Kit combination for urinary system disease screening and application thereof

Abstract

The invention provides an application of an SNCG immunochromatography test strip and a methylation detection composition in preparation of a kit for detecting urinary system diseases, and a kit combination.

Description

Technical Field

[0001] The present application belongs to the field of detection technology, and specifically, relates to a kit combination for screening urinary system diseases and its use. Background Art

[0002] The urinary system includes the kidneys, ureters, bladder, and urethra, which are responsible for filtering blood, excreting waste, and regulating fluid balance in the body. With the change of lifestyle and the aging of the population, the incidence of urinary system diseases has gradually increased. Among them, urinary tract infections are particularly common in women and are usually caused by bacterial infections. If not treated in time, the infection may ascend to the kidneys and cause pyelonephritis, which not only causes severe pain but also may cause serious kidney damage. Urinary stones are formed by crystallization of minerals and salts in urine, often causing severe pain, hematuria, and urinary tract obstruction. If the stones are too large, surgery may be required to remove them. Urinary system cancers include bladder cancer, ureteral cancer, etc. These cancers usually have no obvious symptoms in the early stages, but if they can be detected in early screening, the treatment effect will be significantly improved. Smoking, occupational exposure, and family history are important risk factors for urinary system cancer. Regular screening is particularly important for high-risk groups, such as those with a family history of urinary system diseases, long-term smoking, obesity, chronic hypertension, and diabetes. Advances in modern medical technology, such as urine analysis, blood tests, imaging tests (such as ultrasound, CT and MRI), and endoscopy, have made early screening of urinary system diseases more accurate and convenient. In short, early screening of urinary system diseases not only helps to reduce the morbidity and mortality of the disease, but also reduces medical expenses and improves the quality of life of patients. It is one of the important measures to maintain public health.

[0003] The common methods currently used in clinical practice for urinary system diseases are as follows: 1) Urinalysis: used to detect infection, hematuria, and proteinuria. 2) Imaging examinations: such as ultrasound, CT, and MRI, used to detect stones, tumors, and other structural abnormalities. 3) Endoscopy: such as cystoscopy, used to directly observe the internal structure of the bladder and urethra. However, these methods either rely on hospital testing institutions or use invasive methods, and this invasive screening may cause complications such as urinary and male reproductive system infections, urethral and bladder bleeding, urethral injuries, and urethral strictures. Therefore, there is an urgent need to find a non-invasive, highly accurate, and convenient screening method. Summary of the invention

[0004] Liquid biopsy technology uses body fluids such as blood, saliva, and urine as test materials, and tumor markers as detection indicators to achieve early screening and diagnosis of cancer, auxiliary staging, prognosis and recurrence monitoring, medication guidance, etc. It has the advantages of being non-invasive, efficient, and accurate. Among them, immunochromatographic test strips for home testing have become an increasingly popular health monitoring method due to their simple operation, rapid results, high flexibility, privacy protection, and affordability. With the continuous advancement of technology and the expansion of its application scope, immunochromatographic test strips for home testing will play an increasingly important role in the field of medical testing, providing people with more convenient and efficient means of health management.

[0005] In addition, using abnormal changes in DNA methylation levels as a marker for molecular diagnosis of tumors is one of the current research hotspots and has gradually become a consensus in the scientific and medical communities.

[0006] Therefore, combining home screening with immunochromatographic test strips with laboratory DNA methylation testing for early screening and auxiliary diagnosis of urinary system diseases has great application potential.

[0007] The purpose of the present application is to provide a kit combination for screening of urinary system diseases and its use.

[0008] Specifically, this application involves the following aspects:

[0009] 1. Use of SNCG immunochromatographic test strips and methylation detection compositions in the preparation of a kit for detecting urinary system diseases,

[0010] The composition comprises:

[0011] Nucleic acid used to detect the methylation status of the target gene,

[0012] The methylation status of the target gene is characterized by the methylation of the target sequence of the target gene, and the target gene is the VIM gene, the TMEM220 gene and the PPM1N gene.

[0013] 2. The use according to item 1, wherein the target sequence of the VIM gene is as shown in any one of SEQ ID NOs: 1-4 or includes a sequence as shown in any one of SEQ ID NOs: 1-4.

[0014] 3. The use according to item 1, wherein the target sequence of the TMEM220 gene is as shown in any one of SEQ ID NOs: 5-8 or includes a sequence as shown in any one of SEQ ID NOs: 5-8.

[0015] 4. The use according to item 1, wherein the target sequence of the PPM1N gene is as shown in any one of SEQ ID NOs: 9-12 or includes a sequence as shown in any one of SEQ ID NOs: 9-12.

[0016] 5. The use according to any one of items 1 to 4, wherein the nucleic acid for detecting the methylation status of the target gene comprises:

[0017] A primer, wherein the primer is a fragment of at least 9 nucleotides in the target sequence of the target gene,

[0018] The fragment comprises at least one CpG dinucleotide sequence.

[0019] 6. The use according to any one of items 1 to 5, wherein the nucleic acid for detecting the methylation status of the target gene comprises:

[0020] A probe, wherein the probe is a fragment of at least 15 nucleotides that hybridizes to the target sequence of the target gene under moderately stringent or stringent conditions,

[0021] The fragment comprises at least one CpG dinucleotide sequence.

[0022] 7. The use according to any one of items 1 to 6, wherein the composition further comprises:

[0023] A reagent that converts unmethylated cytosine base at position 5 of the target sequence of the target gene into uracil.

[0024] 8. The use according to any one of items 1 to 7, wherein the nucleic acid for detecting the methylation status of the target gene further comprises:

[0025] Blockers that preferentially bind to target sequences in their unmethylated state.

[0026] 9. The use according to item 5, wherein the fragment of at least 9 nucleotides is a sequence of SEQ ID NO: 13 and SEQ ID NO: 14, or a sequence of SEQ ID NO: 16 and SEQ ID NO: 17, or a sequence of SEQ ID NO: 19 and SEQ ID NO: 20.

[0027] 10. The use according to item 6, wherein the fragment of at least 15 nucleotides is the sequence of SEQ ID NO: 15, or the sequence of SEQ ID NO: 18, or the sequence of SEQ ID NO: 21.

[0028] 11. The use according to any one of items 1 to 10, wherein the test strip comprises a sample pad, a conjugate pad, a reaction membrane and an absorption pad in sequence along the sample flow direction;

[0029] The conjugate pad contains a first mouse anti-SNCG monoclonal antibody, and the reaction membrane contains a second mouse anti-SNCG monoclonal antibody.

