Methods for providing mitigation for lactose-induced abdominal discomfort

Abstract

The present invention relates to a strain of Lactobacillus salivarius for providing alleviation or prevention of lactose-induced abdominal discomfort; digesting lactose or improving digestion of lactose; when a product containing lactose is eaten, digestion comfort is provided after lactose digestion; and / or provides persistent support and / or effect for lactose digestion. The invention also relates to the use of a strain of Lactobacillus salivarius or a composition comprising the same for providing alleviation or prevention of lactose-induced abdominal discomfort; digesting lactose or improving digestion of lactose; when a product containing lactose is eaten, digestion comfort is provided after lactose digestion; and / or provides long-lasting support and / or action for lactose digestion of people with lactose intolerance.

Description

[0001] References to sequence listings

[0002] This application contains a sequence listing in computer readable form. This computer readable form is incorporated herein by reference.

[0003] References to deposits of biological material

[0004] This application contains references to a deposit of biological material, which is incorporated herein by reference. For complete information, see the last paragraph of the specification. Technical Field

[0005] The present invention relates to a method for providing relief from or preventing abdominal discomfort induced by lactose; digesting lactose or improving the digestion of lactose; providing digestive comfort after lactose digestion when consuming a product containing lactose; and / or providing sustained support and / or effect for lactose digestion in a subject. The present invention particularly relates to a method for providing relief from or preventing abdominal discomfort induced by lactose; digesting lactose or improving the digestion of lactose; providing digestive comfort after lactose digestion when consuming a product containing lactose; and / or providing sustained support and / or effect for lactose digestion by providing one or more strains of Ligilactobacillus salivarius or a composition comprising one or more strains of Lactobacillus salivarius to a subject. Background Art

[0006] Due to lactose, a considerable number of people experience abdominal discomfort when consuming dairy products. Intestinal lactase expression is high at birth, but begins to gradually decline with age after weaning, thus eventually reducing the ability to digest dietary lactose. This inability to digest lactose in the small intestine is known as lactose malabsorption (LM). The presence of malabsorbed lactose in the colon does not necessarily lead to gastrointestinal symptoms, but when this condition is associated with uncomfortable manifestations such as bloating, abdominal pain, and diarrhea, this leads to lactose intolerance. Up to 50% of lactose malabsorption patients show symptoms of lactose intolerance ('Effect of exogenous beta-galactosidase in patients with lactose malabsorption and intolerance: a crossover double-blind placebo-controlled study' Eur J Clin Nutr 2005, 59(4): 489-493, Montalto M et al. and 'Enzyme replacement therapy for primary adult lactase deficiency. Effective reduction of lactose malabsorption and milk intolerance by direct addition of beta-galactosidase to milk atmealtime [Enzyme replacement therapy for primary adult lactase deficiency. Effective reduction of lactose malabsorption and milk intolerance by adding β-galactosidase directly to milk at mealtime]', Gastroenterology 1984, 87(5): 1072-1082, Rosado JL et al.). The intensity of these gastrointestinal symptoms varies significantly depending on the degree of lactase deficiency and the presence of other gastrointestinal disturbances.

[0007] As a standard practice, individuals who present symptoms of lactose intolerance avoid dairy and milk-containing products. Avoiding milk and dairy products leads to decreased calcium intake and therefore weakened bones, significantly affecting quality of life. One way to manage lactose intolerance is to supplement with exogenously produced lactase as an enzyme replacement or to ingest specialized probiotics that aid lactose digestion due to their β-galactosidase activity ('A combination of acid lactase from Aspergillus oryzae and yogurt bacteria improves lactose digestion in lactose mal-digesters synergistically: A randomized, controlled, double-blind cross-overtrial' Clin Nutr 2015, 34(3): 394-399, de Vrese M et al., and 'The effect of oral supplementation with Lactobacillus reuteri or tilactase in lactose intolerant patients: randomized trial' Eur Rev Med Pharmacol Sci [European Review of Medicine and Pharmacology] 2010, 14 (3): 163-170, Ojetti V et al.). A variety of lactase supplements or probiotics are available in the commercial space. WO08001676A1 describes lactic acid bacteria for use as probiotics for individuals with lactose intolerance as a therapy to improve lactose intolerance. US2012308524 relates to the use of a composition comprising Lactobacillus delbrueckii in the treatment of lactose intolerance or conditions caused by lactase deficiency. Some lactic acid bacteria used as probiotics in the treatment of lactose intolerance produce gas, require other sugar sources and lactose to grow in the intestine, and / or cannot survive for long periods of time in the small intestine. Probiotics alleviate gastrointestinal symptoms from smaller lactose loads while presenting challenges associated with providing relief for larger dairy consumption.

[0008] Although commercially available lactase has been successful to some extent in managing lactose intolerance, consumers still suffer from the side effects of exogenous lactase and additional practical negative effects, such as the need to adjust the lactase dosage in each meal or dairy consumption. Few other approaches exist, such as microbiome remodeling, such as galacto-oligosaccharides (GOS) approaches to enhance the lactose digestion capacity of the intestinal flora, but these approaches have limited benefits and do not provide complete relief for abdominal discomfort.

[0009] Therefore, there is a need to provide relief from lactose-induced abdominal discomfort over an extended period of time in situations where multiple or large amounts of dairy are consumed in a day. Summary of the invention

[0010] The present invention relates to the use of one or more Lactobacillus salivarius strains or compositions comprising the same for providing relief from or preventing lactose-induced abdominal discomfort; digesting lactose or improving the digestion of lactose; providing digestive comfort after lactose digestion when consuming a lactose-containing product; and / or providing sustained support and / or effect to a subject's lactose digestion.

[0011] In one embodiment, the present invention is directed to an Associative Lactobacillus salivarius strain for use in providing relief from or preventing lactose-induced abdominal discomfort; digesting lactose or improving the digestion of lactose; providing digestive comfort after lactose digestion when consuming a lactose-containing product; and / or providing sustained support and / or effect to a subject's lactose digestion.

[0012] In another embodiment, the present invention is directed to a composition for providing relief from or preventing lactose-induced abdominal discomfort; digesting lactose or improving the digestion of lactose; providing digestive comfort after lactose digestion when consuming a lactose-containing product; and / or providing sustained support and / or effect to a subject's lactose digestion, the composition comprising one or more Lactobacillus salivarius strains and one or more lactase enzymes.

[0013] In yet another embodiment, the present invention is directed to a method for providing relief from or preventing lactose-induced abdominal discomfort; digesting lactose or improving the digestion of lactose; providing digestive comfort after lactose digestion when consuming a lactose-containing product; and / or providing sustained support and / or effect on lactose digestion in a subject, the method comprising providing to a subject in need thereof an effective amount of one or more Lactobacillus salivarius strains or a composition comprising one or more Lactobacillus salivarius strains.

[0014] Sequence Listing Overview

[0015] SEQ ID NO: 1 is the mature amino acid sequence of GH35 lactase isolated from Aspergillus candidus.

[0016] SEQ ID NO: 2 is the mature amino acid sequence of GH 2 lactase isolated from Bifidobacterium bifidum.

[0017] SEQ ID NO: 3 is the mature amino acid sequence of GH35 lactase isolated from Penicillium cremeogriseum.

[0018] SEQ ID NO: 4 is the mature amino acid sequence of GH35 lactase isolated from Aspergillus carneus.

[0019] SEQ ID NO: 5 is the mature amino acid sequence of GH35 lactase isolated from Aspergillus wentii.

[0020] SEQ ID NO: 6 is the mature amino acid sequence of GH35 lactase isolated from Rasamsonia byssochlamydoides.

[0021] SEQ ID NO: 7 is the mature amino acid sequence of GH35 lactase isolated from Aspergillus cervinus.

[0022] SEQ ID NO: 8 is the mature amino acid sequence of GH35 lactase isolated from Aspergillus oryzae.

[0023] SEQ ID NO: 9 is the mature amino acid sequence of GH 2 lactase isolated from Lactobacillus delbrueckii subsp. bulgaricus.

[0024] SEQ ID NO: 10 is the mature amino acid sequence of GH2 lactase isolated from Bifidobacterium bifidum.

[0025] SEQ ID NO: 11 is the mature amino acid sequence of GH2 lactase isolated from Kluyveromyces lactis.

[0026] SEQ ID NO: 12 is the mature amino acid sequence of GH2 lactase isolated from Niallia circulans. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] A more complete understanding of the invention may be obtained by referring to the detailed description and claims when considered in conjunction with the accompanying drawings.

[0028] Figure 1 The ability to metabolize lactose by bacterial species based on cell density and maximum growth rate is demonstrated, which is represented by various strains.

[0029] Figure 2 Strains that grew to high cell density on lactose (ΔOD600>0.7) and at higher maximum growth rates (maximum growth rate <5) are represented in the pie charts and tables.

[0030] Figure 3 A graph is presented showing that the vast majority of the tested Lactobacillus salivarius strains have excellent lactose metabolism, ie excellent cell density (ΔOD600>0.7) and maximum growth rate (maximum growth rate<5).

[0031] Figure 4 represents a graph demonstrating the superior growth kinetics of Lactobacillus salivarius on lactose as carbon source compared to L. plantarum.

[0032] Figure 5 A graph showing the effect of salivary fluid combined with Lactobacillus DSM 34078 on lactose-induced gas pressure reduction in human fecal slurry during fecal fermentation.

