Screening and rational transformation method for riboswitch capable of specifically recognizing doxycycline

Abstract

The invention discloses a screening method for a riboswitch capable of specifically recognizing doxycycline as well as rational transformation and application of the riboswitch, and belongs to the field of gene expression regulation and control. The invention provides a doxycycline specific riboswitch, establishes a high-throughput screening method based on a flow cytometry, and obtains the doxycycline riboswitch with further improved activation multiple by means of computer-aided prediction of binding sites of the riboswitch and calculation of mutation sites. According to a dose reaction curve, the riboswitch shows linear correlation at 40-100 [mu] g / L, and meanwhile, the constructed whole-cell sensor is low in price, high in stability and simple to operate, and can be used for on-site rapid detection.

Description

Technical Field

[0001] The present invention belongs to the field of gene expression regulation, and specifically relates to a riboswitch screening method for specifically recognizing doxycycline and a rational transformation and application thereof. Background Art

[0002] Doxycycline is a tetracycline derivative and a broad-spectrum antibiotic with high antibacterial effect. It is widely used to prevent and treat certain bacterial infections. It can also be used as an additive to improve the quality of animal products. However, the residues caused by excessive use of doxycycline will accumulate in the body, causing serious impact on the health of humans and animals. However, with the development of society, the requirements for product quality and green environmental protection in the production process are getting higher and higher. In order to reduce the impact of residue problems on people's health, the detection of doxycycline has received more and more attention.

[0003] Existing methods for detecting doxycycline include high performance liquid chromatography, high performance liquid chromatography-tandem mass spectrometry, infrared spectroscopy, gas chromatography-tandem mass spectrometry, etc. However, these methods are not suitable for rapid detection of doxycycline on site due to their high cost, long detection cycle, and low efficiency. In recent years, sensors have been widely welcomed due to their high detection efficiency and low cost.

[0004] Riboswitches are a new type of regulation that has been developed in recent years. Riboswitches can specifically sense and recognize small molecule ligands without the need for other auxiliary factors (such as proteins, enzymes, and metal compounds), and regulate downstream gene expression during transcription and translation. Compared with other regulatory methods (such as protein regulation and ribozyme regulation), riboswitches are more sensitive and responsive to small molecule ligands, and can quickly recognize small molecule ligands under low concentration conditions. Therefore, the essence of a riboswitch is a sensor.

[0005] In recent years, riboswitches have been favored by many researchers as an emerging element, but they also face many difficulties. Compared with the development of other regulatory elements, the development of riboswitches is still in its infancy, the number of riboswitches developed is limited, and the technology of transforming riboswitches into biosensors is also in its infancy. The traditional method for screening artificial riboswitches is the exponential evolution by enrichment (SELEX) technology, which has a history of more than 30 years and is relatively mature. However, the use of this technology to screen riboswitches requires in vitro enrichment to screen out aptamers with high affinity, and then in vivo high-throughput screening to select sequences that can adapt to the intracellular environment. The whole process is relatively time-consuming and labor-intensive.

[0006] Therefore, it is urgent to screen out doxycycline riboswitches in order to transform them into biosensors that can monitor doxycycline residues in food and other environments in real time. Summary of the invention

[0007] In view of the above-mentioned deficiencies in the prior art, the present invention provides a riboswitch that specifically recognizes doxycycline and a method for screening and rationally modifying the riboswitch and a method for screening and rationally modifying the riboswitch that specifically recognizes doxycycline is obtained by screening using a flow cytometer. The riboswitch can specifically recognize doxycycline.

[0008] The first technical solution provided by the present invention is a method for screening a riboswitch that specifically recognizes doxycycline, comprising the following steps:

[0009] (1) constructing a doxycycline riboswitch library using doxycycline RNA aptamers;

[0010] (2) constructing a riboswitch reporter platform by fusing the SacB gene with the EGFP gene;

[0011] (3) constructing a plasmid library using the doxycycline riboswitch library of step (1) and the riboswitch reporter platform of step (2);

[0012] (4) transforming the plasmid library of step (3) into Escherichia coli and incubating with the substrate; collecting high-fluorescence cells by flow cytometry, i.e., positive cells;

[0013] (5) The positive cells in step (4) are plated and cultured, and single white colonies without fluorescence are selected as positive colonies;

[0014] (6) The positive colonies in step (5) were cultured in a well plate, and the fluorescence intensity was measured at an excitation wavelength of 488 nm and an emission wavelength of 520 nm. The OD was measured using a spectrophotometer. 600 , calculate the unit fluorescence value of the bacteria, and screen out the bacteria with larger unit fluorescence value, that is, those containing the riboswitch that specifically recognizes doxycycline.

