Method for evaluating survival competitive capacity of transgenic insect-resistant poplar and application

Abstract

The invention relates to a transgenic insect-resistant poplar survival competitive capacity evaluation method and application, and belongs to the technical field of transgenic poplar breeding and environmental safety evaluation. According to the characteristics of sexual and asexual propagation of poplar, transgenic insect-resistant poplar seeds and cutting slips are used as materials, the stability investigation of growth traits such as wasteland and cultivation land seed germination rate, cutting slip survival rate, plant height, ground diameter and the like and exogenous genes and the comparison of cutting slip storage modes are carried out, and a comprehensive evaluation method for the survival competitiveness of the transgenic insect-resistant poplar is established. Survival competitive capacity evaluation is an important part of transgenic organism safety evaluation, it is proved that transgenic poplar and non-transgenic poplar do not have the possibility of weed formation under wasteland conditions, and introduction of exogenous insect-resistant genes does not affect the survival competitive capacity of the poplar. The method solves the problem that there is no transgenic insect-resistant poplar survival competitive capacity evaluation method at present, and guarantees the safety evaluation of transgenic poplar organisms.

Description

Technical Field

[0001] The invention relates to a method for evaluating the survival competitiveness of transgenic insect-resistant poplars and its application, and belongs to the technical field of transgenic poplar breeding and environmental safety evaluation. Background Art

[0002] As an important ecological protection tree species, poplars play an important role in the construction of the "Three Norths" shelterbelts and national reserve forests. However, forest insect pests affect the growth of poplars and threaten the healthy development of forestry. In recent years, great progress has been made in the cultivation of transgenic and gene-edited poplars, especially transgenic insect-resistant poplars, which have entered the field test stage such as intermediate tests, environmental defense and production tests on a large scale. The cultivation of transgenic insect-resistant poplars is of great significance to reduce the pollution and economic losses caused by chemical control to the environment.

[0003] During the large-scale promotion and planting of transgenic insect-resistant poplars, their biosafety issues need to be paid special attention. The biosafety assessment of transgenic organisms includes the study of target traits, survival competitiveness, gene drift and biodiversity impacts. At present, related research mainly focuses on annual crops such as cotton, rice and corn. Poplars have a long growth cycle and exist in the ecosystem for a long time. At present, the biosafety assessment of perennial poplars mainly focuses on the stability of target traits, gene escape and the impact on non-target organisms. Functional evaluation of the survival competitiveness of forest trees has not yet been carried out.

[0004] Survival competitiveness refers to the ability of individuals of the same or different species to compete for survival resources under certain conditions to maintain individual survival and racial reproduction. It is an important stage in the promotion and application of transgenic plants. At present, the evaluation of crop survival competitiveness mainly focuses on the possibility of seeds becoming weeds in wasteland and cultivated land and their survival competitiveness. However, poplars are perennial tall trees with a wide range of ecological adaptability and a prominent position in the ecosystem. They also have sexual and asexual reproduction characteristics. At present, the functional evaluation of the survival competitiveness of transgenic poplars has not been carried out.

[0005] Therefore, it is urgent to provide a method and application for evaluating the survival competitiveness of transgenic insect-resistant poplars, comprehensively consider the key characteristics of poplar sexual reproduction, asexual reproduction characteristics and storage methods of asexual reproduction cuttings during large-scale propagation during industrialization, simulate the natural growth environment of transgenic poplars, comprehensively evaluate the survival competitiveness of transgenic and non-transgenic poplars, and provide guidance for the evaluation of survival competitiveness and ecological adaptability of transgenic insect-resistant poplars. This has become a technical problem that needs to be solved in this technical field. Summary of the invention

[0006] The technical problem to be solved by the present invention is the lack of a method for evaluating the survival competitiveness of transgenic insect-resistant poplars. The present invention provides a method for evaluating the survival competitiveness of transgenic poplars. The method utilizes the sexual and asexual reproduction characteristics of poplars and uses transgenic insect-resistant poplar seeds and cuttings obtained by artificial or natural hybridization as breeding materials to carry out survival competitiveness evaluation on wasteland and cultivated land.