[0033] Figure 6 Represents a graph showing the effect of different salivary combined Lactobacillus strains on lactose-induced GAS reduction in human fecal slurry during fecal fermentation.

[0034] Figure 7 A graph showing the proliferation of Lactobacillus salivarius DSM34078 in fecal microbiota from four different stool donors.

[0035] Figure 8 Represents a graph showing the increase in relative abundance of Lactobacillus salivarius DSM34078 during fecal fermentation from three different feces donors.

[0036] Fig. 9 Flowchart representing the experimental design for repeated lactose stimulation.

[0037] Fig.10A graph showing the survival and proliferation of Lactobacillus salivarius DSM34078 in simulated intestinal conditions with repeated lactose stimulation.

[0038] definition

[0039] Unless otherwise defined, all terms (including technical and scientific terms) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs. It will be further understood that terms, such as those defined in commonly used dictionaries, should be interpreted as having a meaning consistent with their meaning in the context of the specification and the relevant art, and should not be interpreted in an idealized or overly formal sense unless explicitly defined herein. For the sake of brevity and / or clarity, well-known functions or structures may not be described in detail.

[0040] As used herein, the singular forms “a”, “an” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise.

[0041] Throughout this disclosure, unless the context requires otherwise, the words “comprise”, “comprises” and “comprising” will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or groups of steps or elements.

[0042] The term "consisting of is meant to include and be limited to whatever follows the phrase "consisting of." Thus, the phrase "consisting of" indicates that the listed elements are required or mandatory, and that other elements may not be present. The term "consisting essentially of" is meant to include any elements listed after the phrase, and is limited to other elements that do not interfere with or contribute to the activity or action specified in the disclosure of the listed elements. Thus, the phrase "consisting essentially of" indicates that the listed elements are required or mandatory, but other elements are optional and may or may not be present, depending on whether they substantially affect the activity or action of the listed elements.

[0043] As used herein, the term "abdominal discomfort" is an expression of discomfort felt in the abdomen, such as feeling abdominal pain, pain, cramping, nausea, irritation, bloating, diarrhea, gas, etc., or any other symptom associated with lactose intolerance, lactase deficiency and / or difficulty digesting lactose.

[0044] As used herein, the term "digestion" means breaking down or helping to break down food in the gastrointestinal tract into substances that can be absorbed and used by the body. For the purposes of the present invention, the term "digesting lactose" is breaking down lactose in the gastrointestinal tract into monosaccharides, glucose and galactose, wherein glucose is used as an energy source, and galactose can be used as a precursor for glycosylation of proteins and lipids. For the purposes of the present invention, the term "improving the digestion of lactose" refers to digesting lactose for subjects who have difficulty digesting lactose or have a lactase deficiency.

[0045] As used herein, the term "digestive comfort" means that lactose is absorbed from the gastrointestinal tract without causing any abdominal discomfort.

[0046] As used herein, the term "diarrhea" refers to a condition characterized by three or more loose or liquid stools per day, or more bowel movements than is normal for the person. Acute diarrhea is defined as an abnormally frequent discharge of semisolid or liquid fecal material from the intestines that lasts for less than 14 days.

[0047] As used herein, the term "constipation" refers to infrequent bowel movements, symptoms of which may include difficulty with bowel movements, straining with bowel movements, prolonged bowel movements, pain with bowel movements secondary to straining with bowel movements, abdominal pain, bloating, and / or a feeling of incomplete bowel movements.

[0048] As used herein, the term "abdominal bloating" is an expression for abdominal gas that causes a feeling of fullness or distension in the abdomen.

[0049] As used herein, the term "GH35 family" refers to a glycoside hydrolase family 35 comprising enzymes having β-galactosidase activity (EC 3.2.1.23). These β-galactosidases catalyze, for example, the hydrolysis of terminal non-reducing β-D-galactose residues in lactose (1,4-O-β-D-galactopyranosyl-D-glucose), oligosaccharides, glycolipids, and glycoproteins. GH35 β-galactosidases exhibit specificity for β-1,3-, β-1,6-, or β-1,4-galactosidic bonds and are most active under acidic conditions. Lactase belongs to the β-galactosidase family of enzymes.

[0050] As used herein, the term "GH2 family" refers to glycoside hydrolase family 2, which includes the enzyme glycoside hydrolase (EC 3.2.1). The GH2 family includes enzymes with several known activities, such as β-galactosidase (EC 3.2.1.23); β-mannosidase (EC 3.2.1.25); β-glucuronidase (EC 3.2.1.31). For the purposes of the present invention, the GH2 family includes enzymes with β-galactosidase (EC 3.2.1.23) activity. Lactase belongs to the β-galactosidase family of enzymes.

[0051] As used herein, the term "acid lactase" means a lactase having optimal activity and / or stability in the pH range between pH 3.5 and pH 5.0.

[0052] As used herein, the term "neutral lactase" refers to a lactase having optimal activity and / or stability in a pH range between pH 6 and pH 9, preferably between pH 7 and pH 8, more preferably between pH 6.5 and pH 7.5.

[0053] As used herein, the term "fungal lactase" means a lactase derived from a fungus, preferably derived from Aspergillus oryzae.

[0054] As used herein, the term "mature polypeptide" means a polypeptide in its mature form after N-terminal and / or C-terminal processing (eg, removal of a signal peptide).

[0055] As used herein, the term "Lactobacillus salivarius" describes a rod-shaped, Gram-positive bacterium. Lactobacillus salivarius was previously designated "Lactobacillus salivarius," a term that is still frequently used. "Ligilactobacillus salivarius" may be used interchangeably with "Lactobacillus salivarius" and "Lactobacillus salivarius."

[0056] As used herein, the term "maximum growth rate" is used to measure the growth rate of bacteria, which means a bacterial growth parameter calculated in milliospatial density per minute based on the inflection point of the slope of the exponential growth curve. For the purposes of the present invention, the maximum growth rate is used to identify lactobacillus strains that have a higher growth rate in the presence of lactose as the sole carbon source in the growth medium.

[0057] As used herein, "lactose medium" is a selective growth medium that has lactose as the carbon source and other essential nutrients required for bacterial growth.

[0058] As used herein, a "barometric measurement system" is a technique for measuring the barometric pressure in a closed container having a sensor for continuously measuring the barometric pressure during an observation period. The closed container may be a Hungate tube (originally used to culture anaerobic microorganisms) with a rubber diaphragm. For purposes of the present invention, the barometric measurement system is used to measure the amount of gas generated in a stool sample with and without a salivarius-associated Lactobacillus strain. The terms "barometric pressure development" and "gas generation" are used interchangeably herein.

[0059] As used herein, "ΔOD600" refers to a spectrometer method used to help estimate the concentration of bacteria or other cells or "cell number / volume" within a liquid sample, where OD600 refers to the 600 nanometer (nm) wavelength used to measure the optical density of a liquid sample. For purposes of the present invention,

[0060] ΔOD600 = (final OD600 with lactose as the main carbon source in the sample) - (final OD600 without lactose in the sample).

[0061] As used herein, the term "sequence identity" is the correlation between two amino acid sequences or between two nucleotide sequences. It is described by the parameter "sequence identity". For the purposes of the present invention, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J.Mol.Biol. [Journal of Molecular Biology] 48: 443-453) is used to determine the sequence identity between two amino acid sequences as the output of "longest identity", which is implemented in the Needle program of the EMBOSS software package (EMBOSS: The European Molecular Biology Open Software Suite [European Molecular Biology Open Software Suite], Rice et al., 2000, Trends Genet. [Genetics Trend] 16: 276-277) (preferably version 6.6.0 or later). The parameters used are a gap opening penalty of 10, a gap extension penalty of 0.5, and an EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix. In order for the Needle program to report the longest identity, the nobrief option must be specified on the command line. The output of the "longest identity" flagged by Needle is calculated as follows:

[0062] (number of identical residues x 100) / (alignment length - total number of gaps in the alignment)

[0063] For purposes of the present invention, the sequence identity between two polynucleotide sequences is determined as the output of "longest identity" using Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra), as implemented in the Needle program of EMBOSS software package (EMBOSS:The European Molecular Biology Open Software Suite [European Molecular Biology Open Software Suite], Rice et al., 2000, supra) (preferred 6.6.0 version or later). The parameters used are gap opening penalty 10, gap extension penalty 0.5 and EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix. In order to make the Needle program report the longest identity, it is necessary to specify the non-simplified (nobrief) option in the command line. The output of "longest identity" marked by Needle is calculated as follows:

[0064] (number of identical deoxyribonucleotides x 100) / (alignment length - total number of gaps in the alignment)

[0065] Although certain embodiments of the present disclosure will be described hereinafter with reference to embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the claims. DETAILED DESCRIPTION

[0066] The present invention relates to uses, strains, compositions and methods for providing relief from or preventing lactose-induced abdominal discomfort; digesting lactose or improving the digestion of lactose; providing digestive comfort after lactose digestion when consuming a product containing lactose; and / or providing sustained support and / or effect to a subject's lactose digestion.

