Molecular markers linked to the curd enlargement gene in brassica oleracea and their applications
By developing SNP molecular markers linked to the gene for fleshy stem enlargement in Bruxelles, and utilizing PCR and fluorescence detection technologies, the problem of insufficient research on the molecular mechanism of fleshy stem enlargement in Bruxelles was solved, enabling early and rapid screening of large-stem plants and improving breeding efficiency and accuracy.
Patent Information
- Application Number
- CN202411793747.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-06
- Publication Date
- 2025-12-05
- Estimated Expiration
- 2044-12-06
AI Technical Summary
Current research on the molecular mechanism of fleshy stem enlargement in bulbous cabbage is still in its early stages. There is a lack of research on the genetic variation of important agronomic traits such as fleshy stem enlargement, making it difficult to effectively screen and identify bulbous plants of different sizes.
A new SNP molecular marker linked to the gene for fleshy stem enlargement in Bruxelles was developed. Through PCR amplification and fluorescence detection, primer design and Touchdown PCR technology were used to rapidly identify the size of Bruxelles plants, providing a new approach for molecular marker breeding.
This enabled early and rapid screening of large-bulb plants, reduced the workload of field identification, improved breeding efficiency and selection accuracy, and laid the genetic foundation for research on bulbous cabbage enlargement genes.
Smart Images

Figure CN119433083B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular breeding of bulrush cabbage, and relates to an SNP molecular marker linked to the enlargement of the fleshy stem of bulrush cabbage and its application. Background Technology
[0002] Bulbous cabbage (Brassica oleracea L. var. gongylodes), also known as Chinese cabbage, is a variety of Brassica oleracea in the Brassicaceae family (Zhang Feixue et al., 2020; Zhang Min et al., 2023). Introduced to my country in the 16th century, bulbous cabbage is characterized by its swollen, shortened, spherical or flattened spherical fleshy stem. The skin is commonly green, greenish-white, or purple. The bulb is crisp, sweet, and has a unique flavor, possessing extremely high edible and nutritional value (Ding Xiaolei and Wang Siming, 2014).
[0003] The formation of the fleshy stem in kohlrabi is a complex process, influenced by environmental, endogenous hormonal, and genetic molecular regulation. While some progress has been made in the physiological study of kohlrabi stem formation, research into its molecular mechanisms is still in its early stages (Zhang et al., 1998). Anatomical studies of the kohlrabi stem enlargement process indicate that secondary thickening is the morphological basis of bulb formation. Stem thickening involves the expansion of the stem diameter, which increases with the expansion of the pith and cortex. Secondary meristems play a dominant role in the bulb enlargement process (Zheng et al., 1992). Among all cabbage varieties, only kohlrabi possesses an enlarged fleshy stem. Current research on kohlrabi largely focuses on the regulatory mechanisms of skin color (Zhang et al., 2015; Rahim et al., 2018). Research on the genetic variation of important agronomic traits such as the enlargement of the fleshy stem in Brussels sprouts is still lacking, and our understanding of Brussels sprouts is limited. Therefore, elucidating the genetic basis of the variation in the fleshy stem of Brussels sprouts can provide a basis for clarifying the mechanism of fleshy stem formation and the evolutionary relationships among varieties.
[0004] The applicant previously obtained a small-stemmed (small-ball) mutant material of Bruxelles Px1 using EMS mutagenesis technology. Using this material and the wild-type Bruxelles inbred line K1 (large-ball), a segregating population was constructed. Genetic analysis showed that the trait of succulent stem enlargement, i.e. large-ball, is controlled by a pair of dominant single genes. Large succulent stem is dominant over small succulent stem. We named this gene Bofse-1.
[0005] Based on this, the present invention has carried out the localization of the fleshy stem enlargement gene and the development of linkage molecular markers.
[0006] References
[0007] Zhang Min, Huo Zhenguo, Zhang Yanmei, et al. 2023. New varietal of Brassica oleracea 'Cuibao No. 4' and its early spring mulch cultivation technology. Vegetables, 11: 59-61.