[0030] 12. The use according to item 11, wherein the first mouse anti-SNCG monoclonal antibody is secreted by a hybridoma cell line with a deposit number of CGMCC NO.2469, and the second mouse anti-SNCG monoclonal antibody is secreted by a hybridoma cell line with a deposit number of CGMCC NO.2468.

[0031] 13. The method according to any one of items 1 to 12, wherein the urinary system disease comprises: urothelial carcinoma, non-urothelial carcinoma or a combination thereof,

[0032] The urothelial cancer includes bladder cancer, ureteral cancer, renal pelvis cancer or a combination thereof,

[0033] The non-urothelial cancer includes kidney stones, ureteral stones, bladder stones, prostate hyperplasia, urothelial papillary hyperplasia or a combination thereof.

[0034] 14. A kit combination, comprising a first kit and a second kit, wherein the first kit comprises an SNCG immunochromatographic test strip, and the second kit comprises a methylation detection composition,

[0035] The composition comprises:

[0036] Nucleic acid used to detect the methylation status of the target gene,

[0037] The methylation status of the target gene is characterized by the methylation of the target sequence of the target gene, and the target gene is the VIM gene, the TMEM220 gene and the PPM1N gene.

[0038] 15. The kit combination according to item 14, wherein the target sequence of the VIM gene is as shown in any one of SEQ ID NOs: 1-4 or includes a sequence as shown in any one of SEQ ID NOs: 1-4.

[0039] 16. The kit combination according to item 14, wherein the target sequence of the TMEM220 gene is as shown in any one of SEQ ID NOs: 5-8 or includes a sequence as shown in any one of SEQ ID NOs: 5-8.

[0040] 17. The kit combination according to item 14, wherein the target sequence of the PPM1N gene is as shown in any one of SEQ ID NOs: 9-12 or comprises a sequence as shown in any one of SEQ ID NOs: 9-12.

[0041] 18. The kit combination according to any one of items 14-17, wherein the nucleic acid for detecting the methylation status of the target gene comprises:

[0042] A primer, wherein the primer is a fragment of at least 9 nucleotides in the target sequence of the target gene,

[0043] The fragment comprises at least one CpG dinucleotide sequence.

[0044] 19. The kit combination according to any one of items 14-18, wherein the nucleic acid for detecting the methylation status of the target gene comprises:

[0045] A probe, wherein the probe is a fragment of at least 15 nucleotides that hybridizes to the target sequence of the target gene under moderately stringent or stringent conditions,

[0046] The fragment comprises at least one CpG dinucleotide sequence.

[0047] 20. A kit of parts according to any one of items 14-19, wherein the composition further comprises:

[0048] A reagent that converts unmethylated cytosine base at position 5 of the target sequence of the target gene into uracil.

[0049] 21. The kit combination according to any one of items 14-20, wherein the nucleic acid for detecting the methylation status of the target gene further comprises:

[0050] Blockers that preferentially bind to target sequences in their unmethylated state.

[0051] 22. The kit combination according to item 18, wherein the fragment of at least 9 nucleotides is a sequence of SEQ ID NO: 13 and SEQ ID NO: 14, or a sequence of SEQ ID NO: 16 and SEQ ID NO: 17, or a sequence of SEQ ID NO: 19 and SEQ ID NO: 20.

[0052] 23. The kit combination according to item 19, wherein the fragment of at least 15 nucleotides is the sequence of SEQ ID NO: 15, or the sequence of SEQ ID NO: 18, or the sequence of SEQ ID NO: 21.

[0053] 24. The kit combination according to any one of items 14 to 23, wherein the test strip comprises a sample pad, a conjugate pad, a reaction membrane and an absorption pad in sequence along the sample flow direction;

[0054] The conjugate pad contains a first mouse anti-SNCG monoclonal antibody, and the reaction membrane contains a second mouse anti-SNCG monoclonal antibody.

[0055] 25. The kit combination according to item 24, wherein the first mouse anti-SNCG monoclonal antibody is secreted by a hybridoma cell line with a preservation number of CGMCC NO.2469, and the second mouse anti-SNCG monoclonal antibody is secreted by a hybridoma cell line with a preservation number of CGMCC NO.2468.

[0056] 26. The kit combination according to any one of items 14-25, wherein the kit is used to detect urinary system diseases, the urinary system diseases comprising: urothelial carcinoma, non-urothelial carcinoma or a combination thereof,

[0057] The urothelial cancer includes bladder cancer, ureteral cancer, renal pelvis cancer or a combination thereof,

[0058] The non-urothelial cancer includes kidney stones, ureteral stones, bladder stones, prostate hyperplasia, urothelial papillary hyperplasia or a combination thereof.

[0059] This application has the following beneficial effects:

[0060] This application combines immunochromatography and PCR fluorescent probe method for detecting urinary system diseases. The kit and method of this application can be used for home testing, realizing the transition from broad-spectrum screening for the general population to precise screening for key high-risk populations, making early screening of urinary system diseases more accurate and convenient. Early screening of urinary system diseases not only helps reduce the morbidity and mortality of the disease, but also reduces medical expenses and improves the quality of life of patients. It is one of the important measures to maintain public health. BRIEF DESCRIPTION OF THE DRAWINGS

[0061] Figure 1 Schematic diagram of the immunochromatography kit. DETAILED DESCRIPTION

[0062] The present application is further described below in conjunction with examples. It should be understood that the examples are only used to further describe and illustrate the present application and are not used to limit the present application.

[0063] Unless otherwise defined, the technical and scientific terms in this specification have the same meaning as those generally understood by those skilled in the art. Although similar or identical methods and materials as described herein may be used in experiments or practical applications, materials and methods are described herein below. In the event of a conflict, the present specification including the definitions therein shall prevail. In addition, materials, methods and examples are provided for illustration only and are not restrictive. The present application is further described below in conjunction with specific embodiments, but is not intended to limit the scope of the present application.