[0067] The inventors have identified salivarius-associated Lactobacillus strains with the present invention, which do not produce gas after lactose digestion when provided to humans, can grow on lactose as a single carbon source at a very high rate and can survive in the gastrointestinal tract, particularly under small intestinal conditions. In some embodiments, salivarius-associated Lactobacillus is referred to as salivarius. The present invention provides salivarius-associated Lactobacillus strains, which alleviate the discomfort caused by people who are intolerant to lactose and / or people who have difficulty digesting lactose. The present invention provides salivarius-associated Lactobacillus strains, which prevent lactose-induced abdominal discomfort in people. In addition, the present invention provides salivarius-associated Lactobacillus strains, which digest lactose or improve the digestion of lactose in people who are intolerant to lactose, have difficulty digesting lactose and / or have a lack of lactase. The present invention provides salivarius-associated Lactobacillus strains, which provide digestive comfort by digesting lactose when eating products containing lactose. The present invention provides salivarius-associated Lactobacillus strains, which have lasting support and / or effect on the digestion of lactose in subjects.

[0068] In one embodiment of the present invention, one or more Lactobacillus salivarius strains are provided to humans in combination with one or more lactases. In order to provide relief for lactose-induced abdominal discomfort and multiple dairy consumption throughout the day over an extended period of time, the inventors unexpectedly identified one or more lactases capable of immediate lactose digestion and one or more Lactobacillus salivarius strains that effectively digest lactose have an extended effect. This dual action concept can be used to effectively solve the gastrointestinal symptoms associated with lactose intolerance by combining exogenous lactase with the endogenous lactase activity of the Lactobacillus salivarius strain in a dosage form. Therefore, one embodiment of the present invention encompasses a dosage form comprising one or more Lactobacillus salivarius strains and one or more lactases. When consumed, the combination of the exogenous lactase of the present invention and the Lactobacillus salivarius strain ensures that the consumer is protected from gastrointestinal symptoms within a few hours in repeated dairy consumption throughout the day. When the dosage form is consumed with a meal containing lactose, the lactase ensures that the incoming dietary lactose is immediately hydrolyzed, while on the other hand, the Lactobacillus salivarius strain of the present invention is able to further digest lactose on the day of additional lactose consumption. Thus, the mode of action of the combination provides consumers with protection from dietary lactose-induced gastrointestinal symptoms and manages lactose intolerance, thereby effectively improving quality of life. The present invention provides prolonged relief of lactose-induced abdominal discomfort in people who are affected by lactose and / or are lactose intolerant, have difficulty digesting lactose, and / or have a lactase deficiency.

[0069] Saliva combined with Lactobacillus strains

[0070] One or more salivarius lactobacillus strains of the present invention or for use in the present invention can be any salivarius lactobacillus strains that digest lactose. The digestion level can be determined, for example, by measuring the maximum growth rate of the salivarius lactobacillus strain on a lactose medium and / or by measuring the Δ OD600 value in the lactose medium. In one embodiment, when the salivarius lactobacillus strain of the present invention or for use in the present invention is grown on a lactose medium, the maximum growth rate of the salivarius lactobacillus strain in the lactose medium is at least 5.0 average optical densities / minute. In another or additional embodiment, the salivarius lactobacillus strain has a Δ OD600 value of at least 0.7 in a lactose medium. The lactose medium can, for example, be a yeast acetic acid lactose (YLA) medium. The composition of the YLA medium is listed in Table 1 below:

[0071] Table 1.

[0072] substance Gram / liter (g / L) Yeast Extract X A-Seed Peptone 25.0g α-Lactose monohydrate 20.0g Tween 80 1.0g Diammonium Hydrogen Citrate 2.0g Sodium acetate 5.0g Magnesium sulfate heptahydrate 0.1g Manganese(II) sulfate monohydrate 0.05g Dipotassium hydrogen phosphate 2.0g

[0073] In one embodiment, the Lactobacillus salivarius strain of the present invention or for use in the present invention survives in the gastrointestinal tract of a human. In one embodiment, the Lactobacillus salivarius strain survives in the gastrointestinal tract for at least 4 hours. In one embodiment, the Lactobacillus salivarius strain grows on lactose in vitro and / or in the gastrointestinal tract of a human. In another or additional embodiment, the Lactobacillus salivarius strain grows on lactose, preferably on lactose as the main carbon source, such as, for example, on lactose as the sole carbon source. In one embodiment, the Lactobacillus salivarius strain prefers to grow on lactose as a carbon source. The Lactobacillus salivarius strain 'prefers to grow on lactose' means that the Lactobacillus salivarius strain grows faster on lactose than other sugars, and the Lactobacillus salivarius strain breaks down lactose first compared to all other available sugar carbon sources. In one embodiment, the Lactobacillus salivarius strain according to the present invention or for use in the present invention reduces gas production of fecal material containing lactose in a gas pressure measurement system. In one embodiment, the Lactobacillus salivarius strain of the present invention or for use in the present invention reduces the gas pressure development of the microbial population by at least 20%. In another embodiment, the salivarius associated Lactobacillus strain of the present invention or for use in the present invention reduces the microbial population pressure development by up to 60%. In a preferred embodiment, the salivarius associated Lactobacillus strain of the present invention or for use in the present invention reduces the microbial population pressure development by at least 30%, such as at least 40% or at least 50%. In one embodiment, the salivarius associated Lactobacillus strain expresses one or more lactases. In another embodiment, the amount of lactase expressed by the salivarius associated Lactobacillus strain is measured in vitro based on the amount of lactose reduced from the lactose medium on which the salivarius associated Lactobacillus strain grows. In one embodiment, the amount of lactose reduced from the lactose medium is at least 30%, such as at least 40%, 50%, 60%, 70% or 75%.

[0074] In one embodiment of the present invention, the one or more Lactobacillus salivarius strains of the present invention and for the uses, methods and compositions of the present invention are Lactobacillus salivarius strains having the deposit number DSM 34078. In another embodiment of the present invention, the one or more Lactobacillus salivarius strains are Lactobacillus salivarius strains having all the identifying characteristics of the Lactobacillus salivarius strain having the deposit number DSM 34078 or mutants thereof.

[0075] Lactase

[0076] In one embodiment of the invention, the one or more lactases used in combination with one or more Lactobacillus salivarius strains belong to the GH35 family or the GH2 family. In one embodiment of the invention, the one or more lactases are acid lactases and / or neutral lactases. In one embodiment of the invention, the one or more lactases are fungal lactases.

[0077] In further embodiments, the one or more lactases are polypeptides selected from the group consisting of:

[0078] (a) a polypeptide having at least 80% sequence identity to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 12;

[0079] (b) a polypeptide derived from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 12 by having 1-30 alterations (e.g., substitutions, deletions and / or insertions) at one or more positions, for example 1 or 2 or 3 or 4 or 5 or 6 or 7 or 8 or 9 or 10 or 11 or 12 or 13 or 14 or 15 or 16 or 17 or 18 or 19 or 20 or 21 or 22 or 23 or 24 or 25 or 26 or 27 or 28 or 29 or 30 alterations, particularly substitutions;

[0080] (c) a polypeptide derived from the polypeptide of (a) or (b) wherein the N- and / or C-terminus has been extended by the addition of one or more amino acids, and

[0081] (d) A fragment of the polypeptide of (a), (b) or (c).

[0082] In another embodiment, the polypeptide has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the polypeptide sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11 or SEQ ID NO:12.

[0083] In a preferred embodiment of the present invention, the lactase is a polypeptide comprising, consisting essentially of, or consisting of SEQ ID NO: 1. In another preferred embodiment of the present invention, the lactase is a polypeptide comprising, consisting essentially of, or consisting of SEQ ID NO: 2.

[0084] In one embodiment, the polypeptide may have an N-terminal and / or C-terminal extension of one or more amino acids, such as 1-5 amino acids.

[0085] In one embodiment, the polypeptide is derived from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 12 by substitution, deletion or addition of one or more amino acids. In some embodiments, the polypeptide is a variant of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 12 comprising a substitution, deletion and / or insertion at one or more positions. In one embodiment, the number of amino acid substitutions, deletions and / or insertions introduced into the polypeptide of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 12 is up to 15, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15. The amino acid changes may be of a minor nature, i.e., conservative amino acid substitutions or insertions that do not significantly affect the folding and / or activity of the protein; small deletions, typically of 1-30 amino acids; a small amino or carboxyl terminal extension, such as an amino terminal methionine residue; a small linker peptide of up to 20-25 residues; or a small extension that facilitates purification by altering the net charge or another function, such as a polyhistidine stretch, an antigenic epitope or a binding module.

[0086] Composition

[0087] In one embodiment, the present invention relates to a composition for providing relief or prevention of abdominal discomfort induced by lactose; digesting lactose or improving the digestion of lactose; providing digestive comfort after lactose digestion when consuming products containing lactose; and / or providing lasting support and / or effect for the digestion of lactose in a subject, wherein the composition comprises one or more saliva-associated Lactobacillus strains. In another embodiment, the composition further comprises one or more lactases. In one embodiment of the composition, the dosage form of the composition can be a single dosage form. In one embodiment of the composition, the composition can be in a dosage form such as, but not limited to, capsules, powders, microcapsules, tablets, dragees, pellets, and granules. In one embodiment of the composition, the amount of one or more saliva-associated Lactobacillus strains in the composition is in the range of 1E+08 colony forming units (CFU) to 1E+11CFU. In another embodiment of the composition, the amount of one or more saliva-associated Lactobacillus strains in the composition is in the range of 1E+09 colony forming units (CFU) to 1E+11CFU.