[0008] Zhang Feixue, Zhou Lili, Chen Liping, et al. 2020. Research status of Brassica oleracea in my country. Vegetables, 08: 36-39.
[0009] Ding Xiaolei, Wang Siming. 2014. A study on the history of cultivation and spread of kohlrabi in northern China. Chinese Agricultural History, 33(6): 25-36, 20.
[0010] Zhang Shuxia, Wu Xuyin. 1998. Study on the changes in fresh and dry weight and nutrient requirements of bulb cabbage. Journal of Hebei Agricultural Technology Teachers College, 02: 27-30.
[0011] Zhang Y, Hu Z, Zhu M, et al. 2015. Anthocyanin Accumulation and Molecular Analysis of Correlated Genes in Purple Kohlrabi (Brassica oleraceavar.gongylodes L.). Journal of agricultural and food chemistry, 63(16): 4160-4169.
[0012] Rahim M, Robin A, Natarajan S, et al. 2018. Identification and Characterization of Anthocyanin Biosynthesis-Related Genes in Kohlrabi. Appl Biochem Biotechnol, 184(4): 1120-1141. Summary of the Invention
[0013] The primary objective of this invention is to provide a molecular marker linked to a gene for enlarged fleshy stems, addressing the phenomenon of varying stem sizes in bulrushes, thus offering a new approach for screening for large-stem plants.
[0014] The second objective of this invention is to provide the application of the above-mentioned molecular markers in molecular marker breeding of cabbage, mainly for identifying or assisting in the identification of the size of the bulbous cabbage plants.
[0015] The third objective of this invention is to provide a method for identifying the characteristics of large and small bulbs in kohlrabi plants.
[0016] The fourth objective of this invention is to provide a kit for identifying the size of bulbs in kohlrabi and the application of a reagent for detecting the presence of the molecular marker in the localization of the kohlrabi enlargement gene Bofse-1.
[0017] To achieve the above objectives, the technical solution of the present invention is as follows:
[0018] A molecular marker linked to the gene for fleshy stem enlargement in Bruxelles is a G-to-A mutation at nucleotide position 43133013 on chromosome 3 of Bruxelles.
[0019] Furthermore, the genotypes corresponding to the molecular markers are: A:A, which is a genotype with a microglobulin phenotype, and G:A and G:G, which are genotypes without a microglobulin phenotype.
[0020] Furthermore, the primers (Bo-PX markers) designed for this mutation site are as follows:
[0021] Forward primer Primer_Al1eleX (BoPX-1): GAAGGTGACCAAGTTCATGCTTGGTGATTCTTAGCGGCTATTCTG; (SEQ ID NO.1);
[0022] Forward primer Primer_AlleleY (BoPX-2): GAAGGTCGGAGTCAACGGATTTGGTGATTCTTAGCGGCTATTCTA (SEQ ID NO.2);
[0023] Reverse primer Primer_Common: CATTCATCATCGCTGTAATCTCCG (SEQ ID NO.3);
[0024] Furthermore, the two forward primers are connected to different fluorescent adapter sequences, FAM and HEX, respectively.
[0025] The connector sequences are as follows:
[0026] FAM: GAAGGTGACCAAGTTCATGCT (SEQ ID NO.4);
[0027] HEX:GAAGGTCGGAGTCAACGGATT(SEQ ID NO.5);
[0028] The fluorescent adapter sequence is either FAM or HEX (synthesized by LGC). Preferably: the forward primer BoPX-1 ligated with the FAM fluorescent adapter sequence is: GAAGGTGACCAAGTTCATGCTTGGTGATTCTTAGCGGCTATTCTG; the forward primer BoPX-2 ligated with the HEX fluorescent adapter sequence is: GAAGGTCGGAGTCAACGGATTTGGTGATTCTTAGCGGCTATTCTA.
