and breeding of Brussels sprouts, especially the screening of large bulb plants.

[0030] Furthermore, when the molecular marker is used, PCR reaction is used for detection, which specifically includes the following steps:

[0031] (1) Using the genomic DNA of the sample to be tested as a template, PCR amplification is performed using molecular marker primers to obtain an amplified product;

[0032] (2) Perform fluorescence detection and analysis on the amplified products.

[0033] Furthermore, when the amplified product is subjected to fluorescence detection, if the sample PCR product only detects the fluorescence signal corresponding to the primer BoPX-2 connected to the fluorescent linker sequence, the detection site is the A:A genotype, and it is determined to be a homozygous individual plant with a small ball phenotype; if the sample PCR product only detects the fluorescence signal corresponding to the primer BoPX-1 connected to the fluorescent linker sequence, the detection site is the G:G genotype, and it is determined to be a homozygous individual plant with a large ball phenotype; if both fluorescence signals corresponding to the primers BoPX-2 and BoPX-1 connected to the fluorescent linker sequence are detected at the same time, the detection site is the G:A genotype, and it is determined to be a heterozygous individual plant with a large ball phenotype.

[0034] Furthermore, when the molecular markers are applied, Touchdown PCR is used.

[0035] Furthermore, the touchdown PCR amplification program was: 94°C for 15 min; 95°C for 20 s; 65°C-56°C for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8°C in each cycle; 94°C for 20 s; 57°C for 60 s, 26 cycles.

[0036] In addition, a kit containing the above-mentioned molecular marker primers can be used to identify the bulb size trait of Brussels sprouts. In specific applications, a reagent containing the above-mentioned molecular marker primers can be selected to make a kit.

[0037] The reagent for detecting the presence of the molecular marker is used in the localization of the Bofse-1 gene of the fleshy stem enlargement of Brussels sprouts. The forward primer sequences of the primers for amplifying the molecular marker are shown in SEQ ID NO.1 and SEQ ID NO.2, and the reverse primer sequence is shown in SEQ ID NO.3. The molecular marker of the present invention can be used to locate the Bofse-1 gene of the fleshy stem enlargement of Brussels sprouts. The above applications can be carried out according to conventional methods.

[0038] The present invention also protects vectors containing the above-mentioned molecular markers. The recombinant vector may be an expression vector or a cloning vector into which the molecular marker of the present invention is inserted. After obtaining the above-mentioned recombinant vector, those skilled in the art can transform the recombinant vector into suitable cells according to different needs to obtain recombinant cells containing the recombinant vector. Therefore, the present invention also protects recombinant cells containing the recombinant vector.

[0039] Advantages of the present invention:

[0040] The present invention utilizes BSA population positioning in combination with traditional genetic linkage analysis to locate a marker linked to the fleshy stem enlargement gene of Brussels sprouts, the mutation site is located at 43133013 of chromosome 3, and a KASP molecular marker associated with the gene is developed, which can be directly used for the identification of the phenotype and corresponding genotype of Brussels sprouts, and then the molecular marker is relied on for auxiliary breeding to accelerate breeding efficiency. By using the molecular marker in the early stage, the target plant can be quickly screened, the planting scale is effectively reduced, the workload of field identification in the later stage is reduced, and the efficiency and accuracy of selection are improved. The present invention is of great significance in the practice of Brussels sprouts yield breeding and the theoretical research related to plant stem growth and development. Therefore, the molecular marker of the present invention is conducive to the selection and breeding of Brussels sprouts, and lays a foundation for cloning the bulb enlargement gene and studying the molecular mechanism of plant stem growth and development. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 The small-bulb mutant 'Px1' and the large-bulb wild-type material 'K1' of the present invention are Brussels sprouts; Figure 1 Left panel represents: the spherule mutant ‘Px1’; Figure 1 The right panel shows: large ball wild type 'K1'; Bar = 5 cm.

[0042] Figure 2 The results of population positioning were constructed for the present invention'Px1' and 'K1'; Figure 2The upper figure in shows the BSA positioning result; Figure 2 The figure below shows a schematic diagram of marker development and linkage positioning within the candidate segment of the present invention, 1-9 represents chromosome numbers, and the Brussels sprouts fleshy stem enlargement gene Bofse-1 is located on chromosome 3.