[0064] Liquid biopsy technology uses body fluids such as blood, saliva, and urine as samples, and tumor markers as detection indicators to achieve early screening and diagnosis of cancer, auxiliary staging, prognosis and recurrence monitoring, medication guidance, etc. It has the advantages of being non-invasive, efficient, and accurate. Among them, the abnormal changes in DNA methylation levels as a marker for tumor molecular diagnosis is one of the current research hotspots and has gradually become a consensus in the scientific and medical communities. DNA methylation is an important epigenetic modification and participates in the regulation of a variety of cellular processes, including embryonic development, gene transcription, X chromosome inactivation, genomic imprinting, chromatin structure stability, etc. Therefore, abnormal DNA methylation is closely related to the occurrence of complex human diseases. In normal cells, cytosine in CpG islands and some CG-rich sites is usually non-methylated, while cytosine bases in regions with a low CG ratio are mostly in a highly methylated state. However, in many cancers, the methylation pattern is just the opposite. Many studies have shown that high methylation of CpG islands can inhibit or silence the expression of some tumor suppressor genes and DNA mismatch repair genes, while low methylation in other regions of the genome can promote the expression of oncogenes, which will give normal cells carcinogenic properties and promote the occurrence of cancer. In addition, abnormal DNA methylation usually occurs in the very early stages of cancer and is the "seed" factor for tumor growth. As the course of cancer progresses, the methylation state of DNA will also change dynamically, which can directly reflect the growth of tumor lesions. Therefore, the use of DNA methylation detection for early cancer screening and auxiliary diagnosis has great application potential.

[0065] On the one hand, the present application provides the use of a gamma synuclein (SNCG) immunochromatographic test strip and a methylation detection composition in the preparation of a kit for detecting urinary system diseases, wherein the composition comprises: a nucleic acid for detecting the methylation state of a target gene, wherein the methylation state of the target gene is characterized by the methylation of a target sequence of the target gene, and the target gene is a VIM gene, a TMEM220 gene, and a PPM1N gene.

[0066] The present application provides a group of target sequences of target genes that are abnormally methylated in urinary system diseases, including target sequences of VIM gene, TMEM220 gene and PPM1N gene, the target sequence of VIM gene is shown in any one of SEQ ID NO:1-4 or includes the sequence shown in any one of SEQ ID NO:1-4, the target sequence of TMEM220 gene is shown in any one of SEQ ID NO:5-8 or includes the sequence shown in any one of SEQ ID NO:5-8, and the target sequence of PPM1N gene is shown in any one of SEQ ID NO:9-12 or includes the sequence shown in any one of SEQ ID NO:9-12.

[0067] Those skilled in the art can also understand that the target sequences of the VIM gene, TMEM220 gene, and PPM1N gene are not limited to the specific sequences listed above. The target sequence of the VIM gene should include a sequence that contains one, two, or three or more nucleotide mutations compared to the sequence shown in any one of SEQ ID NOs: 1-4, but is still substantially functionally the same, and also includes a sequence that has 95%, 96%, 97%, 98%, or 99% sequence identity compared to the sequence shown in any one of SEQ ID NOs: 1-4, and also includes a sequence that deletes one or more nucleotides, adds one or more nucleotides, or replaces one or more nucleotides based on the nucleotide sequence shown in any one of SEQ ID NOs: 1-4 but has 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleotide sequence shown in any one of SEQ ID NOs: 1-4. The target sequence of the TMEM220 gene should include a sequence that contains one, two or three or more nucleotide mutations compared to the sequence shown in any one of SEQ ID NOs: 5-8, but is still substantially functionally identical thereto, and also includes a sequence having 95%, 96%, 97%, 98% or 99% sequence identity compared to the sequence shown in any one of SEQ ID NOs: 5-8, and also includes a sequence that deletes one or more nucleotides, adds one or more nucleotides, or replaces one or more nucleotides based on the nucleotide sequence shown in any one of SEQ ID NOs: 5-8 but has 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleotide sequence shown in any one of SEQ ID NOs: 5-8. The target sequence of the PPM1N gene should include a sequence comprising one, two or three or more nucleotide mutations compared to the sequence shown in any one of SEQ ID NOs: 9-12, but having substantially the same essential function as the sequence, and also includes a sequence having 95%, 96%, 97%, 98% or 99% sequence identity compared to the sequence shown in any one of SEQ ID NOs: 9-12, and also includes a sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleotide sequence shown in any one of SEQ ID NOs: 9-12 by deleting one or more nucleotides, adding one or more nucleotides, or replacing one or more nucleotides.

[0068] The target sequence (5'-3') of the VIM gene is as follows:

[0069] CTGAGCCCTGCGTCCTGCGCTGTGCGCGCCCCCACCCCGCGTTCCAATCTCAGGCGCTCTTTGTTTCTTTCCGCG ACTTCAGATCTGAGGGATTCCTTACTCTTTCCTCTTCCCGCTCCTTTGCCCGCGGGTCTCCCCGCCTGACCGCAGCCCCG AGACCGCCGCGCACCTCCTCCCACGCCCCTTTGGCGTGGTGCC (SEQ ID NO: 1)

[0070] The complementary sequence (5'-3') of the target sequence of the VIM gene is as follows:

[0071] GGCACCACGCCAAAGGGGCGTGGGAGGAGGTGCGCGGCGGTCTCGGGCTCGGTCAGGCGGGGAGACCCGCGG GCAAAGGAGCGGGAAGAGGAAAGAGTAAGGAATCCCTCAGATCTGAAGTCGCGGAGAAAGAAACAAAGAGCGCCTGA GATTGGAACGCGGGGTGGGGGCGCGCACAGCGCAGGAACGCAGGGCTCAG (SEQ ID NO: 2)

[0072] The sequence of the target sequence of the VIM gene after bisulfite treatment (5'-3') is as follows:

[0073] TTGAGTTTTGCGTTTTTGCGTTGTGCGCGTTTTTATTTCGCGTTTTAATTTTAGGCGTTTTTTGTTTTTTTTCGCGAT TTTAGATTTGAGGGATTTTTTATTTTTTTTTTTTTCGTTTTTGTTCGCGGGTTTTTTCGTTTGATCGTAGTTTCGAGATC GTCGCGTATTTTTTTTTACGTTTTTTTGGCGTGGTGTT (SEQ ID NO: 3)

[0074] The complementary sequence of the target sequence of the VIM gene after bisulfite treatment (5'-3') is as follows:

[0075] GGTATTACGTTAAAGGGGCGTGGGAGGAGGTGCGCGGCGGTTTCGGGGTTGCGGTTAGGCGGGGAGATTCGCGGG TAAAGGAGCGGGAAGAGGAAAGAGTAAGGAATTTTTTAGATTTGAAGTCGCGGAGAAAGAAATAAAGAGCGTTTGAG ATTGGAACGCGGGGTGGGGGCGCGTATAGCGTAGGAACGTAGGGTTTAG(SEQ ID NO:4)