[0029] A second objective of this invention is to provide the application of the aforementioned molecular marker, which is linked to a gene for fleshy stem enlargement. This marker can identify or assist in identifying the size of bulbous Brassica oleracea plants at the molecular level. Specifically, by utilizing this molecular marker and further PCR amplification, the size of the bulbous Brassica oleracea can be determined at the budding or seedling stage, thereby accelerating the breeding process. Those skilled in the art will understand that, for example, detecting the presence of the molecular marker of this invention to determine whether a particular Brassica oleracea plant is large or small can be used for bulb selection breeding, especially for large-headed plants.
[0030] Furthermore, when the aforementioned molecular markers are applied, PCR reaction is used for detection, specifically including the following steps:
[0031] (1) Using the genomic DNA of the sample to be tested as a template, PCR amplification was performed using molecular marker primers to obtain the amplification product;
[0032] (2) Fluorescence detection and analysis of the amplification products.
[0033] Furthermore, when performing fluorescence detection on the amplification products, if only the fluorescent signal corresponding to primer BoPX-2 with the fluorescent adapter sequence is detected in the sample PCR product, the detection site is A:A genotype, and it is determined to be a homozygous single plant with a small spherical phenotype; if only the fluorescent signal corresponding to primer BoPX-1 with the fluorescent adapter sequence is detected in the sample PCR product, the detection site is G:G genotype, and it is determined to be a homozygous single plant with a large spherical phenotype; if both fluorescent signals corresponding to primers BoPX-2 and BoPX-1 with the fluorescent adapter sequence are detected simultaneously, the detection site is G:A genotype, and it is determined to be a heterozygous single plant with a large spherical phenotype.
[0034] Furthermore, the molecular markers are applied using Touchdown PCR.
[0035] Furthermore, the Touchdown PCR amplification program was as follows: 94℃ for 15 min; 95℃ for 20 s; 65℃-56℃ for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8℃ per cycle; 94℃ for 20 s; 57℃ for 60 s, 26 cycles.
[0036] In addition, kits containing the above-mentioned molecular marker primers can be used to identify the size of bulbs in kohlrabi. For specific applications, kits can be made using reagents containing the above-mentioned molecular marker primers.
[0037] The reagents used to detect the presence of the molecular marker are applied in the localization of the Bofse-1 gene for swelling the fleshy stem of Brassica oleracea. The forward primer sequences for amplifying the molecular marker are shown in SEQ ID NO.1 and SEQ ID NO.2, and the reverse primer sequences are shown in SEQ ID NO.3. Using the molecular markers of this invention, the Bofse-1 gene for swelling the fleshy stem of Brassica oleracea can be located. All of these applications can be performed using conventional methods.
[0038] This invention also protects vectors containing the aforementioned molecular markers. The recombinant vector may be an expression vector or a cloning vector containing the molecular markers of this invention. After obtaining the aforementioned recombinant vector, those skilled in the art can transform the recombinant vector into suitable cells according to different needs to obtain recombinant cells containing the recombinant vector. Therefore, this invention also protects recombinant cells containing the aforementioned recombinant vector.
[0039] Advantages of this invention:
[0040] This invention utilizes BSA population mapping combined with traditional genetic linkage analysis to locate a marker linked to a gene for bulb enlargement in Brassica oleracea. This mutation site is located at 43133013 on chromosome 3. A KASP molecular marker associated with this gene was developed, which can be directly used to identify the bulb size phenotype and corresponding genotype in Brassica oleracea. This marker can then be used for marker-assisted breeding, accelerating breeding efficiency. Early use of this molecular marker allows for rapid screening of target plants, effectively reducing planting scale, decreasing the workload of later field identification, and improving selection efficiency and accuracy. This invention is of significant importance in Brassica oleracea yield breeding practices and in theoretical research related to plant stem growth and development. Therefore, the molecular marker of this invention is beneficial for the selection of different bulb sizes in Brassica oleracea and lays the foundation for cloning the bulb enlargement gene and studying the molecular mechanisms of plant stem growth and development. Attached Figure Description
[0041] Figure 1 The small bulb mutant 'Px1' and the large bulb wild-type material 'K1' in this invention; Figure 1 The left image shows the small spherical mutant 'Px1'. Figure 1 The image on the right shows: Wild-type 'K1'; Bar = 5cm.