[0088] In a preferred embodiment, the amount of the one or more Lactobacillus salivarius strains in the composition is about 1E+09 CFU. In an embodiment of the composition, the amount of the one or more lactases is at least 4500 Food Chemicals Codex (FCC) units. In a preferred embodiment, the amount of the one or more lactases is about 10000 FCC units.

[0089] In embodiments where the composition of the present invention comprises one or more lactases, the one or more lactases are immediately available for lactose decomposition in the gastrointestinal tract. The saliva-associated lactobacillus strain of the composition slowly releases lactase in the gastrointestinal tract, and the released lactase is available in the gastrointestinal tract all day. The lactase released by the saliva-associated lactobacillus strain can be used to decompose lactose consumed by the subject at any time throughout the day. In one embodiment of the composition, after consuming the composition, the one or more lactases of the composition immediately decompose the lactose consumed by the subject, and after consuming the composition, at least for a period of 4 hours, the one or more saliva-associated lactobacillus strains decompose the lactose consumed by the subject, preferably decomposing the lactose consumed by the subject all day. "Immediately" is understood here as lactase decomposing lactose once it contacts lactose. For example, if a subject consumes milk or any dairy product immediately after consuming a composition comprising one or more Lactobacillus salivarius strains and one or more lactases, the lactase in the composition breaks down lactose from the consumed milk or dairy product once it comes into contact with lactose, and the Lactobacillus salivarius strains break down lactose from the consumed milk or dairy product at any time throughout the day. In one embodiment, the one or more Lactobacillus salivarius strains break down lactose consumed by the subject for a period of at least up to 8 hours after consuming the composition. In another embodiment, the one or more Lactobacillus salivarius strains break down lactose consumed by the subject for a period of at least up to 12 hours after consuming the composition. In yet another embodiment, the one or more Lactobacillus salivarius strains break down lactose consumed by the subject for a period of at least up to 18 hours after consuming the composition. The composition can be provided to the subject 1, 2, or 3 times a day to provide relief or prevention of abdominal discomfort induced by lactose; digest lactose or improve digestion of lactose; provide digestive comfort after lactose digestion when consuming products containing lactose; and / or provide sustained support and / or effect for lactose digestion of the subject throughout the day. In one embodiment, the composition is provided to the subject twice a day to provide relief or prevention of abdominal discomfort induced by lactose; digest lactose or improve digestion of lactose; provide digestive comfort after lactose digestion when consuming products containing lactose; and / or provide sustained support and / or effect for lactose digestion of the subject throughout the day. In a preferred embodiment, the composition can be provided to the subject once a day to provide relief or prevention of abdominal discomfort induced by lactose; digest lactose or improve digestion of lactose; provide digestive comfort after lactose digestion when consuming products containing lactose; and / or provide sustained support and / or effect for lactose digestion of the subject throughout the day.

[0090] Uses and methods

[0091] Also disclosed herein is the use of one or more Lactobacillus salivarius strains or a composition comprising the same selected from the group consisting of:

[0092] a. providing relief from or preventing lactose-induced abdominal discomfort,

[0093] b. Digest lactose or improve lactose digestion;

[0094] c. When consuming products containing lactose, provide digestive comfort after the lactose is digested;

[0095] d. provide sustained support and / or action for lactose digestion; and

[0096] e. Any combination thereof.

[0097] In one embodiment, the use is to provide relief for or prevent abdominal discomfort induced by lactose. In one embodiment, the use is to digest lactose or improve the digestion of lactose. In one embodiment, the use is to provide digestive comfort after lactose digestion when consuming a product containing lactose. In one embodiment, the use is to provide sustained support and / or effect for lactose digestion.

[0098] In one embodiment of the use, the one or more Lactobacillus salivarius strains or compositions comprising the same have an effect on the subject for at least 4 hours after consumption, preferably for at least 8 hours. In another embodiment, the one or more Lactobacillus salivarius strains or compositions comprising the same have an effect for at least 12 hours, 18 hours or 24 hours after consumption. In one embodiment, the Lactobacillus salivarius strains or compositions are provided to the subject 1, 2 or 3 times daily, preferably at least once daily.

[0099] In one embodiment of the use, the composition further comprises one or more lactases. In another embodiment of the use, the one or more lactases break down lactose consumed by the subject immediately after consuming the composition, and the one or more saliva-associated lactobacillus strains break down lactose consumed by the subject within a period of at least 4 hours after consuming the composition, preferably within a period of up to 24 hours after consuming the composition. In another embodiment, the one or more saliva-associated lactobacillus strains break down lactose consumed by the subject within a period of at least 8 hours after consuming the composition. In another embodiment, the one or more saliva-associated lactobacillus strains break down lactose consumed by the subject within a period of at least 12 hours, 18 hours or 24 hours after consuming the composition.

[0100] In another embodiment, the present invention is directed to a method for providing relief from or preventing lactose-induced abdominal discomfort; digesting lactose or improving the digestion of lactose; providing digestive comfort after lactose digestion when consuming a lactose-containing product; and / or providing sustained support and / or effect on lactose digestion in a subject; the method comprising providing an effective amount of one or more Lactobacillus salivarius strains or a composition comprising one or more Lactobacillus salivarius strains to a subject in need thereof.

[0101] In one embodiment, the method is used to provide relief or prevention of abdominal discomfort induced by lactose. In one embodiment, the method is used to digest lactose or improve the digestion of lactose. In one embodiment, the method is used to provide digestive comfort after lactose digestion when consuming products containing lactose. In one embodiment, the method is used to provide long-lasting support and / or effect for lactose digestion.

[0102] In one embodiment of the method, one or more Lactobacillus salivarius strains or a composition comprising one or more Lactobacillus salivarius strains are provided to the subject 1, 2 or 3 times a day, preferably at least once a day. In a preferred embodiment of the method, one or more Lactobacillus salivarius strains or a composition comprising one or more Lactobacillus salivarius strains are provided orally.

[0103] In one embodiment of the method, the composition further comprises one or more lactases. In another embodiment of the method, the one or more lactases immediately decompose the lactose consumed by the subject after consuming the composition, and the one or more saliva-associated lactobacillus strains decompose the lactose consumed by the subject within a time period of at least 4 hours after consuming the composition, preferably within a time period of up to 24 hours after consuming the composition. In another embodiment, the one or more saliva-associated lactobacillus strains decompose the lactose consumed by the subject within a time period of at least 8 hours after consuming the composition. In another embodiment, the one or more saliva-associated lactobacillus strains decompose the lactose consumed by the subject within a time period of at least 12 hours, 18 hours or 24 hours after consuming the composition.

[0104] The following numbered paragraphs describe particular embodiments of the present disclosure:

[0105] 1. One or more saliva-associated Lactobacillus strains or compositions comprising the same are used for use selected from the group consisting of:

[0106] a. Providing relief or prevention of lactose-induced abdominal discomfort;

[0107] b. Digest lactose or improve lactose digestion;

[0108] c. When consuming products containing lactose, provide digestive comfort after the lactose is digested;

[0109] d. provide sustained support and / or action for lactose digestion; and

[0110] e. Any combination thereof.

[0111] 2. The use according to paragraph 1, wherein the effect of the one or more Lactobacillus salivarius strains or the composition comprising the same lasts for a period of at least up to 4 hours, preferably at least up to 8 hours after consumption.

[0112] 3. The use according to paragraph 1, wherein the effect of the one or more Lactobacillus salivarius strains or the composition comprising the same lasts for a period of up to 24 hours after consumption.

[0113] 4. The use according to any one of paragraphs 1 or 2, wherein the lactose-induced abdominal discomfort is diarrhea, constipation, bloating, pain, flatulence, nausea and / or flatulence induced by ingestion of a product containing lactose.

[0114] 5. The use according to any one of the preceding paragraphs, wherein the saliva-associated Lactobacillus strain or composition is provided to the subject 1 to 3 times a day, preferably provided to the subject at least once a day.

[0115] 6. The use according to any one of the preceding paragraphs, wherein the one or more Lactobacillus salivarius strains or the composition is provided orally to the subject.

[0116] 7. The use according to any one of the preceding paragraphs, wherein the Lactobacillus salivarius strain expresses one or more lactase enzymes.

[0117] 8. The use according to any of the preceding paragraphs, wherein the amount of lactase expressed by the Lactobacillus salivarius strain is measured in vitro based on the amount of lactose reduced from a lactose medium on which the Lactobacillus salivarius strain is grown.

[0118] 9. The use according to any of the preceding paragraphs, wherein the amount of lactose reduced from the lactose medium is at least 30%, preferably 75%.

[0119] 10. Use according to any of the preceding paragraphs, wherein the amount of lactose reduced from the lactose medium is at least 50%, preferably 75% over a period of up to 24 hours.

[0120] 11. The use according to any one of the preceding paragraphs, wherein the Lactobacillus salivarius strain has the deposit accession number DSM 34078, or the Lactobacillus salivarius strain is a Lactobacillus salivarius strain having all the identifying characteristics of the Lactobacillus salivarius strain with the deposit accession number DSM 34078 or a mutant thereof.

[0121] 12. The use according to any of the preceding paragraphs, wherein the Lactobacillus salivarius strains have a maximum growth rate of at least 5.0 mean optical density / minute in lactose medium.

[0122] 13. The use according to any of the preceding paragraphs, wherein the Lactobacillus salivarius strains have a ΔOD600 value of at least 0.7 in lactose medium.