[0043] Figure 3 Partial results of genotyping of the Bofse-1 molecular marker of the present invention in the F2 population constructed by 'Px1' and 'K1';

[0044] A indicates that the PCR product is the fluorescence signal corresponding to the primer SS-1 connected to the fluorescent linker sequence, which is a homozygous individual plant of the macroglobulus;

[0045] B indicates that the PCR product has two fluorescent signals of primers SS-1 and SS-2 connected to the fluorescent linker sequence, which is a heterozygous single plant of the macroglobulus;

[0046] C indicates that the PCR product is the fluorescent signal corresponding to the primer SS-2 connected to the fluorescent linker sequence, which is a homozygous individual of the ball. DETAILED DESCRIPTION

[0047] The present invention is further described below in conjunction with specific examples, but the present invention is not limited to the examples. The materials, reagents, instruments and methods used in the following examples, unless otherwise specified, are conventional materials, reagents, instruments and methods in the field, and can be obtained through commercial channels. The Brussels sprouts germplasm ('Px1', 'K1') involved in the present invention are all provided by the Vegetable Research Institute of Tianjin Academy of Agricultural Sciences, and can also be guaranteed to be sold to the outside world for at least 20 years. Among them, 'K1' and 'Px1' are the corresponding 'PL-1' and 'PL-11' in Table 1, respectively, in the literature: Identification of resistance to clubroot in cabbage vegetable varieties (lines) at the seedling stage, Plant Protection, 2020, 46(5): 193-199.

[0048] Example 1 Obtaining Molecular Markers Linked to the Gene for Fleshy Stem Enlargement in Brussels Sprout

[0049] 1. Construction of the isolation group

[0050] The wild-type material 'K1' (large ball, Figure 1 Right) as the male parent (it should be explained that during the experiment, the inventors used 'K1' as the male parent for the sake of material availability and ease of operation. The relevant experiments can also be carried out when other homozygous materials are used). Figure 1 Left) is the female parent, the mutant can be stably inherited, the large ball and small ball of the present invention are obtained by comparing the two, and are relative. 'K1' and 'Px1' are hybridized to obtain the F1 generation, and the F1 generation is self-fertilized to obtain the F2 population.

[0051] 2. Identification of fleshy stem size

[0052] During the maturity stage of the fleshy stem, the size of the fleshy stem of Brussels sprouts can be identified.

[0053] 3. Preliminary localization of the gene for fleshy stem enlargement

[0054] In the F2 population of 'K1'×'Px1', 25 large-bulb plants and 25 small-bulb plants were randomly selected and mixed in the seedling stage. The two pools, the dominant parent 'K1' and the recessive parent 'Px1' were used to extract the total DNA of the four pools using the CTAB method. The four pool DNAs were library-built using the TruSeqDNA LT Sample Prep Kit (Illumina). The genome was resequenced using Illumina Novaseq 6000 to obtain the data. Bwa was used for mapping and samtools for SNP calling. The filtering conditions were that the base quality value was greater than or equal to 30, the mapping quality value was greater than or equal to 30, the base depth was greater than or equal to 2 and less than or equal to 40 in the parents, and greater than or equal to 2 and less than or equal to 80 in the two F2 pools. A total of 1,157,778 differential SNPs were obtained, and then the SNP-index distribution map was made with 1 Mb as the window and 100 kb as the step size (such as Figure 2 The candidate interval is within the range of 25,305,107bp to 54,387,396bp on chromosome 3, and the interval size is 29.08Mb.

[0055] 4. Fine mapping of genes for fleshy stem enlargement

[0056] In order to further narrow down the candidate region of the gene controlling fleshy stem enlargement obtained in step 3, the F2 population was expanded for fine positioning. According to the results of parental resequencing, the reference genome sequence of Brussels sprouts was compared to find the SNP variation site, and the KASP marker was developed. The developed KASP molecular marker was used to perform genotyping on the individual plants of the F2 population to determine the exchange plant. Based on the large / small ball phenotype data and the genotype of the exchange plant, the gene controlling fleshy stem enlargement was located in the 43066736bp~43399401bp interval of chromosome 3 (such as Figure 2 Further combining the sites in the interval where the dominant parent and recessive parent were homozygous, the recessive pool was different and homozygous, and the dominant pool was homozygous or heterozygous, it was found that only site 43133013 met the GA of EMS mutagenesis preference, annotated as a non-synonymous mutation, and 100% linked to the phenotype.