[0015] In certain embodiments, in step (1), the nucleotide sequence of the RNA aptamer of doxycycline is as follows:

[0016] GGGAGACGCGAAAGCGUUACGAAUGCGAUGACUCGUCGAAAGACGAACAGUUCCUUUGGAUCCGAAUUCGCCGC (SEQ ID NO. 2).

[0017] In certain embodiments, the doxycycline RNA aptamer is designed to insert 10 random bases N into the 3′ end of the doxycycline DNA sequence to construct a doxycycline riboswitch library, and the doxycycline riboswitch library is shown in SEQ ID NO.3.

[0018] GGGAGACGCGAAAGCGTTACGAATGCGATGACTCGTCGAAAGACGAACAGTTCCTTTGGATCCGAATTCGCCGCNNNNNNNNNN (SEQ ID NO. 3).

[0019] In certain embodiments, in step (2), a 21 bp fragment of the SacB gene with a nucleotide sequence such as that shown in SEQ ID NO.4 is fused to the EGFP gene to construct a SacB-21-EGFP fusion protein, which is a riboswitch reporter platform.

[0020] In certain embodiments, in step (3), the doxycycline riboswitch library is inserted between the promoter and the ribosome binding site of a recombinant plasmid containing a riboswitch reporter platform to construct a plasmid library.

[0021] In certain embodiments, the promoter is a strong T7 promoter and the ribosome binding site is AAGGAG.

[0022] In certain embodiments, the recombinant plasmid uses PET-Duet-1 as an expression vector.

[0023] In certain embodiments, in step (4), the Escherichia coli includes Escherichia coli JM109 and Escherichia coli BL21.

[0024] In certain embodiments, in step (4), the concentration of IPTG used to induce expression in the E. coli is 0.5 mM.

[0025] In certain embodiments, in step (4), the substrate is doxycycline at a concentration of 100 μg / L.

[0026] In certain embodiments, the temperature of the fermentation culture is always maintained at 37° C. and the rotation speed is 220 rpm.

[0027] In certain embodiments, the culture medium is LB medium.

[0028] In certain embodiments, the pH of the culture medium is 6-7.

[0029] The second technical solution provided by the present invention is a riboswitch (DOX-3-4) that specifically recognizes doxycycline, the nucleotide sequence of the riboswitch is shown in SEQ ID NO: 1,

[0030] DOX-3-4 (SEQ ID NO: 1):

[0031] GGGAGACGCGAAAGCGUUACGAAUGCGAUGACUCGUCGAAAGACGAACAGUUCCUUUGGAUCCGAAUUCGCCGC-CACGAUUUGU.

[0032] The third technical solution provided by the present invention is a biosensor, wherein the biosensor carries the ribosome switch described in the second technical solution.

[0033] The fourth technical solution provided by the present invention is a method for modifying a doxycycline riboswitch, the method comprising mutating the 26th nucleotide, the 47th nucleotide, the 51st nucleotide and / or the 53rd nucleotide of the parent of the riboswitch, wherein the nucleotide sequence of the parent is shown in SEQ ID NO: 1.

[0034] In certain embodiments, the mutant is a mutant of the parent subjected to any of the mutations (1) to (6):

[0035] (1) mutate cytosine C at position 26 to guanine G;

[0036] (2) mutating adenine A at position 47 to uracil U;

[0037] (3) mutating adenine A at position 49 to guanine G;

[0038] (4) mutating uracil U at position 51 to cytosine C;

[0039] (5) mutating cytosine C at position 53 to guanine G;

[0040] (6) Mutation of cytosine C at position 26 to guanine G and mutation of adenine A at position 47 to uracil U.

[0041] The fifth technical solution provided by the present invention is the application of the above-mentioned riboswitch, the above-mentioned biosensor or the above-mentioned method in the synthesis of doxycycline.