[0123] 14. The use according to any of the preceding paragraphs, wherein the Lactobacillus salivarius strains have a maximum growth rate of at least 5.0 mean optical density / minute in lactose medium and a ΔOD600 value of at least 0.7 in lactose medium.

[0124] 15. The use according to any of the preceding paragraphs, wherein the Lactobacillus salivarius strains survive in the gastrointestinal tract.

[0125] 16. The use according to any of the preceding paragraphs, wherein the Lactobacillus salivarius strains survive in the gastrointestinal tract for at least 4 hours.

[0126] 17. The use according to any of the preceding paragraphs, wherein the Lactobacillus salivarius strains are grown on lactose in vitro and / or in the gastrointestinal tract of a subject.

[0127] 18. The use according to any of the preceding paragraphs, wherein the Lactobacillus salivarius strains prefer to grow on lactose in the presence of other sugars.

[0128] 19. The use according to any of the preceding paragraphs, wherein the saliva-associated Lactobacillus strains reduce gas production of fecal matter containing lactose in a gas pressure measurement system.

[0129] 20. The use according to any of the preceding paragraphs, wherein the amount of the salivarius-associated Lactobacillus strains is in the range of 1E+08 colony forming units (CFU) to 1E+11 CFU.

[0130] 21. The use according to any of the preceding paragraphs, wherein the amount of the salivarius-associated Lactobacillus strains is in the range of 1E+09 CFU to 1E+11 CFU, preferably in the range of 1E+09 CFU to 1E+10 CFU, more preferably about 1E+09 CFU.

[0131] 22. The use according to any one of the preceding paragraphs, wherein the composition further comprises one or more lactases.

[0132] 23. The use according to paragraph 22, wherein the one or more lactases belong to the GH35 family or the GH2 family.

[0133] 24. The use according to any one of paragraphs 22 or 23, wherein the one or more lactases are acid lactase and / or neutral lactase.

[0134] 25. The use according to any of paragraphs 22-24, wherein the one or more lactases is a fungal lactase.

[0135] 26. The use according to any one of paragraphs 22-25, wherein the one or more lactases are polypeptides selected from the group consisting of:

[0136] a. a polypeptide having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, or SEQ ID NO: 12;

[0137] b. a polypeptide derived from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 12 by having 1-30 alterations (e.g., substitutions, deletions and / or insertions) at one or more positions, for example 1 or 2 or 3 or 4 or 5 or 6 or 7 or 8 or 9 or 10 or 11 or 12 or 13 or 14 or 15 or 16 or 17 or 18 or 19 or 20 or 21 or 22 or 23 or 24 or 25 or 26 or 27 or 28 or 29 or 30 alterations, in particular substitutions,

[0138] c. a polypeptide derived from the polypeptide of (a) or (b), wherein the N- and / or C-terminus has been extended by the addition of one or more amino acids, and

[0139] d. A fragment of the polypeptide of (a), (b) or (c).

[0140] 27. The use according to any of paragraphs 22-26, wherein the lactase is a polypeptide comprising, consisting essentially of, or consisting of SEQ ID NO: 1.

[0141] 28. The use according to any of paragraphs 22-26, wherein the lactase is a polypeptide comprising, consisting essentially of, or consisting of SEQ ID NO: 2.

[0142] 29. The use according to any of paragraphs 22-28, wherein the amount of the lactases is at least 4500 Food Chemicals Codex (FCC) units.

[0143] 30. The use according to any of paragraphs 22-29, wherein the amount of the one or more lactases is 10000 FCC units.

[0144] 31. The use according to any one of paragraphs 22-30, wherein the one or more lactase enzymes are used to produce a rapid support and / or effect on lactose, and the one or more salivarius associated Lactobacillus strains are used to produce a sustained support and / or effect on lactose.

[0145] 32. The use according to any of paragraphs 22-31, wherein the one or more lactases break down lactose consumed by the subject immediately after consumption of the composition, and the one or more salivarius associated Lactobacillus strains break down lactose consumed by the subject for a period of at least up to 4 hours after consumption of the composition, preferably for a period of up to 24 hours after consumption of the composition.

[0146] 33. The use according to any of paragraphs 22-32, wherein the one or more Lactobacillus salivarius strains break down lactose consumed by the subject for a period of at least up to 8 hours after consumption of the composition.

[0147] 34. The use according to any of paragraphs 22-33, wherein the one or more Lactobacillus salivarius strains break down lactose consumed by the subject for a period of at least up to 12 hours after consumption of the composition.

[0148] 35. One or more salivarius-associated Lactobacillus strains or a composition comprising the same, for use selected from the group consisting of:

[0149] a. For providing relief or prevention of lactose-induced abdominal discomfort;

[0150] b. Used to digest lactose or improve the digestion of lactose;

[0151] c. To provide digestive comfort after the lactose is digested when consuming products containing lactose;

[0152] d. for providing sustained support and / or action for lactose digestion; and

[0153] e. for any combination thereof.

[0154] 36. One or more Lactobacillus salivarius strains or a composition comprising the same for use according to paragraph 35, wherein the effect of the one or more Lactobacillus salivarius strains or the composition comprising the same lasts for a period of at least up to 4 hours, preferably at least up to 8 hours after consumption.

[0155] 37. One or more Lactobacillus salivarius strains or a composition comprising the same for use according to any one of paragraphs 35 or 36, wherein the effect of the one or more Lactobacillus salivarius strains or the composition comprising the same lasts for a period of up to 24 hours after consumption.

[0156] 38. One or more Lactobacillus salivarius strains for use or a composition comprising the same according to any one of paragraphs 35-37, wherein the lactose-induced abdominal discomfort is diarrhea, constipation, bloating and / or flatulence induced by ingestion of a product containing lactose.

[0157] 39. One or more Lactobacillus salivarius strains or a composition comprising the same for use according to any one of paragraphs 35-38, wherein the Lactobacillus salivarius strains or the composition are provided to the subject 1 to 3 times a day, preferably at least once a day.

[0158] 40. One or more Associative Lactobacillus salivarius strains or a composition comprising the same for use according to any one of paragraphs 35-39, wherein the one or more Associative Lactobacillus salivarius strains or the composition is provided orally to the subject.

[0159] 41. One or more Lactobacillus salivarius strains for use or a composition comprising the same according to any one of paragraphs 35-40, wherein the Lactobacillus salivarius strains express one or more lactases.

[0160] 42. One or more Lactobacillus salivarius strains for use or a composition comprising the same according to any one of paragraphs 35-41, wherein the amount of lactase expressed by the Lactobacillus salivarius strain is measured in vitro based on the amount of lactose reduced from a lactose medium on which the Lactobacillus salivarius strain is grown.

[0161] 43. One or more Associative Lactobacillus salivarius strains for use or a composition comprising the same according to any one of paragraphs 35-42, wherein the amount of lactose reduced from the lactose medium is at least 30%, preferably 75%.

[0162] 44. One or more Associative Lactobacillus salivarius strains for use according to any one of paragraphs 35-43 or a composition comprising the same, wherein the amount of lactose reduced from the lactose medium is at least 50%, preferably 75% over a period of up to 24 hours.

[0163] 45. One or more Lactobacillus salivarius strains for use according to any one of paragraphs 35-44, or a composition comprising the same, wherein the Lactobacillus salivarius strain has the deposit accession number DSM 34078, or the Lactobacillus salivarius strain is a Lactobacillus salivarius strain having all the identifying characteristics of the Lactobacillus salivarius strain with the deposit accession number DSM 34078, or a mutant thereof.

[0164] 46. ​​One or more Lactobacillus salivarius strains for use according to any one of paragraphs 35-45 or a composition comprising the same, wherein the Lactobacillus salivarius strains have a maximum growth rate of at least 5.0 mean optical density / minute in lactose medium.

[0165] 47. One or more Lactobacillus salivarius strains for use or a composition comprising the same according to any one of paragraphs 35-46, wherein the Lactobacillus salivarius strains have a ΔOD600 value of at least 0.7 in lactose medium.

[0166] 48. One or more Lactobacillus salivarius strains for use according to any one of paragraphs 35-47 or a composition comprising the same, wherein the Lactobacillus salivarius strains have a maximum growth rate of at least 5.0 mean optical density / minute in lactose medium and a ΔOD600 value of at least 0.7 in lactose medium.

[0167] 49. One or more Lactobacillus salivarius strains or a composition comprising the same for use according to any one of paragraphs 35-48, wherein the Lactobacillus salivarius strains survive in the gastrointestinal tract.

[0168] 50. One or more Lactobacillus salivarius strains or a composition comprising the same for use according to any one of paragraphs 35-49, wherein the Lactobacillus salivarius strains survive in the gastrointestinal tract for at least 4 hours.

[0169] 51. One or more Lactobacillus salivarius strains for use or a composition comprising the same according to any one of paragraphs 35-50, wherein the Lactobacillus salivarius strains are grown on lactose in vitro and / or in the gastrointestinal tract of a subject.

[0170] 52. One or more Lactobacillus salivarius strains for use or a composition comprising the same according to any one of paragraphs 35-51, wherein the Lactobacillus salivarius strains prefer to grow on lactose in the presence of other sugars.

[0171] 53. One or more Lactobacillus salivarius strains or a composition comprising the same for use according to any one of paragraphs 35-52, wherein the Lactobacillus salivarius strains reduce gas production of fecal matter containing lactose in a gas pressure measurement system.