[0007] To achieve the above object, the present invention provides the following technical solutions:

[0008] A method for evaluating the survival competitiveness of transgenic insect-resistant poplars comprises the following steps:

[0009] S1: Evaluation of survival competitiveness between seed barren land and cultivated land

[0010] Using transgenic insect-resistant poplars and non-transgenic poplars as materials, after artificial controlled pollination, female flower branches were collected, and after the capsules dried and cracked, seeds were collected to evaluate the survival competitiveness of seeds in wasteland and cultivated land;

[0011] S2: Evaluation of survival competitiveness of wasteland and cultivated land

[0012] Poplar varieties are mainly propagated by cuttings, which is the most widely used asexual propagation method in poplar production. Taking advantage of the asexual propagation characteristics of poplars, genetically modified insect-resistant poplars and non-genetically modified poplar cuttings are used as propagators to evaluate the survival competitiveness of wasteland and cultivated land.

[0013] S3: PCR identification of exogenous Bt genes

[0014] DNA was extracted from leaves of transgenic insect-resistant poplars and non-transgenic poplars, and PCR was used to identify whether the exogenous Bt gene was stable.

[0015] S4: Evaluation of the natural continuity of transgenic insect-resistant poplars and non-transgenic poplar cuttings

[0016] Underground burial is a common way to preserve cuttings. The natural continuation ability of genetically modified insect-resistant poplar and non-genetically modified poplar cuttings was evaluated by setting up shallow burial (30 cm) and deep burial (60 cm). The cuttings were put into 150-mesh nylon bags and buried in the soil. After 60 days of treatment, the cuttings were taken out and counted to see whether they rotted, whether the cut ends were healed, and whether the buds germinated. The survival rate of the cuttings was also counted, and variance statistical analysis was performed on them.

[0017] Through the above experiments and result analysis, the present invention clarifies that the introduction of exogenous genes does not change the survival competitiveness of poplars during sexual and asexual reproduction, and establishes a method for evaluating the survival competitiveness of transgenic insect-resistant poplars.

[0018] Preferably, the specific process of S1 is as follows:

[0019] The evaluation of seed survival competitiveness involved wasteland and cultivated land. Three blocks were set up respectively, and 300 seeds were sown in each block. Among them, the cultivated land was covered with film, and the germination rate was counted. The survival rate was investigated after 7 days. The area of ​​each block was 2m×2m=4m 2 .

[0020] Preferably, the specific process of S2 is as follows:

[0021] The wasteland refers to the land that is not tilled and fertilized before cutting, and no field management such as weeding and bud removal during the seedling stage is carried out in the later stage, and only watering is carried out; the cultivated land is tilled before cutting, and normal field management such as weeding, watering, and bud removal during the seedling stage is carried out; the area of ​​the plot is 6m×8m=48m 2 .

[0022] Preferably, the wasteland in S1 and S2 is land that has been idle for one year and on which no poplars are planted, which is not tilled before sowing or cutting and which is only watered in the later stage without any field management such as mulching, weeding, and fertilization.

[0023] Preferably, the cultivation land in S1 and S2 is tilled and subjected to normal field management.

[0024] Preferably, in S1, transgenic insect-resistant poplar and non-transgenic poplar seeds are evenly sown on the land and covered with 4-5 mm thick sieved fine soil, the cultivated land is covered with film, watered, and weeded, and no management is performed on the wasteland.

[0025] Preferably, in S2, the diameter of the transgenic insect-resistant poplar and non-transgenic poplar cuttings is 0.8-1.5 cm, the length is 13-15 cm, with 1-2 buds, the cutting time is from March 20 to April 5, and the plant spacing is 30 cm×50 cm.

[0026] Preferably, the specific steps of S3 are as follows: extract DNA using the CTAB method, amplify with specific primers, the reaction system is 20 μL, the reaction program is 95°C 5min, 95°C 30s, 57°C 30s, 72°C 30s (35 cycles), 72°C 7min, the PCR product is 275bp, wherein the forward primer sequence (5'-3') is: GAATTCGCTAGGAACCAAGCCATT; the reverse primer sequence (5'-3') is AAGTATATCCATCAAATGTGGACT.

[0027] Another object of the present invention is to provide an application of a method for evaluating the survival competitiveness of transgenic insect-resistant poplars.

[0028] The above object of the present invention is achieved through the following technical solutions:

[0029] The survival competitive ability evaluation method of transgenic insect-resistant poplars is used to evaluate the survival competitive ability of transgenic insect-resistant poplars.