[0042] The technical effects of the present invention are as follows:

[0043] 1. The present invention is an invention for screening doxycycline riboswitches based on flow cytometry. A large number of literatures are consulted to find aptamers for doxycycline, and only 10 random bases are connected after the aptamer to reduce the library capacity and improve the screening success rate;

[0044] 2. The host for screening doxycycline riboswitches in the present invention is Escherichia coli, and the gene is expressed under the control of the T7 strong promoter and the AAGGAG strong ribosome binding site, and the appropriate IPTG concentration is selected to greatly reduce the probability of false positives;

[0045] 3. The entire process of the present invention is based on the in vivo screening process, and the riboswitches screened out have strong adaptability to the organism;

[0046] 4. The riboswitches screened by the present invention are subjected to dose response curves and molecular docking to double verify the interaction between the riboswitch and the ligand;

[0047] 5. The riboswitches screened by the present invention have a strong perception ability for doxycycline, but have no recognition effect on other small molecule ligands;

[0048] 6. The mutant riboswitch constructed by the present invention can further increase the activation multiple of the riboswitch. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 Map for riboswitch library plasmid construction;

[0050] Figure 2 For doxycycline substrate tolerance verification;

[0051] Figure 3 Optimized for IPTG concentration;

[0052] Figure 4 The fusion EGFP result graph is retained for SacB;

[0053] Figure 5 This is the positive control image of flow cytometry;

[0054] Figure 6 collected results for flow cytometry;

[0055] Figure 7 This is a diagram of high-throughput screening results;

[0056] Figure 8 is the riboswitch dose-response curve and activation fold;

[0057] Fig. 9 Predict secondary and tertiary structures for riboswitches;

[0058] Fig.10 Direct molecular docking of the riboswitch with doxycycline;

[0059] Fig.11 The results are for single-point mutations of riboswitches;

[0060] Fig.12 Combinatorial mutation results for riboswitches;

[0061] Fig.13 is the mutant riboswitch dose-response curve;

[0062] Fig.14 Molecular docking for mutant riboswitches. DETAILED DESCRIPTION

[0063] The preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explaining the present invention and are not used to limit the present invention.

[0064] Test method:

[0065] Fluorescence intensity determination: 200 μL of the fermented bacterial solution was placed in a black 96-well plate, and the fluorescence intensity of the bacteria was determined under the conditions of an excitation wavelength of 488 nm and an emission wavelength of 520 nm.

[0066] OD600 determination: Take 20 μL of the bacterial solution after fermentation and put it into a white 96-well plate, and add 180 μL of deionized water to dilute the bacterial solution 10 times, and measure the absorbance at 600 nm.

[0067] The raw materials used in the examples are:

[0068] 1. PET-Duet-1 vector comes from our laboratory;

[0069] 2. Escherichia coli BL21 (DE3) was from our laboratory;

[0070] 3. Formula of LB liquid culture medium: 10g peptone, 5g yeast powder, 10g sodium chloride, dilute to 1L.

[0071] 4. Formula of LB solid medium: 10g peptone, 5g yeast powder, 10g sodium chloride, dilute to 1L, divide equally into 5 shake flasks, and add 3.5g agar powder.

[0072] Example 1 Establishment of high-throughput screening protocol

[0073] 1. Establishment of high-throughput screening program

[0074] (1) Expression of fluorescent reporter gene EGFP

[0075] The EGFP fluorescent protein gene (SEQ ID NO.4) stored in the laboratory was connected to the PET-Duet-1 vector by homologous recombination using the primers in the table below, and the plasmid was extracted and sequenced to obtain the recombinant plasmid PET-Duet-EGFP. The recombinant plasmid PET-Duet-EGFP was transformed into Escherichia coli BL21 (DE3) to obtain the recombinant bacteria BL21 / PET-Duet-EGFP.

[0076]

[0077] (2) Verification of doxycycline substrate tolerance

[0078] Doxycycline solution was prepared with a concentration of 50 mg / L. Different volumes of pre-prepared substrate were added to the plates when pouring to prepare different concentration gradients. After culturing the recombinant bacteria BL21 / PET-Duet-EGFP for 12 hours, it was diluted 10,000 times and dispensed into 30 μL portions. The solution was evenly spread on the pre-prepared plates. After culturing for 12 hours, the bacterial growth was observed to determine the screening concentration.

[0079] like Figure 2 As shown in the figure, the doxycycline substrate tolerance verification shows that when the concentration is greater than 100 μg / L, the bacteria grow slowly or not at all. This is because doxycycline can bind to the ribosome, thereby inhibiting protein synthesis and causing the bacteria to be unable to grow. Therefore, 100 μg / L was selected as the subsequent high-throughput screening concentration.