[0172] 54. One or more Lactobacillus salivarius strains for use or a composition comprising the same according to any one of paragraphs 35-53, wherein the amount of the one or more Lactobacillus salivarius strains is in the range of 1E+08 colony forming units (CFU) to 1E+11 CFU, preferably in the range of 1E+09 CFU to 1E+11 CFU, preferably in the range of 1E+09 CFU to 1E+10 CFU, more preferably about 1E+09 CFU.

[0173] 55. One or more Associative Lactobacillus salivarius strains for use or a composition comprising the same according to any one of paragraphs 35-54, wherein the composition further comprises one or more lactases.

[0174] 56. One or more Lactobacillus salivarius strains for use or a composition comprising the same according to paragraph 55, wherein the one or more lactases belong to the GH35 family or the GH2 family.

[0175] 57. One or more Lactobacillus salivarius strains for use or a composition comprising the same according to paragraph 55 or 56, wherein the one or more lactases are acid lactases and / or neutral lactases.

[0176] 58. One or more Associative Lactobacillus salivarius strains for use or a composition comprising the same according to any one of paragraphs 55-57, wherein the one or more lactases are fungal lactases.

[0177] 59. One or more Lactobacillus salivarius strains for use or a composition comprising the same according to any one of paragraphs 55-58, wherein the one or more lactases are polypeptides selected from the group consisting of:

[0178] e. a polypeptide having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, or SEQ ID NO: 12;

[0179] f. a polypeptide derived from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 12 by having 1-30 alterations (e.g., substitutions, deletions and / or insertions) at one or more positions, for example 1 or 2 or 3 or 4 or 5 or 6 or 7 or 8 or 9 or 10 or 11 or 12 or 13 or 14 or 15 or 16 or 17 or 18 or 19 or 20 or 21 or 22 or 23 or 24 or 25 or 26 or 27 or 28 or 29 or 30 alterations, in particular substitutions,

[0180] g. A polypeptide derived from the polypeptide of (a) or (b), wherein the N- and / or C-terminus has been extended by the addition of one or more amino acids, and

[0181] h. A fragment of the polypeptide of (a), (b) or (c).

[0182] 60. One or more Lactobacillus salivarius strains for use or a composition comprising the same according to any one of paragraphs 55-59, wherein the lactase is a polypeptide comprising, consisting essentially of, or consisting of SEQ ID NO: 1.

[0183] 61. One or more Lactobacillus salivarius strains for use or a composition comprising the same according to any one of paragraphs 55-59, wherein the lactase is a polypeptide comprising, consisting essentially of, or consisting of SEQ ID NO: 2.

[0184] 62. One or more Associative Lactobacillus salivarius strains for use or a composition comprising the same according to any one of paragraphs 55-61, wherein the amount of the one or more lactases is at least 4500 Food Chemicals Codex (FCC) units.

[0185] 63. One or more Lactobacillus salivarius strains for use or a composition comprising the same according to any one of paragraphs 55-62, wherein the amount of the one or more lactases is 10000 FCC units.

[0186] 64. One or more Lactobacillus salivarius strains for use or a composition comprising the same according to any one of paragraphs 55-63, wherein the one or more lactases are used to produce a rapid support and / or action on lactose and the one or more Lactobacillus salivarius strains are used to produce a sustained support and / or action on lactose.

[0187] 65. One or more Lactobacillus salivarius strains for use or a composition comprising the same according to any one of paragraphs 55-64, wherein the one or more lactases break down lactose consumed by the subject immediately after consumption of the composition, and the one or more Lactobacillus salivarius strains break down lactose consumed by the subject for a period of at least up to 4 hours after consumption of the composition, preferably for a period of up to 24 hours after consumption of the composition.

[0188] 66. One or more Lactobacillus salivarius strains for use or a composition comprising the same according to any one of paragraphs 55-65, wherein the one or more Lactobacillus salivarius strains break down lactose consumed by the subject for a period of at least up to 8 hours after consumption of the composition.

[0189] 67. One or more Lactobacillus salivarius strains for use or a composition comprising the same according to any one of paragraphs 55-66, wherein the one or more Lactobacillus salivarius strains break down lactose consumed by the subject for a period of at least up to 12 hours after consumption of the composition.

[0190] 68. One or more Lactobacillus salivarius strains for use or a composition comprising the same according to any one of paragraphs 55-67, wherein the amount of the one or more Lactobacillus salivarius strains is in the range of 1E+08 CFU to 1E+11 CFU, preferably in the range of 1E+09 CFU to 1E+11 CFU, preferably in the range of 1E+09 CFU to 1E 10 CFU, more preferably about 1E+09 CFU.

[0191] 69. One or more Associative Lactobacillus salivarius strains for use or a composition comprising the same according to any one of paragraphs 54-67, wherein the composition further comprises one or more lactases.

[0192] 70. A Lactobacillus salivarius strain having the deposit number DSM 34078 or a Lactobacillus salivarius strain having all the identifying characteristics of the Lactobacillus salivarius strain having the deposit number DSM 34078 or a mutant thereof.

[0193] 71. The Lactobacillus salivarius strain according to paragraph 70, wherein the Lactobacillus salivarius strain survives in the gastrointestinal tract.

[0194] 72. The Lactobacillus salivarius strain of any of paragraphs 70 or 71, wherein the Lactobacillus salivarius strain grows on lactose in vitro and / or in the gastrointestinal tract of a subject.

[0195] 73. The Lactobacillus salivarius strain of any of paragraphs 70-72, wherein the Lactobacillus salivarius strain prefers to grow on lactose in the presence of other sugars.

[0196] 74. The Lactobacillus salivarius strain of any of paragraphs 70-73, wherein the Lactobacillus salivarius strain reduces gas production of fecal matter containing lactose in a gas pressure measurement system.

[0197] 75. The Lactobacillus salivarius strain of any of paragraphs 70-74, wherein the Lactobacillus salivarius strain expresses one or more lactases.

[0198] 76. The Lactobacillus salivarius strain according to any of paragraphs 70-75, wherein the amount of lactase expressed by the Lactobacillus salivarius strain is measured in vitro based on the amount of lactose reduced from a lactose medium on which the Lactobacillus salivarius strain is grown.

[0199] 77. The Lactobacillus salivarius strain according to any of paragraphs 70-76, wherein the amount of lactose reduced from the lactose medium is at least 50%, preferably 75%.

[0200] 78. A composition for providing relief from or preventing lactose-induced abdominal discomfort; digesting lactose or improving the digestion of lactose; providing digestive comfort after lactose digestion when consuming a lactose-containing product; and / or providing sustained support and / or effect to a subject's lactose digestion, the composition comprising:

[0201] (a) one or more strains of Lactobacillus salivarius; and

[0202] (b) one or more lactase enzymes.

[0203] 79. The composition according to paragraph 78, wherein the effect of the one or more Lactobacillus salivarius strains or the composition comprising the same lasts for a period of at least up to 4 hours, preferably at least up to 8 hours after consumption.

[0204] 80. The composition according to paragraph 78 or 79, wherein the effect of the one or more Lactobacillus salivarius strains or the composition comprising the same persists for a period of up to 24 hours after consumption.

[0205] 81. The composition according to paragraphs 78-80, wherein the lactose-induced abdominal discomfort is diarrhea, constipation, bloating and / or flatulence induced by ingestion of a product comprising lactose.

[0206] 82. The composition according to any of paragraphs 78-81, wherein the saliva-associated Lactobacillus strain or composition is provided to the subject 1 to 3 times per day, preferably provided to the subject at least once per day.

[0207] 83. The composition of any of paragraphs 78-82, wherein the one or more Lactobacillus salivarius strains or the composition is provided orally to the subject.

[0208] 84. The composition of any of paragraphs 78-83, wherein the Associating Lactobacillus salivarius strain expresses one or more lactase enzymes.

[0209] 85. The composition of any of paragraphs 78-84, wherein the amount of lactase expressed by the Lactobacillus salivarius strain is measured in vitro based on the amount of lactose reduced from a lactose medium on which the Lactobacillus salivarius strain was grown.

[0210] 86. The composition according to any of paragraphs 78-85, wherein the amount of lactose reduced from the lactose medium is at least 30%, preferably 75%.

[0211] 87. The composition according to any of paragraphs 78-86, wherein the amount of lactose reduced from the lactose medium is at least 50%, preferably 75% over a period of up to 24 hours.

[0212] 88. The composition according to paragraphs 78-87, wherein the Lactobacillus salivarius strain has the deposit accession number DSM 34078, or the Lactobacillus salivarius strain is a Lactobacillus salivarius strain having all the identifying characteristics of the Lactobacillus salivarius strain deposited with the accession number DSM 34078 or a mutant thereof.

[0213] 89. The composition of any of paragraphs 78-88, wherein the Lactobacillus salivarius strains have a maximum growth rate of at least 5.0 mean optical density / minute in lactose medium.

[0214] 90. The composition of any of paragraphs 78-89, wherein the Lactobacillus salivarius strains have a ΔOD600 value of at least 0.7 in lactose medium.

[0215] 91. The composition of any of paragraphs 78-90, wherein the Lactobacillus salivarius strains have a maximum growth rate of at least 5.0 mean optical density / minute in lactose medium and a ΔOD600 value of at least 0.7 in lactose medium.

[0216] 92. The composition of any of paragraphs 78-91, wherein the Lactobacillus salivarius strains survive in the gastrointestinal tract.