[0076] The target sequence (5'-3') of the TMEM220 gene is as follows:

[0077] AGGGTGTGAGCCCTGGTATGGGACTCGCTTCCATGAACACATCCGCGTCTCTTAGACGGGGGAGAAAGTGGGGGCTCCCCAAGCAGAAAGCCCAAGTCCCGTCCTCCCCACTAACTGTGCGCCCCTGCGACTCTGCCCGCTAGTCAGTTACACGGCCCGCTAGGCCAGGGGGCGGAGCTGGGAGCCGGGCGGGTCCCCCTCCCACCGCGGCCGCCTGACCTGCACCAAGGC(SEQ ID NO:5)

[0078] The complementary sequence (5'-3') of the target sequence of the TMEM220 gene is as follows:

[0079] GCCTTGGTGCAGGTCAGGCGGCCGCGGTGGGAGGGGGACCCGCCCGGCTCCCAGCTCCGCCCCCTGGCCTAGCGGGCCGTGTAACTGACTAGCGGGCAGAGTCGCAGGGGCGCACAGTTAGTGGGGAGGACGGGACTTGGGCTTTCTGCTTGGGGAGCCCCCACTTTCTCCCCCGTCTAAGAGACGCGGATGTGTTCATGGAAGCGAGTCCCATACCAGGGCTCACACCCT(SEQ ID NO:6)

[0080] The sequence of the target sequence of the TMEM220 gene after bisulfite treatment (5'-3') is as follows:

[0081] AGGGTGTGAGTTTTGGTATGGGATTCGTTTTTATGAATATATTCGCGTTTTTTAGACGGGGGAGAAAGTGGGGGTTT TTTAAGTAGAAAGTTTAAGTTTCGTTTTTTTTATTAATTGTGCGTTTTTGCGATTTTGTTCGTTAGTTAGTTATACGGTTCG TTAGGTTAGGGGGCGGAGTTGGGAGTCGGGCGGGTTTTTTTTTTATCGCGGTCGTTTGATTTGTATTAAGGT(SEQ ID NO:7)

[0082] The complementary sequence of the target sequence of the TMEM220 gene after bisulfite treatment (5'-3') is as follows:

[0083] GTTTTGGTGTAGGTTAGGCGGTCGCGGTGGGAGGGGGATTCGTTCGGTTTTTAGTTTCGTTTTTTGGTTTAGCGGGT CGTGTAATTGATTAGCGGGTAGAGTCGTAGGGGCGTATAGTTAGTGGGGAGGACGGGATTTGGGTTTTTTGTTTGGGGA GTTTTTATTTTTTTTTTCGTTTAAGAGACGCGGATGTGTTTATGGAAGCGAGTTTTATATTAGGGTTTATATTTT(SEQ ID NO:8)

[0084] The target sequence of the PPM1N gene (5'-3') is as follows

[0085] TGAAGGATGGCGGTCCTGGCCCGCCAGCTGCAGCGTCTCCTCTGGACCGCTTGCAAGAAAAAGGAGAGGGAGAAG GAGGGGAGGGAGGAAGAGGAGGAGGAGGAGGCGGGGCGCAGGGCCCCCGAAGGGCCTCGGTCTCTGTTGACAGCGCC GCGCCGCGCCCAGCGGCCGCACGGGGGTGCCGAGGCGTCTGGGGGCCTGCGCTTCGGGGCGAGCG(SEQ ID NO:9)

[0086] The complementary sequence of the target sequence of the PPM1N gene (5'-3') is as follows:

[0087] CGCTCGCCCCGAAGCGCAGGCCCCCAGACGCCTCGGCCCCGTGCGGCCGCTGGGCGCGGCGCGGCGCTGTCA ACAGAGACCGAGGCCCTTCGGGGGCCCTGCGCCCCGCCTCCTCCTCCTCCTTCCTCCCTCCCCTCCTTCTCCCTCCT TTTTCTTGCAAGCGGTCCAGAGGAGACGCTGCAGCTGGCGGGCCAGGACCGCCATCCTTCA (SEQ ID NO: 10)

[0088] The target sequence of the PPM1N gene after bisulfite treatment (5'-3') is as follows:

[0089] TGAAGGATGGCGGTTTTGGTTCGTTAGTTGTTAGCGTTTTTTTTGGATCGTTTGTAAGAAAAAGGAGAGGGAGAAGG AGGGGAGGGAGGAAGAGGAGGAGGAGGAGGCGGGGCGTAGGGTTTCGAAGGTTCCGGTTTGTTGATAGCGTCGC GTCGCGTTTAGCGGTCGTACGGGGGTGTCGAGGCGTTTGGGGGTTTGCGTTTCGGGGCGAGCG (SEQ ID NO:11)

[0090] The complementary sequence of the target sequence of the PPM1N gene after bisulfite treatment (5'-3') is as follows:

[0091] CGTTCGTTTCGAAGCGTAGGTTTTTAGACGTTTCGGTATTTTCGGTGCGGTCGTTGGGCGCGGCGGCGTTGTTAAT AGAGATCGAGGTTTTTCGGGGGTTTTGCGTTTCGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGTAAGCGGTTTAGAGGAGACGTTGTAGTTGGCGGGTTAGGATCGTTATTTTTA (SEQ ID NO:12)

[0092] The target sequences and related sequences of VIM gene, TMEM220 gene and PPM1N gene are shown in Table 1:

[0093] Table 1: Target sequences and related sequences of each gene

[0094] Target sequence name Serial Number Target sequence of VIM gene SEQ ID NO:1 Complementary sequence of the target sequence of the VIM gene SEQ ID NO:2 Sequence of the target sequence of the VIM gene after bisulfite treatment SEQ ID NO:3 The complementary sequence of the target sequence of the VIM gene after bisulfite treatment SEQ ID NO:4 Target sequence of TMEM220 gene SEQ ID NO:5 Complementary sequence of the target sequence of the TMEM220 gene SEQ ID NO:6 Target sequence of TMEM220 gene after bisulfite treatment SEQ ID NO:7 Complementary sequence of the target sequence of the TMEM220 gene after bisulfite treatment SEQ ID NO:8 Target sequence of PPM1N gene SEQ ID NO:9 Complementary sequence of the target sequence of the PPM1N gene SEQ ID NO:10 Target sequence of PPM1N gene after bisulfite treatment SEQ ID NO:11 The complementary sequence of the target sequence of the PPM1N gene after bisulfite treatment SEQ ID NO:12

[0095] Preferably, the nucleic acid used to detect the methylation state of the target gene includes a fragment of at least 9 nucleotides in the target sequence of the target gene, wherein the fragment contains at least one CpG dinucleotide sequence. In certain preferred embodiments, if the sample DNA to be tested is converted using bisulfite, the nucleic acid used to detect the methylation state of the target gene includes a fragment of at least 9 nucleotides in the sequence after bisulfite conversion of the target sequence of the target gene, preferably a fragment of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or more nucleotides, wherein the fragment of the nucleotide contains at least one CpG dinucleotide sequence.