[0057] 5. Development of molecular markers linked to the fleshy stem enlargement gene

[0058] The marker was used to perform genotyping on 523 plants of the F2 population constructed by 'K1' and 'Px1'. Three fluorescent signals appeared, of which 127 plants had A:A fluorescent signals, 258 plants had G:A fluorescent signals, and 138 plants had G:G fluorescent signals. Combined with the phenotypic survey data, it was found that the genotype and phenotype were completely consistent, with a compliance rate of 100%. The above results fully demonstrate that the Bo-PX marker of the present invention has versatility and accuracy, and can be applied to the prediction, identification and screening of the dwarf stem trait of loose cauliflower.

[0059] 6. Application of Molecular Markers

[0060] (1) Using the genomic DNA of the sample to be tested as a template, the Touchdo-

[0061] wnPCR amplification to obtain the amplified product;

[0062] (2) Detect and analyze the amplified products.

[0063] Forward primer Primer_AlleleX (BoPX-1): GAAGGTGACCAAGTTCATGCTTGGTGATTCTTAGCGGCTATTCTG;

[0064] Forward primer Primer_AlleleY (BoPX-2): GAAGGTCGGAGTCAACGGATTTGGTGATTCTTAGCGGCTATTCTA;

[0065] Reverse primer Primer_Common: CATTCATCATCGCTGTAATCTCCG;

[0066] The two forward primers were connected to different fluorescent linker sequences respectively; the 5' end of the forward primer BoPX-1 was connected to the FAM fluorescent linker sequence, and the 5' end of the forward primer BoPX-2 was connected to the HEX fluorescent linker sequence; the FAM and HEX fluorescent linker sequences were:

[0067] FAM: GAAGGTGACCAAGTTCATGCT;

[0068] HEX: GAAGGTCGGAGTCAACGGATT.

[0069] When the amplified product is subjected to fluorescence detection, if the sample PCR product only detects the HEX fluorescence signal corresponding to the primer BoPX-2 connected to the fluorescent linker sequence, the detection site is the A:A genotype, and it is determined to be a mutant individual plant with a small ball phenotype; if the sample PCR product only detects the FAM fluorescence signal corresponding to the primer BoPX-1 connected to the fluorescent linker sequence, the detection site is the G:G genotype, and it is determined to be a wild individual plant with a large ball phenotype; if both fluorescence signals corresponding to the primers BoPX-2 and BoPX-1 connected to the fluorescent linker sequence are detected at the same time, the detection site is the G:A genotype, and it is determined to be a wild individual plant with a large ball phenotype.

[0070] Touchdown PCR was used for molecular marker application. The touchdown PCR amplification program was: 94℃15min; 95℃20s; 65℃-56℃60s, 10 cycles, annealing extension temperature decreased by 0.8℃ in each cycle; 94℃20s; 57℃60s, 26 cycles.

[0071] The BoPX marker of the present invention was used to detect the genotype of the leaves of the sample to be tested, and the phenotype was statistically analyzed. The results are shown in Table 1 (partial results).

[0072] Table 1 The phenotype and genotype of big and small bulbs in parents and F2 populations by BoPX marker

[0073]

[0074]

[0075]

[0076] Table 2 Phenotypes and genotypes of large and small balls of BoPX markers in parents and other natural populations

[0077] name genotype Phenotype K1 G:G Big Ball Px1 A: A Small Ball Qing Ke No.3 G:G Big Ball Cuibao No. 1 G:G Big Ball Autumn skewers G:G Big Ball Kohlrabi G:G Big Ball Qingxian Kohlrabi G:G Big Ball early crown G:G Big Ball corolla G:G Big Ball Tianjin Xiaoyingzi G:G Big Ball Datong Songgen G:G Big Ball