[0080] (3) Optimization of IPTG concentration

[0081] The IPTG concentration was optimized by the well plate fermentation method. The recombinant plasmid PET-Duet-EGFP was transferred into Escherichia coli BL21 (DE3) to obtain the recombinant bacteria BL21 / PET-Duet-EGFP. 0, 0.25, 0.5, 0.75, 1, 1.5, 1.75, and 2 mM IPTG were added to the culture medium. The culture was carried out at 37°C and 220 rpm for 12 h. The fluorescence value was determined using a multifunctional microplate reader at an excitation wavelength of 488 nm and an emission wavelength of 520 nm. The bacterial OD600 was also determined, and the unit bacterial fluorescence value = fluorescence value / OD600 was recorded. The unit bacterial fluorescence values ​​of the experimental group and the control group were calculated to determine the IPTG concentration.

[0082] like Figure 3 As shown, the IPTG concentration was optimized, and it was found that under 0.5 mM IPTG induction, the unit bacterial fluorescence value was the highest, so 0.5 mM was selected as the subsequent induction concentration.

[0083] (4) Fusion sequence optimization

[0084] In order to fully express the fluorescent reporter gene, we tried to retain some bases of the SacB gene (SEQ ID NO.5) for connection and measured the fluorescence value. The number of bases of the retained SacB gene was set to 9, 21, 30, 42, and 60 (SEQ ID NO.6-10). The primers in the table below were connected to the PET-Duet-EGFP plasmid by homologous recombination to construct five plasmids PET-Duet-SacB-9-EGFP, PET-Duet-SacB-21-EGFP, PET-Duet-SacB-30-EGFP, PET-Duet-SacB-42-EGFP, and PET-Duet-SacB-60-EGFP. After the above plasmids were transformed into Escherichia coli BL21 (DE3), recombinant bacteria BL21 / PET-Duet-SacB-9-EGFP, recombinant bacteria BL21 / PET-Duet-SacB-21-EGFP, recombinant bacteria BL21 / PET-Duet-SacB-30-EGFP, recombinant bacteria BL21 / PET-Duet-SacB-42-EGFP, and recombinant bacteria BL21 / PET-Duet-SacB-60-EGFP were obtained. Subsequently, the above-mentioned recombinant bacteria were fermented and cultured at 37°C and 220rpm for 12h. After the culture was completed, the fluorescence value was measured using a multifunctional microplate reader at an excitation wavelength of 488nm and an emission wavelength of 520nm. The bacterial OD600 was also measured at the same time, and the unit bacterial fluorescence value = fluorescence value / OD600 was recorded. The unit bacterial fluorescence values ​​of the experimental group and the control group were calculated.

[0085] like Figure 4 As shown in the result diagram of SacB retention fusion with EGFP, when the number of fusion bases is 21, the fluorescence value of the unit cell increases significantly. This fusion method (i.e., plasmid PET-Duet-SacB-21-EGFP) can be selected for high-throughput screening.

[0086]

[0087]

[0088] (5) Flow cytometry positive control design

[0089] Take 1 mL of the recombinant bacteria BL21 / PET-Duet-SacB-21-EGFP and add it to 4 mL of LB (containing ampicillin and 0.5 mM IPTG) liquid culture medium and culture it at 37°C and 220 rpm for 16 h. Wash the cultured bacteria twice with PBS buffer and dilute the OD to 0.3. Detect the fluorescence intensity using a flow cytometer.

[0090] like Figure 5As shown, the positive control graph of flow cytometry is used as a subsequent positive reference. When collecting sample cells subsequently, only cells with a fluorescence value greater than the positive control value are collected.

[0091] (II) Construction of riboswitch library

[0092] (1) Design of riboswitch plasmid library:

[0093] Random ssDNA library and primers (synthesized by Shanghai Shenggong Biotechnology Co., Ltd.):

[0094] 5'-GGGAGACGCGAAAGCGTTACGAATGCGATGACTCGTCGAAAGACGAACAGTTCCTTTGGATCCGAATTCGCCGC-N10- aaggag catctccatgaaca-3', wherein N10 represents a sequence formed by connecting 10 arbitrary nucleotide bases, and the underline represents the ribosome binding site.