[0096] More preferably, the nucleic acid used to detect the methylation status of the target gene includes a fragment of at least 15 nucleotides in the target sequence of the target gene that hybridizes under moderate stringency or stringent conditions, wherein the fragment of the nucleotide contains at least one CpG dinucleotide sequence. In certain preferred embodiments, if the test sample DNA is converted using bisulfite, the nucleic acid used to detect the methylation status of the target gene includes a fragment of at least 15 nucleotides in the sequence after bisulfite conversion, preferably at least 16, 17, 18, 19, 20, 21, 22 or more nucleotides, hybridized to the target sequence of the target gene under moderate stringency or stringent conditions, wherein the fragment of the nucleotide contains at least one CpG dinucleotide sequence.

[0097] Preferably, the composition further comprises a reagent for converting the unmethylated cytosine base at position 5 of the target sequence of the target gene into uracil. More preferably, the reagent is bisulfite.

[0098] The nucleic acid used to detect the methylation status of the target gene may also include a blocker that preferentially binds to DNA in an unmethylated state.

[0099] Preferably, the composition comprises one or more of the primers and probes shown in Table 2:

[0100] Table 2 Primer and probe sequences used in this application

[0101] Sequence number sequence name Specific nucleotide sequence (5'-3') SEQ ID NO:13 VIM-F TAAAGTTATATAATTTGCGACG SEQ ID NO:14 VIM-R AATCGCCGAACTAAAACC SEQ ID NO:15 VIM-P TTCGTTTTTATTTTTCGGTCGTTT SEQ ID NO:16 TMEM220-F ATTAATTGTGCGTTTTTGCGAT SEQ ID NO:17 TMEM220-R TACAAATCAAACGACCGCGAT SEQ ID NO:18 TMEM220-P CCGCCCGACTCCCAACTC SEQ ID NO:19 PPM1N_F GGCGGTTTTGGTTCGTTAGTTGT SEQ ID NO:20 PPM1N_R CCAAACGCCTCGACACCC SEQ ID NO:21 PPM1N_P AAACCCTACGCCCCGCCTC

[0102] In Table 2, "F" indicates a forward primer; "R" indicates a reverse primer; and "P" indicates a probe.

[0103] Preferably, the fluorescent labeling method of the probe sequence used in the present application is as shown in Table 3.

[0104] Table 3 A fluorescent labeling method for the probe sequences used in this application

[0105]

[0106]

[0107] In certain embodiments, the composition further comprises an agent for converting the unmethylated cytosine base at position 5 of the gene into uracil. Preferably, the agent is bisulfite. Bisulfite modification of DNA is a known tool for assessing the methylation status of CpGs. In the DNA of eukaryotic cells, 5-methylcytosine is the most common covalent base modification. 5-methylcytosine cannot be identified by sequencing because 5-methylcytosine has the same base pairing behavior as cytosine. In addition, during PCR amplification, the epigenetic information carried by 5-methylcytosine is completely lost. The method most commonly used to analyze the presence of 5-methylcytosine in DNA is based on the specific reaction of bisulfite with cytosine; after subsequent alkaline hydrolysis, unmethylated cytosine is converted into uracil, which corresponds to thymine in pairing behavior; but under these conditions, 5-methylcytosine remains unmodified. Thus the original DNA is transformed in this way, so that the 5-methylcytosine, which was originally indistinguishable from cytosine in its hybridization behavior, can now be detected as the only remaining cytosine by conventional known molecular biology techniques, such as by amplification and hybridization. All these techniques are based on different base pairing characteristics and can now be fully utilized. Therefore, typically, the application provides the combined use of bisulfite technology and one or more methylation assays to determine the methylation state of the CpG dinucleotide sequence in the target sequence of the target gene. In addition, the method of the application is suitable for analyzing heterogeneous biological samples, such as low-concentration tumor cells in blood or feces. Therefore, when analyzing the methylation state of the CpG dinucleotide sequence in this sample, those skilled in the art can use quantitative determination methods to determine the methylation level (such as percentage, number, ratio, proportion or degree) of a specific CpG dinucleotide sequence, rather than the methylation state. Accordingly, the term methylation status or methylation state should also be considered to refer to the value reflecting the methylation state of the CpG dinucleotide sequence.

[0108] The SNCG immunochromatographic test strips of the present application may be various types of known or preparable SNCG immunochromatographic test strips, as long as they can achieve SNCG-based detection, for example, they may include qualitative colloidal gold immunochromatographic test strips and latex immunochromatographic test strips, as well as fluorescent immunochromatographic test strips and quantum dot immunochromatographic test strips that can be read quantitatively with the aid of small instruments.

[0109] Figure 1The typical structure of a test strip is shown. The exemplary test strip includes a sample pad, a conjugate pad, a reaction membrane and an absorption pad in sequence along the sample flow direction; the conjugate pad contains a first mouse anti-SNCG monoclonal antibody, and the reaction membrane contains a second mouse anti-SNCG monoclonal antibody.

[0110] In a specific embodiment, the first mouse anti-SNCG monoclonal antibody is secreted by a hybridoma cell line with a deposit number of CGMCC NO.2469, and the second mouse anti-SNCG monoclonal antibody is secreted by a hybridoma cell line with a deposit number of CGMCC NO.2468.

[0111] The urinary system diseases of the present application may include: urothelial carcinoma, non-urothelial carcinoma or a combination thereof, wherein the urothelial carcinoma may include bladder cancer, ureteral cancer, renal pelvis cancer, etc., and the non-urothelial carcinoma may include kidney stones, ureteral stones, bladder stones, prostatic hyperplasia, urothelial papillary hyperplasia, etc.