[0042] Figure 2 The population localization results for 'Px1' and 'K1' in this invention are constructed; Figure 2The image above shows the BSA localization results; Figure 2 The following diagram illustrates the marker development and linkage mapping within the candidate region of this invention. 1-9 represent chromosome numbers, and the Bofse-1 gene for swelling the fleshy stem of Bulb cabbage is located on chromosome 3.
[0043] Figure 3 This is a partial result of genotyping of the Bofse-1 molecular marker of the present invention in the F2 population constructed from 'Px1' and 'K1';
[0044] Section A indicates that the PCR product is the fluorescent signal corresponding to primer SS-1, which is linked to the fluorescent adapter sequence, and is a homozygous monoculture of the large sphere.
[0045] Section B indicates that the PCR product has two fluorescent signals, SS-1 and SS-2, which are linked to fluorescent adapter sequences, and is a heterozygous monoculture of the large sphere.
[0046] Section C indicates that the PCR product is the fluorescent signal corresponding to primer SS-2, which is linked to the fluorescent adapter sequence, and is a homozygous monoculture of the microsphere. Detailed Implementation
[0047] The present invention will be further described below with reference to specific embodiments, but the present invention is not limited to the embodiments. Unless otherwise specified, the materials, reagents, instruments and methods used in the following embodiments are all conventional materials, reagents, instruments and methods in the art and can be obtained through commercial channels. The bulb cabbage germplasm ('Px1', 'K1') involved in the present invention were all provided by the Vegetable Research Institute of Tianjin Academy of Agricultural Sciences and can be guaranteed to be sold for at least 20 years. Among them, 'K1' and 'Px1' are 'PL-1' and 'PL-11' respectively in the literature: Identification of resistance to clubroot disease in seedlings of cabbage vegetable varieties (lines), Plant Protection, 2020, 46(5): 193-199.
[0048] Example 1: Obtaining the linkage molecular marker for the gene of fleshy stem enlargement in bulbous cabbage
[0049] 1. Construction of segregated populations
[0050] Using wild-type material 'K1' (large ball, Figure 1 (Right) as the parent (it should be explained that during the experiment, considering the availability of materials and ease of operation, the inventor used 'K1' as the parent; similar experiments could be conducted using other homozygous materials), and its mutant 'Px1' (small ball, Figure 1 (Left) is the maternal parent. This mutant can be stably inherited. The large and small balls of this invention are derived by comparing the two and are relative. 'K1' and 'Px1' are crossed to obtain the F1 generation. After self-crossing, the F2 population is obtained.
[0051] 2. Identification of fleshy stem size
[0052] During the fleshy stem maturation period, the size of the fleshy stem of bulbous cabbage can be identified.
[0053] 3. Preliminary localization of the fleshy stem enlargement gene
[0054] In the F2 population of 'K1'× and 'Px1', 25 large-ball plants and 25 small-ball plants were randomly selected, and their young leaves were mixed into four pools. Total DNA was extracted from the two pools, the dominant parent 'K1', and the recessive parent 'Px1' using the CTAB method. Libraries were constructed using the TruSeqDNA LT Sample Prep Kit (Illumina), and genome resequencing was performed using Illumina Novaseq 6000. Mapping was performed using bwa, and SNP calling was performed using samtools. The filtering conditions were: base quality value ≥30, mapping quality value ≥30, base depth ≥2 and ≤40 in the parent, and ≥2 and ≤80 in the two F2 pools. A total of 1,157,778 differentially expressed SNPs were obtained. SNP-index distribution maps were then plotted with a window size of 1 Mb and a step size of 100 kb (e.g., ...). Figure 2 (See the image above). The candidate interval is within the range of 25,305,107bp to 54,387,396bp on chromosome 3, with an interval size of 29.08Mb.