[0217] 93. The composition of any of paragraphs 78-92, wherein the Lactobacillus salivarius strains survive in the gastrointestinal tract for at least 4 hours.

[0218] 94. The composition of any of paragraphs 78-93, wherein the Lactobacillus salivarius strains are grown on lactose in vitro and / or in the gastrointestinal tract of a subject.

[0219] 95. The composition of paragraphs 78-94, wherein the Lactobacillus salivarius strains prefer to grow on lactose in the presence of other sugars.

[0220] 96. The composition of any of paragraphs 78-95, wherein the saliva-associated Lactobacillus strains reduce gas production of fecal matter containing lactose in a gas pressure measurement system.

[0221] 97. The composition according to any of paragraphs 78-96, wherein the composition is in a single dosage form.

[0222] 98. The composition according to any of paragraphs 78-97, wherein the single dosage form of the composition is a capsule, a powder, a microcapsule, a tablet, a dragee, a pellet, and a granule.

[0223] 99. The composition according to any of paragraphs 78-98, wherein the amount of the one or more Associative Lactobacillus salivarius strains is in the range of 1E+08 colony forming units (CFU) to 1E+11 CFU.

[0224] 100. The composition according to any of paragraphs 78-99, wherein the amount of the one or more Associative Lactobacillus salivarius strains is in the range of 1E+09 CFU to 1E+11 CFU, preferably in the range of 1E+09 CFU to 1E 10 CFU, more preferably about 1E+09 CFU.

[0225] 101. The composition of any of paragraphs 78-100, wherein the amount of the one or more lactases is at least 4500 Food Chemicals Codex (FCC) units.

[0226] 102. The composition of any of paragraphs 78-101, wherein the amount of the one or more lactases is 10000 FCC units.

[0227] 103. The composition according to any of paragraphs 78-102, wherein the one or more lactases belong to the GH35 family or the GH2 family.

[0228] 104. The composition of any of paragraphs 78-103, wherein the one or more lactases are acid lactase and / or neutral lactase.

[0229] 105. The composition of any of paragraphs 78-104, wherein the one or more lactases is a fungal lactase.

[0230] 106. The composition according to any of paragraphs 78-105, wherein the one or more lactases are polypeptides selected from the group consisting of:

[0231] a. a polypeptide having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, or SEQ ID NO: 12,

[0232] b. a polypeptide derived from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 12 by having 1-30 alterations (e.g., substitutions, deletions and / or insertions) at one or more positions, for example 1 or 2 or 3 or 4 or 5 or 6 or 7 or 8 or 9 or 10 or 11 or 12 or 13 or 14 or 15 or 16 or 17 or 18 or 19 or 20 or 21 or 22 or 23 or 24 or 25 or 26 or 27 or 28 or 29 or 30 alterations, in particular substitutions,

[0233] c. a polypeptide derived from the polypeptide of (a) or (b), wherein the N- and / or C-terminus has been extended by the addition of one or more amino acids, and

[0234] d. A fragment of the polypeptide of (a), (b) or (c).

[0235] 107. The composition of any of paragraphs 78-106, wherein the lactase is a polypeptide comprising, consisting essentially of, or consisting of SEQ ID NO: 1.

[0236] 108. The composition of any of paragraphs 78-106, wherein the lactase is a polypeptide comprising, consisting essentially of, or consisting of SEQ ID NO: 2.

[0237] 109. The composition according to any of paragraphs 78-108, wherein the one or more lactase enzymes are used to produce a rapid support and / or effect on lactose and the one or more salivarius associated Lactobacillus strains are used to produce a sustained support and / or effect on lactose.

[0238] 110. The composition of any of paragraphs 39-109, wherein the one or more lactases break down lactose consumed by the subject immediately after consumption of the composition, and the one or more salivarius associated Lactobacillus strains break down lactose consumed by the subject for a period of at least up to 4 hours after consumption of the composition, preferably for a period of up to 24 hours after consumption of the composition.

[0239] 111. The composition of any of paragraphs 39-110, wherein the one or more Lactobacillus salivarius strains break down lactose consumed by the subject for a period of at least up to 8 hours after consumption of the composition.

[0240] 112. The composition of any of paragraphs 39-111, wherein the one or more Lactobacillus salivarius strains break down lactose consumed by the subject for a period of at least up to 12 hours after consumption of the composition.

[0241] 113. A method for alleviating or preventing lactose-induced abdominal discomfort; digesting lactose or improving the digestion of lactose; providing digestive comfort after lactose digestion when consuming a lactose-containing product; and / or providing sustained support and / or effect for lactose digestion; the method comprising providing an effective amount of one or more Lactobacillus salivarius strains or a composition comprising the one or more Lactobacillus salivarius strains to a subject in need thereof.

[0242] 114. The method according to paragraph 113, wherein the effect of the one or more Lactobacillus salivarius strains or the composition comprising the same persists for a period of at least up to 4 hours, preferably at least up to 8 hours after consumption.

[0243] 115. The method according to any of paragraphs 113 or 114, wherein the effect of the one or more Lactobacillus salivarius strains or the composition comprising the same persists for a period of up to 24 hours after consumption.

[0244] 116. The method of any of paragraphs 113-115, wherein the lactose-induced abdominal discomfort is diarrhea, constipation, bloating and / or flatulence induced by ingestion of a product comprising lactose.

[0245] 117. The method according to any of paragraphs 113-116, wherein the saliva-associated Lactobacillus strain or composition is provided to the subject 1 to 3 times per day, preferably provided to the subject at least once per day.

[0246] 118. The method of any of paragraphs 113-117, wherein the Lactobacillus salivarius strain expresses one or more lactases.

[0247] 119. The method of any of paragraphs 113-118, wherein the amount of lactase expressed by the Lactobacillus salivarius strain is measured in vitro based on the amount of lactose reduced from a lactose medium on which the Lactobacillus salivarius strain was grown.

[0248] 120. The method according to any of paragraphs 113-119, wherein the amount of lactose reduced from the lactose medium is at least 30%, preferably 75%.

[0249] 121. The method according to any of paragraphs 113-120, wherein the amount of lactose reduced from the lactose medium is at least 50%, preferably 75% over a period of up to 24 hours.

[0250] 122. The method according to any one of paragraphs 113-121, wherein the Lactobacillus salivarius strain has the deposit accession number DSM 34078, or the Lactobacillus salivarius strain is a Lactobacillus salivarius strain having all the identifying characteristics of the Lactobacillus salivarius strain deposited with the accession number DSM 34078 or a mutant thereof.

[0251] 123. The method of any of paragraphs 113-122, wherein the Lactobacillus salivarius strains have a maximum growth rate of at least 5.0 mean optical density / minute in lactose medium.

[0252] 124. The method according to any of paragraphs 113-123, wherein the Lactobacillus salivarius strains have a ΔOD600 value of at least 0.7 in lactose medium.

[0253] 125. The method according to any of paragraphs 113-124, wherein the Lactobacillus salivarius strains have a maximum growth rate of at least 5.0 mean optical density / minute in lactose medium and a ΔOD600 value of at least 0.7 in lactose medium.

[0254] 126. The method of any of paragraphs 113-125, wherein the Lactobacillus salivarius strains survive in the gastrointestinal tract.

[0255] 127. The method of any of paragraphs 113-126, wherein the Lactobacillus salivarius strains survive in the gastrointestinal tract for at least 4 hours.

[0256] 128. The method of any of paragraphs 113-127, wherein the Lactobacillus salivarius strains are grown on lactose in vitro and / or in the gastrointestinal tract of a subject.

[0257] 129. The method of any of paragraphs 113-128, wherein the Lactobacillus salivarius strains prefer to grow on lactose in the presence of other sugars.

[0258] 130. The method of any of paragraphs 113-129, wherein the saliva-associated Lactobacillus strains reduce gas production of fecal matter containing lactose in a gas pressure measurement system.

[0259] 131. The method according to any of paragraphs 113-130, wherein the amount of the one or more Associative Lactobacillus salivarius strains is in the range of 1E+08 colony forming units (CFU) to 1E+11 CFU.

[0260] 132. The method according to any of paragraphs 113-131, wherein the amount of the one or more salivarius-associated Lactobacillus strains is in the range of 1E+09 CFU to 1E+11 CFU, preferably in the range of 1E+09 CFU to 1E 10 CFU, more preferably about 1E+09 CFU.

[0261] 133. The method of any of paragraphs 113-132, wherein the composition further comprises one or more lactases.

[0262] 134. The method according to any of paragraph 133, wherein the one or more lactases belong to the GH35 family or the GH2 family.

[0263] 135. The method according to any of paragraphs 133 or 134, wherein the one or more lactases are acid lactase and / or neutral lactase.

[0264] 136. The method according to any of paragraphs 133-135, wherein the one or more lactases are fungal lactases.

[0265] 137. The method according to any of paragraphs 133-136, wherein the one or more lactases are polypeptides selected from the group consisting of:

[0266] a. a polypeptide having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, or SEQ ID NO: 12,

[0267] b. a polypeptide derived from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 12 by having 1-30 alterations (e.g., substitutions, deletions and / or insertions) at one or more positions, for example 1 or 2 or 3 or 4 or 5 or 6 or 7 or 8 or 9 or 10 or 11 or 12 or 13 or 14 or 15 or 16 or 17 or 18 or 19 or 20 or 21 or 22 or 23 or 24 or 25 or 26 or 27 or 28 or 29 or 30 alterations, in particular substitutions,

[0268] c. a polypeptide derived from the polypeptide of (a) or (b), wherein the N- and / or C-terminus has been extended by the addition of one or more amino acids, and

[0269] d. A fragment of the polypeptide of (a), (b) or (c).