[0030] Compared with the prior art, the present invention has the following beneficial effects:

[0031] The method for evaluating the survival competitiveness of transgenic insect-resistant poplars of the present invention has no obvious difference in the survival competitiveness between transgenic insect-resistant poplars and non-transgenic poplars under the conditions of wasteland and cultivated land; the present invention comprehensively considers the key characteristics of poplar sexual reproduction, asexual reproduction characteristics and the storage method of asexual reproduction cuttings during large-scale propagation in the industrialization process, simulates the natural growth environment of transgenic poplars, and comprehensively evaluates the survival competitiveness of transgenic insect-resistant poplars and non-transgenic poplars, providing guidance for the evaluation of the survival competitiveness and ecological adaptability of transgenic insect-resistant poplars.

[0032] The present invention is further described below through the accompanying drawings and specific embodiments, but it is not intended to limit the protection scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 This is the wasteland growth environment of the BtCry1Ac insect-resistant poplar and non-transgenic poplar cuttings transferred in Example 1 of the present invention.

[0034] Figure 2 This is the growth environment of the BtCry1Ac insect-resistant poplar and non-transgenic poplar cuttings cultivation site in Example 1 of the present invention.

[0035] Figure 3 This is the type and abundance of weeds in the BtCry1Ac insect-resistant poplar and non-transgenic poplar cuttings transferred in Example 1 of the present invention.

[0036] Figure 4 The plant heights of the BtCry1Ac insect-resistant poplar and the non-transgenic poplar under the conditions of the cuttings cultivation field in Example 1 of the present invention. ns means no significant difference in the T-test.

[0037] Figure 5 The diameters of the BtCry1Ac insect-resistant poplar and the non-transgenic poplar cuttings under field conditions in Example 1 of the present invention. ns means no significant difference in T-test.

[0038] Figure 6 This is the PCR specific identification of BtCry1Ac-transgenic poplars and non-transgenic poplars in Example 1 of the present invention.

[0039] Figure 7 This is the phenotype of BtCry1Ac insect-resistant poplar and non-transgenic poplar cuttings after shallow burial storage in Example 1 of the present invention.

[0040] Figure 8 This is the phenotype of BtCry1Ac insect-resistant poplar and non-transgenic poplar cuttings after deep burial storage in Example 1 of the present invention.

[0041] Fig. 9 The rooting of the BtCry1Ac insect-resistant poplar and non-transgenic poplar cuttings after shallow burial storage in Example 1 of the present invention. ns means no significant difference in T-test.

[0042] Fig.10 The rooting of the BtCry1Ac-transgenic poplar and non-transgenic poplar cuttings after deep burial storage in Example 1 of the present invention. ns means no significant difference in T-test. DETAILED DESCRIPTION

[0043] The present invention is further described below in conjunction with specific embodiments, which are not described in detail in the following embodiments. It should be understood that the following text is only used to describe one or several specific implementations of the present application, and does not strictly limit the scope of protection of the specific requests of the present application. In the absence of conflict, the embodiments in the present application and the features in the embodiments can be combined with each other.

[0044] Example 1

[0045] A method for evaluating the survival competitiveness of transgenic insect-resistant poplars, comprising the following steps:

[0046] 1 Experimental Materials and Methods

[0047] 1.1 Experimental Materials

[0048] The transgenic BtCry1Ac insect-resistant poplars (Linji Xuzhun

[2023] No. 22) and non-transgenic poplars that have entered the environmental release and production test stage with the administrative permission of the State Forestry and Grassland Administration were used as test materials, and their seeds and cuttings were used to investigate the survival competitiveness. In spring, healthy and undamaged one-year-old transgenic BtCry1Ac insect-resistant poplars and non-transgenic poplar branches with a diameter of 0.8-1.5 cm were selected and pruned into cuttings with a length of 15-18 cm and 1-2 buds preserved 1 cm from the top;

[0049] 1.2 Evaluation of the survival competitiveness of BtCry1Ac-transgenic and non-transgenic poplar seeds

[0050] The experimental land is divided into wasteland and cultivated land, such as Figure 1 As shown, this is the wasteland growth environment of the BtCry1Ac insect-resistant poplar and the non-transgenic poplar cuttings in Example 1 of the present invention; Figure 2As shown, it is the growth environment of the BtCry1Ac insect-resistant poplar and non-transgenic poplar cuttings cultivation site in Example 1 of the present invention; the wasteland is the land that has been idle for 1 year and has not been planted, and has not been tilled before sowing, and no field management such as film covering, weeding, and fertilization is performed in the later stage; the cultivation land is tilled and covered with plastic film, and 3 blocks are set, 300 hybrid seeds are sown in each block, and the germination rate and survival rate are investigated and the significance analysis is performed;