[0055] 4. Fine mapping of genes for fleshy stem enlargement
[0056] To further narrow down the candidate region for the gene controlling fleshy stem enlargement obtained in step 3, the F2 population was expanded for fine mapping. Based on the parental resequencing results, the SNP variation sites were identified by comparing with the reference genome sequence of bulbous cabbage. KASP markers were developed, and genotyping of individual plants in the F2 population was performed using these markers to determine the exchange plants. Based on the large / small bulb phenotypic data and the genotypes of the exchange plants, the gene controlling fleshy stem enlargement was located in the interval 43066736bp–43399401bp on chromosome 3 (e.g., ...). Figure 2 (See the figure below). Further analysis of the homozygous dominant and recessive parents within the interval, the differentially homozygous recessive pool, and the homozygous or heterozygous dominant pool revealed that only locus 43133013 met the EMS mutagenesis preference for GA, annotated as a non-synonymous mutation, and was 100% linked to the phenotype.
[0057] 5. Development of molecular markers linked to the fleshy stem enlargement gene
[0058] Genotyping was performed on 523 individuals from the F2 population constructed using 'K1' and 'Px1' markers. Three fluorescent signals were observed: A:A fluorescence signals were observed in 127 individuals, G:A fluorescence signals in 258 individuals, and G:G fluorescence signals in 138 individuals. Combined with phenotypic data, the genotype and phenotype were found to be completely identical, with a concordance rate of 100%. These results fully demonstrate that the Bo-PX marker of this invention has universality and accuracy, and can be applied to the prediction, identification, and screening of dwarf traits in loose-leaved cauliflower.
[0059] 6. Applications of molecular markers
[0060] (1) Using the genomic DNA of the sample to be tested as a template, Touchdo-1 amplification was performed using molecularly labeled primers.
[0061] wnPCR amplification was performed to obtain the amplification product;
[0062] (2) Detect and analyze the amplification products.
[0063] Forward primer Primer_AlleleX(BoPX-1): GAAGGTGACCAAGTTCATGCTTGGTGATTCTTAGCGGCTATTCTG;
[0064] Forward primer Primer_AlleleY(BoPX-2): GAAGGTCGGAGTCAACGGATTTGGTGATTCTTAGCGGCTATTCTA;
[0065] Reverse primer Primer_Common: CATTCATCATCGCTGTAATCTCCG;
[0066] Two forward primers are attached to different fluorescent adapter sequences; the 5' end of forward primer BoPX-1 is attached to the FAM fluorescent adapter sequence, and the 5' end of forward primer BoPX-2 is attached to the HEX fluorescent adapter sequence; the FAM and HEX fluorescent adapter sequences are as follows:
[0067] FAM: GAAGGTGACCAAGTTCATGCT;
[0068] HEX: GAAGGTCGGAGTCAACGGATT.
[0069] When performing fluorescence detection on the amplification products, if only the HEX fluorescence signal corresponding to primer BoPX-2 with the fluorescent adapter sequence is detected in the sample PCR product, the detection site is A:A genotype, and it is determined to be a mutant single plant with a small spherical phenotype; if only the FAM fluorescence signal corresponding to primer BoPX-1 with the fluorescent adapter sequence is detected in the sample PCR product, the detection site is G:G genotype, and it is determined to be a wild single plant with a large spherical phenotype; if both fluorescence signals corresponding to primers BoPX-2 and BoPX-1 with the fluorescent adapter sequence are detected simultaneously, the detection site is G:A genotype, and it is determined to be a wild single plant with a large spherical phenotype.
[0070] When applying molecular markers, Touchdown PCR was used. The Touchdown PCR amplification program was as follows: 94℃ for 15 min; 95℃ for 20 s; 65℃-56℃ for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8℃ per cycle; 94℃ for 20 s; 57℃ for 60 s, 26 cycles.
[0071] The BoPX markers of this invention were used to detect the genotypes of the leaves of the test samples, and their phenotypes were statistically analyzed. The results are shown in Table 1 (partial results).
[0072] Table 1. BoPX marker phenotypes and genotypes of large and small spheres in parents and F2 populations.
[0073]
[0074]
[0075]
[0076] Table 2. BoPX marker phenotypes and genotypes in parents and other natural populations.