[0112] On the other hand, the present application also provides a kit combination, including a first kit and a second kit, wherein the first kit includes an SNCG immunochromatographic test strip, and the second kit includes a methylation detection composition. The description of the SNCG immunochromatographic test strip and the methylation detection composition is the same as above.

[0113] Those skilled in the art will appreciate that the second kit may further comprise at least one other component selected from the following: nucleoside triphosphates, DNA polymerase, and a buffer required for the function of the DNA polymerase.

[0114] The kit combination also includes a container for containing a patient's biological sample. In addition, the kit combination also includes instructions for use and interpretation of test results.

[0115] The kit combination can be used to detect urinary system diseases, and the specific types of urinary system diseases are as described above.

[0116] In the above-mentioned purposes or kit combinations, various types of biological samples can be selected for detection, such as urine, cell lines, histological sections, tissue biopsy / paraffin-embedded tissues, body fluids, feces, colon effluent, plasma, serum, whole blood, separated blood cells, cells separated from blood, or a combination thereof. The preferred biological sample is urine.

[0117] The present application combines immunochromatography and PCR fluorescent probe method for detecting urinary system diseases. Among them, immunochromatography can quickly and inexpensively perform broad-spectrum screening on the general public. Further, the PCR fluorescent probe method can be used for the screened patients to detect urothelial carcinoma by detecting the methylation status of the gene target sequence in the VIM gene, TMEM220 gene, and PPM1N gene in the sample. Thereby, the early screening of urinary system diseases can be made more accurate and convenient. Early screening of urinary system diseases not only helps to reduce the morbidity and mortality of the disease, but also reduces medical expenses and improves the quality of life of patients.

[0118] Example

[0119] Example 1 Preparation of SNCG Immunochromatography Kit

[0120] The prepared immunochromatographic kit is as follows Figure 1 As shown, the preparation process of the test strip is as follows:

[0121] (1) Preparation of colloidal gold particles

[0122] Take 1.0g of chloroauric acid, balance it to room temperature, measure 2.0mL of purified water, add it to the glass bottle containing chloroauric acid, and blow it repeatedly until the chloroauric acid is completely dissolved. Pour the dissolved chloroauric acid into a container, and repeatedly rinse the chloroauric acid glass bottle with purified water for 5 times, and pour the washing liquid back into the container. Use purified water to make the solution dilute to 10.0mL. Cover the bottle cap tightly, shake it thoroughly for 15 minutes, mix it evenly, and prepare a 10% chloroauric acid solution.

[0123] Measure 0.3 mL of 10% chloroauric acid solution, add it to 100.0 mL of purified water, and heat and stir until boiling. Measure 0.6 mL of 10% trisodium citrate solution, quickly and all at once add it to the boiling chloroauric acid solution, continue heating and boiling for 2 minutes, turn off the heat source and heat with residual heat for 5 minutes. After cooling to room temperature, add purified water to make up to 100.0 mL to obtain a solution containing colloidal gold particles.

[0124] (2) Preparation of the first mouse anti-SNCG monoclonal antibody and the second mouse anti-SNCG monoclonal antibody

[0125] The preparation method of SNGG monoclonal antibody described in the Chinese patent application with application number 200810105770.7 and invention name "SNCG monoclonal antibody and its application" is adopted, and the hybridoma cell line with the preservation number of CGMCCNO.2469 is used to secrete the first mouse anti-SNCG monoclonal antibody, and the hybridoma cell line with the preservation number of CGMCCNO.2468 is used to secrete the second mouse anti-SNCG monoclonal antibody.

[0126] (3) Preparation of colloidal gold-labeled mouse anti-SNCG antibody colloidal gold conjugate

[0127] Take 100.0mL (0.03g) of colloidal gold in a conical flask, accurately add 3.5mL of 0.1M potassium carbonate solution, mix well, and let stand for 10 minutes. Take 0.85mg of the first mouse anti-SNCG monoclonal antibody prepared in step (2), add the first mouse anti-SNCG monoclonal antibody dropwise to the conical flask under rapid stirring conditions, and let stand at room temperature for 40 minutes. Take 1.5mL of 10g / 100mL casein sodium solution, add it dropwise to the conical flask under rapid stirring conditions, and let stand at room temperature for 15 minutes. Obtain a colloidal gold-labeled mouse anti-SNCG antibody colloidal gold conjugate.

[0128] (4) Preparation of gold conjugate pad

[0129] The colloidal gold conjugate was centrifuged at 12000rpm and 4°C for 40 minutes, the supernatant was carefully discarded, the colloidal gold conjugate resuspension was added to the original volume, the colloidal gold conjugate was re-dissolved with the colloidal gold resuspension, so that the content of the first mouse anti-SNCG monoclonal antibody after re-dissolution was 8.5μg / mL, and the re-solution was sprayed on the glass fiber membrane with a spraying amount of 0.0166mL / cm2, and dried to obtain a gold conjugate pad. After spraying, it was placed in a drying room for 5 hours to obtain a gold conjugate pad, and then stored in a room temperature desiccator.

[0130] Wherein, the preparation of colloidal gold conjugate resuspension is as follows:

[0131] Add 0.124g of boric acid, 0.762g of borax, 150.0g of sucrose, 7.0g of bovine serum albumin, 1.0g of caseinate sodium, 4g of Triton X-100, 5g of polyvinyl pyrrolidone K30, and 1g of polyethylene glycol-20000 to 700.0mL of purified water, stir until fully dissolved, add appropriate amount of concentrated hydrochloric acid, stir evenly, adjust pH to 7.4, and dilute to 1000mL after fully stirring and dissolving.

[0132] (5) Preparing a test line and a quality control line on a nitrocellulose membrane to obtain a reaction membrane.

[0133] The second mouse anti-SNCG antibody prepared in step (2) was added to 5.0 mL of 0.05 M PBS, and after thorough mixing, the final volume was fixed to 10.0 mL with 0.05 M PBS buffer, so that the final concentration of the second mouse anti-SNCG was 0.56 mg / mL. The solution containing the second mouse anti-SNCG monoclonal antibody was sprayed onto the nitrocellulose membrane at a spraying amount of 10 μL / cm2 to form a detection line.