[0095] Upstream primer: 5'-aaggagcatctccatgaacatcaaaaagtttgcaggtaag-3'

[0096] Downstream primer: 5'-GCGGCGAATTCGGATCCAAAGGAACTGTTCGTCTTTCGAC-3'

[0097] The random ssDNA library and primers were prepared into 100 μM storage solution with BB buffer (Tris-HCl: 20 Mm, MgCl2: 50 mM, KCl: 5 mM, CaCl2: 2 Mm, pH 7.6) and stored at -20°C for use.

[0098] (2) PCR amplification to construct a riboswitch plasmid library

[0099] Insert the riboswitch plasmid library:

[0100] GGGAGACGCGAAAGCGTTACGAATGCGATGACTCGTCGAAAGACGAACAGTTCCTTTGGATCCGAATTCGCCGC-N10 was inserted into the promoter and ribosome binding site of the recombinant plasmid PET-Duet-SacB-21-EGFP by homologous recombination, and the riboswitch plasmid library was constructed by PCR amplification using the upstream and downstream primers in (1), as shown in FIG. Figure 1 shown.

[0101] PCR system:

[0102] Components volume 2×Phanta Max Master Mix 25μL Upstream primer 2μL(100μM) Downstream primer 2μL(100μM) Ultrapure water 20μL Template DNA 1μL

[0103] PCR procedure:

[0104]

[0105] Polyacrylamide gel electrophoresis verification: PCR products were electrophoresed using 2% agarose gel.

[0106] The plasmid library was transformed into Escherichia coli BL21 (DE3) to construct recombinant Escherichia coli containing the plasmid library.

[0107] Example 2: High-throughput screening of doxycycline riboswitches

[0108] 1 mL of the recombinant E. coli containing the plasmid library in Example 1 was added to 4 mL of LB (containing ampicillin, 0.5 mM IPTG, 100 μg / L doxycycline) liquid culture medium and cultured at 37°C and 220 rpm for 16 h. The cultured bacterial solution was washed twice with PBS buffer and diluted to OD 0.3. The high fluorescent cells obtained were collected using a flow cytometer, and the collected high fluorescent cells were spread on LB (containing ampicillin, 0.5 mM IPTG) solid culture medium and cultured at 37°C for 12 h.

[0109] like Figure 6 As shown, the flow cytometer collected the results, and only collected the fluorescence values ​​greater than 3*10 4 of cells.

[0110] Subsequently, under ultraviolet irradiation, white bacteria were selected and placed in a new LB (containing ampicillin) solid culture medium, cultured at 37°C for 12 h, and the cultured bacteria were inoculated into a 48-well plate (control group: containing ampicillin, 0.5 mM IPTG, experimental group: containing ampicillin, 0.5 mM IPTG, 100 μg / L doxycycline), and cultured at 37°C, 12 h, and 220 rpm. After the culture was completed, the fluorescence value was determined using a multifunctional microplate reader at an excitation wavelength of 488 nm and an emission wavelength of 520 nm. At the same time, the bacterial OD600 was determined, and the unit bacterial fluorescence value = fluorescence value / OD600 was recorded, and the unit bacterial fluorescence value of the experimental group and the control group was calculated.

[0111] like Figure 7 As shown in the figure, the high-throughput screening results showed that the fluorescence values ​​of the experimental group and the control group of DOX-3-4 riboswitch were quite different, and it can be used as an alternative riboswitch.

[0112] DOX-3-4 bacteria were selected and placed in a new LB (containing ampicillin) solid medium, cultured at 37°C for 12 h, and the cultured bacteria were inoculated into a 48-well plate (control group: containing ampicillin, 0.5 mM IPTG, experimental group: containing ampicillin, 0.5 mM IPTG, 100 μg / L doxycycline). Three parallels were set up for the experimental group and the control group respectively. After the culture was completed, the fluorescence value was measured under the conditions of excitation wavelength 488 nm and emission wavelength 520 nm, and the bacteria OD600 was measured at the same time. DOX-3-4 bacteria were placed in a new LB (containing ampicillin) liquid medium and cultured at 37°C and 220 rpm for 12 h. After the culture was completed, the plasmid DOX-3-4-PET-Duet-SacB-21-EGFP was extracted and sent for sequencing. The correct sequence was the riboswitch sequence (GGGAGACGCGAAAGCGUUACGAAUGCGAUGACUCGUCGAAAGACGAACAGUUCCU UUGGAUCCGAAUUCGCCGC-CACGAUUUGU).