[0051] 1.3 Evaluation of the survival competitiveness of BtCry1Ac-transgenic and non-transgenic poplar cuttings

[0052] The experimental land is divided into wasteland and cultivated land, such as Figure 1 As shown, this is the wasteland growth environment of the BtCry1Ac insect-resistant poplar and the non-transgenic poplar cuttings in Example 1 of the present invention; Figure 2 As shown in the figure, it is the growth environment of the BtCry1Ac insect-resistant poplar and non-transgenic poplar cuttings cultivation site in Example 1 of the present invention; the wasteland is the land that has been idle for one year without planting poplars, and it is not tilled before cutting, and only watered in the later stage, without weeding, fertilization, plant bud removal and other field management; the cultivation land is tilled before cutting, and normal weeding, watering, plant bud removal and other field management are carried out in the later stage; before the cutting test, the BtCry1Ac insect-resistant poplar and non-transgenic poplar cuttings are soaked in water for 1 to 2 days to improve the survival rate, the plant spacing and row spacing are 30 cm and 50 cm respectively, and 50 cuttings are taken from each; in July, the growth and development phenotypic traits such as weed coverage, type, plant survival rate, plant height, and ground diameter are investigated; as shown in the figure Figure 3 As shown, the weed species and abundance of BtCry1Ac-transgenic poplar and non-transgenic poplar in Example 1 of the present invention;

[0053] 1.4 Identification of insect-resistant poplars transformed with BtCry1Ac

[0054] The leaves of BtCry1Ac-transgenic poplars and non-transgenic poplars after cutting propagation were used as experimental materials. DNA was extracted by CTAB method and amplified with specific primers. The reaction system was 20 μL. The reaction procedure was 95℃5min, 95℃30s, 57℃30s, 72℃30s (35 cycles), 72℃7min. The PCR product was 275 bp. The forward primer sequence (5'-3') was: GAATTCGCTAGGAACCAAGCCATT; the reverse primer sequence (5'-3') was AAGTATATCCATCAAATGTGGACT;

[0055] 1.5 Evaluation of the natural continuation ability of cuttings

[0056] The cuttings of BtCry1Ac-transgenic poplar and non-transgenic poplar were used as experimental materials. They were placed in 150-mesh nylon bags and buried shallowly (30 cm) and deeply (60 cm) in spring. The cuttings were counted to see if they rotted, whether the cut ends were wounded, whether the buds fell off and germinated, and the survival rate of the cuttings was counted to see if the introduction of exogenous genes would affect the storage method of poplar.

[0057] 2 Results and analysis

[0058] 2.1 Evaluation of seed survival competitiveness between wasteland and cultivated land

[0059] Using BtCry1Ac insect-resistant poplar and non-transgenic poplar seeds as materials, 4 days after sowing in wasteland, the germination rates of BtCry1Ac insect-resistant poplar and non-transgenic poplar were 6.00% and 5.84%, respectively, and the germination rates in cultivated land were 37.50% and 37.00%, respectively. After 7 days of germination, without watering, the survival rate of transgenic and non-transgenic seeds in wasteland and cultivated land was 0.00% (Table 1).

[0060] Table 1 Survival rate of transgenic and non-transgenic seeds in wasteland and cultivated land

[0061]

[0062] 2.2 Evaluation of the competitiveness of cuttings in wasteland and cultivated land