[0134] Take 15.0 mg of goat anti-mouse polyclonal antibody, add it to 5.0 mL of 0.05 M PBS buffer, mix thoroughly and dilute to a final volume of 10.0 mL with 0.05 M PBS buffer, so that the final concentration of goat anti-mouse polyclonal antibody is 1.5 mg / mL. Spray the solution containing goat anti-mouse IgG polyclonal antibody onto the nitrocellulose membrane at 10 μL / cm2 to form a quality control line. Put the reaction membrane coated with the test line and the quality control line into the drying workshop and dry for 5 hours.

[0135] The sample pad, the binding pad, the reaction membrane and the absorption pad are pasted on the PVC board so that the sample pad, the binding pad, the reaction membrane and the absorption pad are arranged in sequence along the flow direction of the sample, and the test strips are cut and then installed in the detection card shell, and the installed plastic card is then installed in the aluminum foil bag, and the sealing is performed to complete the assembly of the gamma synuclein (SNCG) detection card; the gamma synuclein (SNCG) detection card, the instruction manual and other materials are then placed in the packaging box of the gamma synuclein (SNCG) detection kit (immunochromatography) to form the gamma synuclein (SNCG) detection kit (immunochromatography).

[0136] Example 2 SNCG immunochromatographic kit for screening of urinary system diseases

[0137] 1) Take out the gamma synuclein (SNCG) detection kit (immunochromatography) prepared in Example 1, open the aluminum foil bag, and lay the detection card flat on a flat surface;

[0138] 2) Use a dropper to draw up 2-3 drops of urine and add them to the sample well S of the test card;

[0139] 3) 10 minutes after adding the sample, interpret the results according to the following standards:

[0140] a) Positive: A red band appears in both the test area (T) and the quality control area (C);

[0141] b) Negative: Only one red band appears in the control area (C), and no red band appears in the test area (T);

[0142] c) Invalid: No red stripes appear in both the quality control area (C) and the test area (T), or only one red stripe appears in the test area (T), indicating that the test is invalid and a new test card should be used for retesting.

[0143] The test results are shown in Table 4:

[0144] Table 4

[0145]

[0146]

[0147]

[0148]

[0149]

[0150]

[0151]

[0152]

[0153]

[0154]

[0155]

[0156] The above results show that the performance indicators of SNCG in the screening of urinary system diseases are as follows: the specificity of normal people in 400 samples is 98%, the sensitivity in 100 kidney stone samples is 73%, the sensitivity in 100 ureteral stone samples is 65%, the sensitivity in 100 prostate hyperplasia samples is 57%, and the sensitivity in 100 bladder cancer samples is 75%. It can be seen that SNCG has a certain detection ability in urinary system diseases. The disadvantage of this detection method is that it cannot distinguish between disease and cancer. Therefore, in order to further distinguish between disease and cancer, we combined PCR fluorescent probe method for precise screening.

[0157] Example 3 Screening of markers

[0158] 1) Sample collection: Download 450k methylation chip cancer tissue data from TCGA, involving 7769 cancer tissue samples of 26 tumors, including adrenocortical carcinoma (80), bladder cancer (412), acute myeloid leukemia (140), low-grade glioma (654), breast cancer (740), cervical cancer (286), colorectal cancer (348), esophageal cancer (183), uveal melanoma (80), head and neck squamous cell carcinoma (52 7), renal cancer (660), liver cancer (377), lung adenocarcinoma (425), lung squamous cell carcinoma (372), diffuse large B-cell lymphoma (29), ovarian serous cystadenocarcinoma (10), pancreatic cancer (184), mesothelioma (116), prostate cancer (488), skin melanoma (104), sarcoma (117), gastric cancer (397), testicular cancer (134), thymic cancer (94), thyroid cancer (506), endometrial cancer (309). For healthy people, the applicant collected urine from 38 healthy people and then performed whole genome methylation sequencing (WGBS).

[0159] 2) Candidate marker screening: For healthy urine samples, the third quartile (Q3) of the probe β value corresponding to the 450k region of WGBS was calculated, also known as the "larger quartile", and sites with Q3 < 0.02 were screened, and the result was List 1. For 450K chip tissue data, the first quartile (Q1) of each probe β value corresponding to the 450K region was calculated, Q1 is also known as the "smaller quartile", and sites with Q1 > 0.1 were screened, and the result was List 2. The intersection of List 1 and List 2 was taken to obtain 65,739 differentially methylated regions.

[0160] 3) Marker selection: 123 markers were obtained from the above markers. At the same time, the difference in methylation levels between bladder cancer (412) and adjacent tissues (21) in the TCGA 450k chip was required to be greater than 0.2, and 79 differentially methylated regions were finally obtained.

[0161] 4) Marker verification: Probe capture was designed for the above 79 differentially methylated regions, and the data of urine samples from Boercheng (number of urothelial carcinoma samples = 40, number of healthy samples = 38) were used for verification, and finally the differential intervals of VIM, TMEM220 and PPM1N genes were verified. According to the obtained target sequence region, a PCR probe composition was customized. The target sequences and related sequences of the VIM gene, TMEM220 gene, and PPM1N gene are shown in Table 1, the primers and probe sequences used are shown in Table 2, and the fluorescent labeling method of the probe sequence is shown in Table 3. The key PCR system is shown in Table 5.

[0162] Table 5

[0163] Volume (μl) Final concentration Taq DNA Polymerase(Biochain) 1 / 4.2×buffer(Biochain) 12 1× F(10μM) 1.0 200nM R(10μM) 1.0 200nM P(10μM) 1.0 200nM BisDNA 4.0 / H2O 20 / Total 40 /

[0164] Note: “F” stands for forward primer; “R” stands for reverse primer; “P” stands for probe.

[0165] Example 4 Methylation marker performance indicators

[0166] 97 urine samples of urothelial carcinoma and 329 control samples (urinary stones, urinary system inflammation, hyperplastic renal cancer, prostate cancer, endometrial cancer, prostate cancer, etc.) were selected, and genomic DNA was extracted. After conversion to BisDNA by bisulfite, methylation detection of VIM, TMEM220 and PPM1N genes was performed according to the PCR reaction system in Example 1. Finally, the CT values ​​of real-time PCR for the target sequence of the target gene of 426 samples were measured, and the results are shown in Table 6.

[0167] According to the PCR results, the critical values ​​of the Ct values ​​of the three genes are all selected as Ct=45, and the detection is positive when it is less than 45. The detection is negative when it is equal to 45. As shown in Tables 7-10, the sensitivity and specificity of the methylation level of the VIM gene detected by urine are 74.23% and 96.96%, respectively. The sensitivity and specificity of the methylation level of the TMEM220 gene are 52.58% and 99.09%, respectively. The sensitivity and specificity of the methylation level of the PPM1N gene detected by urine are 65.98% and 94.22%, respectively. The sensitivity and specificity of the three-gene joint detection (single positive is positive, three negatives are negative) are 90.72% and 92.10%, respectively.