[0078] The above identification results show that in breeding, by molecular marker identification and screening, retaining the material that detects the HEX fluorescent signal corresponding to the primer BoPX-2 connected to the fluorescent linker sequence, it is possible to select homozygous materials with small balls. Retaining the material that detects the FAM fluorescent signal corresponding to the primer BoPX-1 connected to the fluorescent linker sequence can select homozygous materials with large balls. Retaining the material that detects both fluorescent signals of primers BoPX-2 and BoPX-1 connected to the fluorescent linker sequence can select heterozygous materials with large balls. Screening of molecular markers in the early stage can reduce the workload of later screening and identification and accelerate the breeding process.

Claims

1. A molecular marker linked to a gene for fleshy stem enlargement in Brussels sprouts, characterized in that: The mutation of G to A at nucleotide 43133013 of chromosome 3 of Brussels sprouts was detected. The molecular marker primers designed for the mutation site are as follows: Forward primer BoPX-1: 5′-GAAGGTGACCAAGTTCATGCTTGGTGATTCTTAG CGGCTATTCTG-3′; Forward primer BoPX-2: 5′-GAAGGTCGGAGTCAACGGATTTGGTGATTCTTAG CGGCTATTCTA-3′; Reverse primer Primer Common: 5'-CATTCATCATCGCTGTAATCTCCG-3'.

2. The molecular marker according to claim 1, characterized in that The molecular marker is a KASP molecular marker.

3. The molecular marker according to claim 1, characterized in that The genotypes corresponding to the molecular markers are: A:A is a genotype with a small ball phenotype, and G:A and G:G are genotypes with a large ball phenotype.

4. The molecular marker according to claim 3, characterized in that The two forward primers were connected to different fluorescent linker sequences respectively; the 5' end of the forward primer BoPX-1 was connected to the FAM fluorescent linker sequence, and the 5' end of the forward primer BoPX-2 was connected to the HEX fluorescent linker sequence; the FAM and HEX fluorescent linker sequences were: FAM: GAAGGTGACCAAGTTCATGCT; HEX: GAAGGTCGGAGTCAACGGATT.

5. Use of the molecular marker according to any one of claims 1 to 4 in identifying or assisting in identifying the plant traits of bulb size of Brussels sprouts.

6. A method for identifying the characteristics of bulb size of Brussels sprouts, characterized in that: The method comprises the following steps: (1) using the genomic DNA of the Brussels sprouts sample to be tested as a template, and performing PCR amplification using the molecular marker primers described in claim 1 to obtain an amplified product; (2) The amplified products are subjected to fluorescence detection and analysis. If the sample PCR product only detects the HEX fluorescence signal corresponding to the primer BoPX-2 connected to the fluorescent linker sequence, the detection site is A:A genotype, and it is determined to be a homozygous individual plant with a small ball phenotype; if the sample PCR product only detects the FAM fluorescence signal corresponding to the primer BoPX-1 connected to the fluorescent linker sequence, the detection site is G:G genotype, and it is determined to be a homozygous individual plant with a large ball phenotype; if both HEX and FAM fluorescence signals corresponding to the primers BoPX-1 and BoP X-2 connected to the fluorescent linker sequence are detected at the same time, the detection site is G:A genotype, and it is determined to be a heterozygous individual plant with a large ball phenotype.

7. The method for identifying the plant traits of Brussels sprouts according to claim 6, characterized in that: Touchdown PCR was used; the touchdown PCR amplification program was: 94°C for 15 min; 95°C for 20 s; 65°C-56°C for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8°C in each cycle; 94°C for 20 s; 57°C for 60 s, 26 cycles.

8. A kit for identifying the size of bulbs of Brussels sprouts, characterized in that: Comprising the primers described in claim 1.

9. Use of a reagent for detecting the presence of the molecular marker described in claim 1 in localizing the enlargement gene Bofse-1 of Brussels sprouts, characterized in that: The forward primer sequences of the molecular marker primers are shown in SEQ ID NO.1 and SEQ ID NO.2, and the reverse primer sequence is shown in SEQ ID NO.3.

Images