[0063] After 15 days of cutting, the BtCry1Ac insect-resistant poplars and non-transgenic poplars in wasteland and cultivated land could germinate, expand leaves and grow normally. In July, the weed coverage in the wasteland transgenic poplar and non-transgenic poplar plots was 100%, including species of Gramineae (dogtail grass, goosegrass, teff, crabgrass), Amaranthaceae (purslane, amaranth, gray vegetable), Malvaceae (abutilon), Convolvulaceae (white morning glory, purple morning glory), Euphorbiaceae (Amaranthus ferox), Solanaceae (Solanum nigrum), Asteraceae (small sedge), etc. Figure 1 , Figure 2 , Figure 3 ), weeds severely restricted the survival of poplars, and the survival rate of poplars was 0. The results showed that transgenic poplars had no risk of weeding as did non-transgenic poplars; BtCry1Ac-transgenic poplars and non-transgenic poplars could grow normally in the cultivation field, with the survival rate of BtCry1Ac-transgenic poplars being 92.00% and that of non-transgenic poplars being 93.34%. The average plant height and ground diameter of transgenic insect-resistant poplars were 116.87 cm and 10.87 mm, respectively, with no significant difference from the non-transgenic controls; Figure 4 As shown, the plant heights of the BtCry1Ac insect-resistant poplar and the non-transgenic poplar cuttings under the cultivation conditions in Example 1 of the present invention, ns means that there is no significant difference in the T-test test; Figure 5As shown, the ground diameter of the BtCry1Ac insect-resistant poplar and the non-transgenic poplar cuttings under the cultivation field conditions in Example 1 of the present invention, ns represents the T-test test without significant difference; through PCR identification of the BtCry1Ac insect-resistant poplar and the non-transgenic poplar, the amplified length of the BtCry1Ac insect-resistant poplar was 275bp, and the non-transgenic poplar had no band; Figure 6 As shown, the PCR specific identification of BtCry1Ac-transgenic poplars and non-transgenic poplars in Example 1 of the present invention.

[0064] 2.3 Evaluation of natural continuity capability

[0065] Using transgenic and non-transgenic poplar cuttings as materials, 8-10% of the BtCry1Ac insect-resistant poplar and non-transgenic poplar cuttings were rotten after shallow and deep burial for 60 days, and a large amount of callus tissue was formed at the cut ends of most of them. The buds sprouted and turned yellow, showing activity, such as Figure 7 As shown, the phenotypes of BtCry1Ac insect-resistant poplar and non-transgenic poplar cuttings after shallow burial storage in Example 1 of the present invention; Figure 8 As shown, the phenotypes of BtCry1Ac-transgenic poplar and non-transgenic poplar cuttings after deep burial storage in Example 1 of the present invention; the rooting rates of BtCry1Ac-transgenic poplar and non-transgenic poplar after shallow burial cuttings were 21.34% and 22.00%, respectively. Fig. 9 As shown, the rooting rate of the BtCry1Ac-transgenic poplar and the non-transgenic poplar cuttings after shallow burial storage in Example 1 of the present invention is 35.34% and 36.67%, respectively. Fig.10 As shown, the rooting of the BtCry1Ac insect-resistant poplar and non-transgenic poplar cuttings after deep burial storage in Example 1 of the present invention, ns means there is no significant difference in the T-test.

[0066] From the above process, it can be concluded that the introduction of exogenous BtCry1Ac gene has no effect on the survival competition and natural continuation of poplar seeds and cuttings; the survival competition ability evaluation method of transgenic insect-resistant poplars of the present invention can be widely applied to the survival competition ability evaluation process of transgenic poplars with insect resistance and other traits.

[0067] The present invention utilizes the characteristics of sexual and asexual reproduction of poplars and uses transgenic insect-resistant poplar seeds and cuttings as materials to carry out investigations on growth traits such as seed germination rate, cutting survival rate, plant height, ground diameter and stability of exogenous genes in wasteland and cultivated land, compares the storage methods of cuttings, and establishes a comprehensive evaluation method for the survival competitiveness of transgenic insect-resistant poplars. The survival competitiveness evaluation is an important part of the safety evaluation of transgenic organisms. The present invention proves that transgenic and non-transgenic poplars have no possibility of weeding under wasteland conditions, and the introduction of exogenous insect-resistant genes does not affect the survival competitiveness of poplars themselves, which solves the problem that there is no survival competitiveness evaluation method for transgenic insect-resistant poplars at present, and plays a role in protecting the biosafety evaluation of transgenic poplars.

[0068] Although the purpose, concept and embodiments of the present invention have been described in detail above, a person skilled in the art will recognize that various improvements and modifications may be made to the present invention without departing from the scope of the claims, and such improvements and modifications shall still fall within the scope of protection of the present invention.