[0168] Table 6: CT value detection results of VIM, TMEM220 and PPM1N genes in urothelial carcinoma samples and control samples

[0169]

[0170]

[0171]

[0172]

[0173]

[0174]

[0175]

[0176]

[0177]

[0178]

[0179]

[0180] Table 7: Detection results of VIM gene in urothelial carcinoma samples and control samples

[0181]

[0182] Table 8: Detection results of TMEM220 gene in urothelial carcinoma samples and control samples

[0183]

[0184] Table 9: Detection results of PPM1N gene in urothelial carcinoma samples and control samples

[0185]

[0186] Table 10: Detection results of the combined VIM, TMEM220, and PPM1N genes in urothelial carcinoma samples and control samples

[0187]

[0188] The above experimental results show that the methylated DNA of the target gene target sequence is a marker for urothelial carcinoma. Through the target gene target sequence methylated DNA detection of the present invention, urine (morning urine) can be used to achieve in vitro non-invasive detection of urothelial carcinoma, and can improve the detection rate of urinary malignancies (urothelial carcinoma).

[0189] Example 5 Combined detection of γ-synuclein (SNCG) detection kit for urinary system diseases (immunochromatography) and urothelial carcinoma gene methylation detection kit (PCR fluorescent probe method)

[0190] 200 samples (80 healthy people, 40 urinary stones, 40 hyperplasia, 40 bladder cancer, etc.) were selected and tested by both SNCG immunochromatographic detection kit and PCR fluorescent probe method. First, all samples were tested using SNCG immunochromatographic detection kit, and samples with positive SNCG test results were further tested using PCR fluorescent probe method.

[0191] Specifically, the SNCG immunochromatography detection kit is as described in Example 2, and the PCR fluorescent probe method is as described in Example 4.

[0192] Finally, the CT values ​​of the real-time PCR of the target gene sequence of 200 samples were measured. According to the PCR results, the critical values ​​of the Ct values ​​of the three genes were all selected as Ct=45, and the test was positive when it was less than 45, and negative when it was equal to 45.

[0193] The test results are shown in Table 11.

[0194] Table 11

[0195]

[0196]

[0197]

[0198]

[0199]

[0200]

[0201] According to the above data, the number of positive samples in 200 samples is shown in Table 12:

[0202] Table 12

[0203]

[0204] From the above data, it can be seen that the accuracy of the SNCG immunochromatography test kit in healthy people is 97.5%, and the accuracy rates in three urinary system diseases (stones, hyperplasia, and urothelial carcinoma) are 70%, 60%, and 77.5%, respectively. The overall accuracy rate can reach 80.50%, but this method cannot accurately distinguish between diseases and cancers, and can only screen out high-risk groups. In this case, 42.5% of the population was listed as a high-risk group and entered the downstream PCR test. The results of the urothelial PCR fluorescent probe method showed that the accuracy rate for healthy people was 100%, and the accuracy rates for urinary system diseases (stones, hyperplasia) were 96.43% and 91.67%, respectively, and the accuracy rate for urothelial carcinoma was 93.55%, and the overall accuracy rate could reach 94.11%, which can effectively distinguish benign diseases from cancer. At the same time, it is recommended that these 32 (37.65%) positive subjects go to the hospital for further examination and regular review.

[0205] Therefore, we proposed a systematic method for detecting urinary system diseases. First, the SNCG immunochromatographic test kit is used to screen a wide spectrum of urinary system diseases. The SNCG immunochromatographic test kit is currently simple to operate and can be used for home testing. For samples that test positive, patients should be alerted to do a good health check. If further confirmation is needed on whether cancer is present, the urothelial carcinoma gene methylation test kit can be used for further testing.

Claims

1. Use of SNCG immunochromatographic test strips and methylation detection compositions in the preparation of a kit for detecting urinary system diseases, The composition comprises: Nucleic acid used to detect the methylation status of the target gene, The methylation state of the target gene is characterized by the methylation of the target sequence of the target gene. The target genes are VIM gene, TMEM220 gene and PPM1N gene.

2. The use according to claim 1, wherein the target sequence of the VIM gene is as shown in any one of SEQ ID NOs: 1-4 or includes a sequence as shown in any one of SEQ ID NOs: 1-4.

3. The use according to claim 1, wherein the target sequence of the TMEM220 gene is as shown in any one of SEQ ID NOs: 5-8 or includes a sequence as shown in any one of SEQ ID NOs: 5-8. 4 . The use according to claim 1 , wherein the target sequence of the PPM1N gene is as shown in any one of SEQ ID NOs: 9-12 or comprises a sequence as shown in any one of SEQ ID NOs: 9-12.

5. The use according to any one of claims 1 to 4, wherein the nucleic acid for detecting the methylation status of the target gene comprises: A primer, wherein the primer is a fragment of at least 9 nucleotides in the target sequence of the target gene, The fragment comprises at least one CpG dinucleotide sequence.

6. The use according to any one of claims 1 to 5, wherein the nucleic acid for detecting the methylation status of the target gene comprises: A probe, wherein the probe is a fragment of at least 15 nucleotides that hybridizes to the target sequence of the target gene under moderately stringent or stringent conditions, The fragment comprises at least one CpG dinucleotide sequence.

7. The use according to any one of claims 1 to 6, wherein the composition further comprises: A reagent that converts unmethylated cytosine base at position 5 of the target sequence of the target gene into uracil.

8. The use according to any one of claims 1 to 7, wherein the nucleic acid for detecting the methylation status of the target gene further comprises: Blockers that preferentially bind to target sequences in their unmethylated state.

9. The use according to claim 5, wherein the fragment of at least 9 nucleotides is a sequence of SEQ ID NO: 13 and SEQ ID NO: 14, or a sequence of SEQ ID NO: 16 and SEQ ID NO: 17, or a sequence of SEQ ID NO: 19 and SEQ ID NO:

20.

10. The use according to claim 6, wherein the fragment of at least 15 nucleotides is a sequence of SEQ ID NO: 15, or a sequence of SEQ ID NO: 18, or a sequence of SEQ ID NO: 21.

Images