[0113] Example 3: Riboswitch Dose Response Curve Analysis

[0114] The dose-response curve of the riboswitch was determined by the well plate fermentation method, and the concentrations of 0, 25, 50, and 100 μg / L were set to determine the dose-response curve. DOX-3-4 bacteria were cultured on 48-well plates, with the control group containing ampicillin and 0.5 mM IPTG, and the experimental group containing ampicillin, 0.5 mM IPTG, and different concentrations of doxycycline. After the culture was completed, the fluorescence intensity was measured at an excitation wavelength of 488 nm and an emission wavelength of 520 nm, and the OD was measured using a spectrophotometer. 600 , calculate the unit bacterial fluorescence value; use GraphPadPrism 8.0 software to make a dose-response curve.

[0115] like Figure 8 As shown, the riboswitch dose response curve and activation factor were measured, respectively. Under the action of 100 μg / L doxycycline, the riboswitch was activated 1.99 times.

[0116] Example 4: Computer-aided design of mutation sites

[0117] The Mfold (RNA Folding Form (unafold.org)) online software was used to predict the secondary structure of the riboswitch RNA. The principle of this software prediction is the minimum free energy principle. After decades of continuous development, it is relatively mature. The 3d RNA (Xiao Lab (hust.edu.cn)) online software developed by Huazhong University of Science and Technology was used to predict the tertiary structure of the riboswitch RNA. This software can accurately predict whether RNA or DNA is a tertiary spatial structure in a relatively short time. Fig. 9 shown.

[0118] Autodock4 is used to dock the macromolecule riboswitch with the small molecule ligand. Before docking, the PDB files of the macromolecule and the small molecule need to be prepared. The macromolecule can be directly predicted and saved in PDB format using online software, and the secondary structure of the small molecule can be saved in sdf format. Finally, it is converted into PDB format using Open Bable software. The overall steps of this software are: preparation of macromolecules and small molecules; pre-treatment of macromolecules and small molecules; setting up the docking box; running Autogrid; running Autodock. Generally, the results of 50 dockings are relatively accurate. After the docking is completed, view the docking results in the Analze box, select the one with the lowest binding free energy and save it, and open it in the pymol software to visualize the image and show the binding pocket. Direct molecular docking of riboswitch and doxycycline is shown in the following figure. Fig.10 shown.

[0119] Example 5: Single point mutation combined with combinatorial mutation to modify riboswitch performance

[0120] In the binding site region, find the hot spot bases within the range and perform single-point saturation mutation (including any nucleotide at positions 22 to 30, nucleotide 41, nucleotide 42, or any nucleotide at positions 45 to 55). Perform iterative combination mutation on mutants that are beneficial to single-point saturation mutation, and determine whether the mutant is beneficial by the activation multiple.

[0121] Table 1 Single point mutation primer design

[0122]

[0123]

[0124] Table 2 Design of combined mutation primers

[0125]

[0126] The specific method is as follows:

[0127] The DOX-3-4-PET-Duet-SacB-21-EGFP plasmid was PCR-PCR-enhanced and site-directed mutagenesis was performed using the above primers to obtain a mutant plasmid (mutant DOX-3-4-PET-Duet-SacB-21-EGFP). The above plasmid was transformed into Escherichia coli BL21 (D3) to determine the activation multiple of the riboswitch.

[0128] The above-mentioned recombinant strains were cultured in a 48-well plate (control group: containing ampicillin, 0.5 mM IPTG, experimental group: containing ampicillin, 0.5 mM IPTG, 100 μg / L doxycycline) at 37°C, 12 h, 220 rpm. After the culture was completed, the fluorescence value was determined using a multifunctional microplate reader at an excitation wavelength of 488 nm and an emission wavelength of 520 nm. At the same time, the bacterial OD600 was determined, and the unit bacterial fluorescence value = fluorescence value / OD600 was recorded to calculate the unit bacterial fluorescence values ​​of the experimental group and the control group.

[0129] like Fig.11 , 12 As shown in the figure, the results of single point mutation and combined mutation of riboswitch were obtained. Single point mutation was performed first, and five mutant riboswitches with increased single point mutation effects were found, namely C26G, A47U, A49G, U51C, and C53G. Subsequently, these five mutants were subjected to combined mutation, and it was found that the C26G / A47U mutant had a larger activation multiple after combination.