[0077] name genotype Phenotype K1 G:G Big ball Px1 A: A Small ball Qingpie No. 3 G:G Big ball Cuibao No. 1 G:G Big ball Autumn String G:G Big ball Kohlrabi from Hejian G:G Big ball Kohlrabi from Qingxian County G:G Big ball early crown G:G Big ball corolla G:G Big ball Tianjin Xiaoyingzi G:G Big ball Datong pine roots G:G Big ball
[0078] The above identification results indicate that by using molecular markers for identification and screening during breeding, retaining materials that show HEX fluorescence signals corresponding to primer BoPX-2 (which has a fluorescent adapter sequence) can yield homozygous materials for small spheres. Retaining materials that show FAM fluorescence signals corresponding to primer BoPX-1 (which has a fluorescent adapter sequence) can yield homozygous materials for large spheres. Retaining materials that show fluorescence signals from both primers BoPX-2 and BoPX-1 (which have fluorescent adapter sequences) can yield heterozygous materials for large spheres. Early molecular marker screening can reduce the workload of later screening and identification, accelerating the breeding process.
Claims
1. The application of a primer set for amplifying molecular markers linked to the fleshy stem enlargement gene in the identification or auxiliary identification of the size of bulbous plants in Brucella oleracea, characterized in that, The molecular markers correspond to the following genotypes: A:A is the genotype with a small spherical phenotype, and G:A and G:G are the genotypes with a large spherical phenotype. The sequences of the primer set are as follows: Forward primer BoPX-1: 5'-GAAGGTGACCAAGTTCATGCTTGGTGATTCTTAGCGGCTATTCTG-3'; Forward primer BoPX-2: 5'-GAAGGTCGGAGTCAACGGATTTGGTGATTCTTAGCGGCTATTCTA-3'; Reverse primer Primer_Common: 5'-CATTCATCATCGCTGTAATCTCCG-3'.
2. The application according to claim 1, characterized in that, Two forward primers are attached to different fluorescent adapter sequences; the 5' end of forward primer BoPX-1 is attached to the FAM fluorescent adapter sequence, and the 5' end of forward primer BoPX-2 is attached to the HEX fluorescent adapter sequence; the FAM and HEX fluorescent adapter sequences are as follows: FAM: GAAGGTGACCAAGTTCATGCT; HEX: GAAGGTCGGAGTCAACGGATT.
3. A method for identifying the size of bulbous cabbage plants, characterized in that, The method includes the following steps: (1) Using the genomic DNA of the Brassica oleracea sample to be tested as a template, PCR amplification was performed using the primer set of the molecular markers described in claim 1 to obtain the amplification product; (2) Perform fluorescence detection and analysis on the amplification products. If only the HEX fluorescence signal corresponding to primer BoPX-2 with fluorescent adapter sequence is detected in the sample PCR product, the detection site is A:A genotype, and it is determined to be a homozygous single plant with small sphere phenotype. If only the FAM fluorescence signal corresponding to primer BoPX-1 with fluorescent adapter sequence is detected in the sample PCR product, the detection site is G:G genotype, and it is determined to be a homozygous single plant with large sphere phenotype. If both HEX and FAM fluorescence signals corresponding to primers BoPX-1 and BoPX-2 with fluorescent adapter sequence are detected at the same time, the detection site is G:A genotype, and it is determined to be a heterozygous single plant with large sphere phenotype.
4. The method for identifying the size of bulbous cabbage plants according to claim 3, characterized in that, Touchdown PCR was used. The Touchdown PCR amplification program was as follows: 94℃ for 15 min; 95℃ for 20 s; 65℃-56℃ for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8℃ in each cycle; 94℃ for 20 s; 57℃ for 60 s, 26 cycles.
5. A kit for identifying the size of bulbs in kohlrabi, characterized in that, It includes the primer set described in claim 1.
Citation Information
Patent Citations
InDel molecular marker for identifying and / or distinguishing brassica oleracea and application of InDel molecular marker
CN113528698A
KASP molecular marker of common head cabbage and application of KASP molecular marker
CN117248054A