Claims

1. A method for evaluating the survival competitiveness of transgenic insect-resistant poplars, comprising the following steps: S1: Evaluation of survival competitiveness between seed barren land and cultivated land Using transgenic insect-resistant poplars and non-transgenic poplars as materials, female flower branches were collected after artificial and natural pollination, and seeds were collected after the capsules dried and cracked, and the survival competitiveness of seeds in wasteland and cultivated land was evaluated; S2: Evaluation of survival competitiveness of wasteland and cultivated land Poplar varieties are mainly propagated by cuttings, which is the most widely used asexual propagation method in poplar production. Taking advantage of the asexual propagation characteristics of poplars, genetically modified insect-resistant poplars and non-genetically modified poplar cuttings are used as propagators to evaluate the survival competitiveness of wasteland and cultivated land. S3: PCR identification of exogenous Bt genes DNA was extracted from leaves of transgenic insect-resistant poplars and non-transgenic poplars, and PCR was used to identify whether the exogenous Bt gene existed stably. S4: Evaluation of the natural continuity of transgenic insect-resistant poplars and non-transgenic poplar cuttings Underground burial is a common way to preserve cuttings. The natural continuation ability of genetically modified insect-resistant poplar and non-genetically modified poplar cuttings was evaluated by setting shallow burial and deep burial. The cuttings were put into 150-mesh nylon bags and buried in the soil. After 60 days of treatment, the cuttings were taken out and counted to see whether they rotted, whether the cut ends were healed, and whether the buds germinated. The survival rate of the cuttings was calculated and variance statistical analysis was performed.

2. The method for evaluating the survival competitiveness of transgenic insect-resistant poplars according to claim 1, characterized in that: The specific process of S1 is as follows: The evaluation of seed survival competitiveness involved wasteland and cultivated land. Three blocks were set up respectively, and 300 seeds were sown in each block. Among them, the cultivated land was covered with film, and the germination rate was counted. The survival rate was investigated after 7 days. The area of ​​each block was 2m×2m=4m 2 .

3. The method for evaluating the survival competitiveness of transgenic insect-resistant poplars according to claim 2, characterized in that: The specific process of S2 is as follows: The wasteland refers to the land that is not tilled and fertilized before cutting, and no field management such as weeding and bud removal during the seedling stage is carried out in the later stage, and only watering is carried out; the cultivated land is tilled before cutting, and normal field management such as weeding, watering, and bud removal during the seedling stage is carried out; the area of ​​the plot is 6m×8m=48m 2 .

4. The method for evaluating the survival competitiveness of transgenic insect-resistant poplars according to claim 3, characterized in that: The wasteland in S1 and S2 was the land that had been idle for one year and on which no poplar trees were planted. The land was not tilled before sowing or cutting and was only watered in the later stage without any field management such as mulching, weeding and fertilization.

5. The method for evaluating the survival competitiveness of transgenic insect-resistant poplars according to claim 4, characterized in that: The cultivation fields in S1 and S2 were tilled and subjected to normal field management.

6. The method for evaluating the survival competitiveness of transgenic insect-resistant poplars according to claim 5, characterized in that: In S1, transgenic insect-resistant poplar and non-transgenic poplar seeds were evenly sown on the land and covered with 4-5 mm thick sieved fine soil. The cultivated land was covered with film, watered, and weeded, while the wasteland was not managed in any way.

7. The method for evaluating the survival competitiveness of transgenic insect-resistant poplars according to claim 6, characterized in that: In S2, the diameter of the cuttings of transgenic insect-resistant poplar and non-transgenic poplar was 0.8-1.5 cm, the length was 13-15 cm, with 1-2 buds, the cutting time was from March 20 to April 5, and the plant spacing was 30 cm × 50 cm.

8. The method for evaluating the survival competitiveness of transgenic insect-resistant poplars according to claim 7, characterized in that: The specific steps of S3 are as follows: DNA is extracted using the CTAB method and amplified with specific primers. The reaction system is 20 μL and the reaction procedure is 95°C for 5 min, 95°C for 30 s, 57°C for 30 s, 72°C for 30 s, and 72°C for 7 min. The PCR product is 275 bp, among which the forward primer sequence (5'-3') is: GAATTCGCTAGGAACCAAGCCATT; the reverse primer sequence (5'-3') is AAGTATATCCATCAAATGTGGACT.

9. Use of the method for evaluating the survival competitiveness of transgenic insect-resistant poplars according to any one of claims 1 to 8 in evaluating the survival competitiveness of transgenic insect-resistant poplars.

Images