[0130] Example 6: Dose-response curve analysis based on mutant riboswitches

[0131] First, the dose-response curve of the C26G / A47U combined mutant riboswitch obtained in Example 5 was determined by a well plate fermentation method, and a control group containing ampicillin and 0.5 mM IPTG and an experimental group containing ampicillin, 0.5 mM IPTG, and different concentrations of doxycycline were set; then, the dose-response curve of the C26G / A47U mutant riboswitch was determined by a shake flask fermentation method. Fig.13 As shown, the mutant riboswitch dose-response curve showed that the riboswitch activation fold increased from 1.99 to 2.78 times.

[0132] Molecular docking was performed according to the method of Example 4. The results are as follows Fig.14 As shown, it was found that the binding energy changed from the original -3.11 kcal / mol to -6.48 kcal / mol, forming a more stable complex system.

[0133] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A method for screening a riboswitch that specifically recognizes doxycycline, characterized in that: The following steps are involved: (1) constructing a doxycycline riboswitch library using doxycycline RNA aptamers; (2) constructing a riboswitch reporter platform by fusing the SacB gene with the EGFP gene; (3) constructing a plasmid library using the doxycycline riboswitch library of step (1) and the riboswitch reporter platform of step (2); (4) transforming the plasmid library of step (3) into Escherichia coli and incubating with the substrate; collecting high-fluorescence cells by flow cytometry, i.e., positive cells; (5) The positive cells in step (4) are plated and cultured, and single white colonies without fluorescence are selected as positive colonies; (6) The positive colonies in step (5) were cultured in a well plate, and the fluorescence intensity was measured at an excitation wavelength of 488 nm and an emission wavelength of 520 nm. The OD was measured using a spectrophotometer. 600 , calculate the unit fluorescence value of the bacteria, and screen out the bacteria with larger unit fluorescence value, that is, those carrying the riboswitch that specifically recognizes doxycycline.

2. The method according to claim 1, characterized in that In step (1), the nucleotide sequence of the RNA aptamer of doxycycline is as shown in SEQ ID NO.2, The doxycycline RNA aptamer is used to design a doxycycline riboswitch library by inserting 10 random bases N into the 3′ end of the doxycycline DNA sequence. The doxycycline riboswitch library is shown in SEQ ID NO.

3.

3. The method according to claim 1, characterized in that In step (2), the 21 bp fragment of the SacB gene is fused with the EGFP gene to construct a SacB-21-EGFP fusion protein, which is a riboswitch reporter platform. The nucleotide sequence of the 21 bp fragment of the SacB gene is shown in SEQ ID NO.4, and the nucleotide sequence of the EGFP gene is shown in SEQ ID NO.

5.

4. The method according to claim 1, characterized in that In step (3), the doxycycline riboswitch library is inserted between the promoter and the ribosome binding site of a recombinant plasmid containing a riboswitch reporter platform to construct a plasmid library; optionally, the promoter is a strong T7 promoter and the ribosome binding site is AAGGAG; the recombinant plasmid uses PET-Duet-1 as an expression vector.

5. The method according to claim 4, characterized in that In step (4), the Escherichia coli includes Escherichia coli JM109 and Escherichia coli BL21; The IPTG concentration for inducing the expression of the E. coli was 0.5 mM; The substrate is doxycycline at a concentration of 100 μg / L.

6. A riboswitch that specifically recognizes doxycycline screened by the method of any one of claims 1 to 5, characterized in that: The nucleotide sequence of the riboswitch is shown in SEQ ID NO:

1.

7. A biosensor, characterized in that: The biosensor carries the ribosomal switch according to claim 6.

8. A method for modifying a doxycycline riboswitch, characterized in that: The method comprises mutating the 26th nucleotide, the 47th nucleotide, the 51st nucleotide and / or the 53rd nucleotide of the riboswitch parent according to claim 6.

9. The method according to claim 8, characterized in that The parent is subjected to a mutation as shown in any one of (1) to (6): (1) mutate cytosine C at position 26 to guanine G; (2) mutating adenine A at position 47 to uracil U; (3) mutating adenine A at position 49 to guanine G; (4) mutating uracil U at position 51 to cytosine C; (5) mutating cytosine C at position 53 to guanine G; (6) Mutation of cytosine C at position 26 to guanine G and mutation of adenine A at position 47 to uracil U.

10. Use of the method of any one of claims 1 to 5, the riboswitch of claim 6, the biosensor of claim 7 or the method of claim 8 or 9 in the synthesis of doxycycline.

Images