[0270] 138. The method according to any of paragraphs 133-137, wherein the lactase is a polypeptide comprising, consisting essentially of, or consisting of SEQ ID NO: 1.

[0271] 139. The method according to any of paragraphs 133-138, wherein the lactase is a polypeptide comprising, consisting essentially of, or consisting of SEQ ID NO: 2.

[0272] 140. The method according to any of paragraphs 133-139, wherein the amount of the one or more lactases is at least 4500 Food Chemicals Codex (FCC) units.

[0273] 141. The method according to any of paragraphs 133-140, wherein the amount of the one or more lactases is 10000 FCC units.

[0274] 142. The method according to any of paragraphs 133-141, wherein the one or more Lactobacillus salivarius strains or the composition is provided to the subject 1 to 3 times per day, preferably provided to the subject at least once per day.

[0275] 143. The method according to any of paragraphs 133-142, wherein the one or more saliva-associated Lactobacillus strains or the composition is provided to the subject orally.

[0276] 144. The method according to any of paragraphs 133-143, wherein the one or more lactases break down lactose consumed by the subject immediately after consuming the composition, and the one or more salivarius associated Lactobacillus strains break down lactose consumed by the subject for a period of at least up to 4 hours after consuming the composition, preferably for a period of up to 24 hours after consuming the composition.

[0277] 145. The method of any of paragraphs 133-144, wherein the one or more Lactobacillus salivarius strains break down lactose consumed by the subject for a period of at least up to 8 hours after consumption of the composition.

[0278] 146. The method of any of paragraphs 133-145, wherein the one or more salivarius associated Lactobacillus strains break down lactose consumed by the subject for a period of at least up to 12 hours after consumption of the composition.

[0279] Examples

[0280] The following examples are not intended to be an exhaustive list of all the different ways in which the present disclosure may be implemented or an exhaustive list of all the features that may be added to the present disclosure. It will be appreciated by those skilled in the art that various changes and additions may be made to the various embodiments without departing from the present disclosure. Therefore, the following description is intended to illustrate some specific embodiments of the present invention, rather than to exhaustively specify all permutations, combinations, and variations thereof.

[0281] Unless otherwise indicated, the percentages listed in the following examples are weight percentages based on the total weight of the composition.

[0282] Materials and methods

[0283] Use standard culture medium to cultivate the Lactobacillus strain, for example, the culture medium that provides 15-30g peptone or tryptone and 5-30g glucose per liter per liter.To prepare standard culture medium, unless otherwise stated, standard procedures (component concentration, sterilization, inoculation) are applied, and the microorganism is grown for sufficient time (for example, 8-48 hours) under the temperature (for example, 35 ℃-42 ℃) that increases.

[0284] Example 1 - Screening for suitable combined Lactobacillus strains

[0285] The screening protocol outlined below was used to screen the Lactobacillus strains for lactose metabolism ability. 850 Lactobacillus strains were screened to select strains that could grow on lactose as a single C source at very high rates and high optical densities by analyzing the optical density at 595 nm (OD595) or 600 nm (OD600) as indicators.

[0286] Screening protocol for combined Lactobacillus strains grown on lactose as sole C source (96-well plates):

[0287] Day 1: Establishment of pre-culture

[0288] A frozen stock of each combined Lactobacillus strain in De Man-Rogosa-Sharp (MRS) medium containing 18% glycerol in a 96-well plate was thawed and 10 microliters (μl) were transferred to 200 μl of medium YDA medium [yeast extract-glucose-acetate; the same composition as in YLA medium (defined above), with one modification that lactose was replaced by D-glucose] in a flat-bottom 96-well plate. The plate was sealed with an airtight film and incubated at 37° C. for 24 hours under anaerobic conditions.

[0289] Day 2: Establishment of primary culture

[0290] Plate 1 with lactose:

[0291] 5 μl of the 1:40 diluted preculture was transferred into 200 μl lactose medium (YLA) in a 96-well flat bottom plate.

[0292] The plate was sealed with an airtight film and placed in a plate photometer (such as a BioTek EON Microplate UV / VIS Reader) at 37°C for 24 hours.

[0293] Optical density at OD600 nm was measured every 5 minutes. The linear region of the growth curve was used to calculate the growth rate in mean optical density / second (mOD / sec) using the microplate reader software.

[0294] Plate 2 without lactose:

[0295] Transfer 5 μl of the 1:40 diluted preculture into 200 μl of the same medium without lactose. Incubate the plate under the same conditions as plate 1.

[0296] result

[0297] Although several species and a large number of strains exhibited high cell density at the end of the culture time (ΔOD600>0.7), only a few strains were characterized by simultaneously having a high growth rate (maximum growth rate <5). Therefore, in order to analyze and select strains that exhibit excellent lactose metabolism, strains with excellent cell density were plotted on the X-axis (ΔOD600>0.7) and strains exhibiting the maximum growth rate (maximum growth rate <5) were plotted on the Y-axis, allowing us to better analyze and select strains with the best lactose metabolism ability.

[0298] Among 850 tested strains of different species, a total of 48 strains exhibited high lactose metabolism ability based on excellent cell density (ΔOD600>0.7) and maximum growth rate (maximum growth rate <5), such as Figure 1 Species that exhibit characteristics of lactose metabolism are Figure 2 (pie chart and table).

[0299] When lactose was used as the main carbon source, most of the tested Lactobacillus salivarius strains (25-26 out of 28) grew at moderate to high or very high growth rates and grew to high optical densities, e.g. Figure 3 As shown (solid triangle).

[0300] Interestingly, among a total of 28 Lactobacillus salivarius strains tested in the strain panel, 22 Lactobacillus salivarius strains exhibited excellent lactose metabolism, i.e., excellent cell density (ΔOD600>0.7) and maximum growth rate (maximum growth rate <5), e.g. Figure 3 These 22 Lactobacillus salivarius strains accounted for approximately 46% of the top lactose metabolizers identified among all 850 Lactobacillus strains screened.

[0301] Example 2 - Growth Kinetics

[0302] A single well of a 96-well plate was inoculated with the target bacterial strain under anaerobic conditions for 24 hours. On the second day, 5 μl of the culture was transferred to 200 μl of fresh YLA medium in a 96-well plate. The plate was sealed with an airtight foil and placed in a plate photometer for 17-24 hours. The optical density at 600 nanometers (nm) was continuously monitored and recorded to generate a growth curve. Over time, the increased optical density was related to the number of bacterial cells in the solution. The maximum growth rate was determined by calculating the slope of the asymptote in the linear range of the growth curve. Figure 4 In the present invention, strain 1 and strain 2 are Lactobacillus salivarius strains, and strain 3 is a Lactobacillus plantarum strain. Strain 1 is Lactobacillus salivarius DSM 34078. Figure 4 The growth kinetics of Lactobacillus salivarius strain DSM 34078 on lactose as a carbon source (C source) are shown in comparison to some other candidates. Strains 1 and 2 show positive densities with a small lag time (maximum density) and a steep curve (maximum growth rate), demonstrating better growth kinetics than strain 3. Lactobacillus salivarius DSM 34078 (strain 1) has a higher growth rate than other Lactobacillus salivarius strains (strain 2) and Lactobacillus plantarum strains (strain 3).

[0303] Example 3 - Air pressure test of saliva combined with Lactobacillus DSM 34078

[0304] The salivarius associated Lactobacillus strains deposited as DSM 34078 were tested in a pressure measurement assay with fecal samples. During the observation period, pressure was measured continuously using an in-house developed pressure measurement device (2ML-FPM). Human fecal samples were collected using the Gut Alive kit. Within two days after collection, the fecal samples were treated by diluting the fecal samples with glycerol / water at a ratio of 1:4, so that 25% of the fecal samples were stored at -80°C after preparation until use. Fecal slurries from human donors were resuspended in phosphate buffered saline (PBS) and 5 grams per liter (g / l) of lactose were added. All procedural steps were performed in an anaerobic atmosphere. The tubes were hermetically sealed and a sensor for continuously measuring the pressure in the headspace was inserted through a rubber diaphragm. The pressure was measured for 24 hours and compared with the pressure accumulation of the microbial community without the addition of lactose. Next to lactose, 108 colony forming units (CFU) of selected bacterial strains showing high lactose metabolism capacity were added to the microbiota and inoculated for 24 h under anaerobic conditions with continuous pressure measurement.

[0305] Table 2.

[0306]

[0307] Figure 5 showed that the addition of Lactobacillus salivae combined with Lactobacillus DSM 34078 reduced lactose-induced GAS in stool samples. Figure 5 Show the effect of fermentation of human feces slurry (donor) alone, the effect of adding lactose to feces slurry on gas pressure generation (donor+lactose) and then further adding Lactobacillus salivae combined with Lactobacillus DSM 34078 to the gas pressure increase induced by lactose (donor+lactose+Lactobacillus salivae combined with Lactobacillus DSM 34078). The addition of Lactobacillus salivae combined with Lactobacillus DSM 34078 significantly reduced the gas pressure development of microbial flora by 50.36%. Calculate pressure and represent in bar graph as cumulative area under the curve (cAUC) when there is human feces donor set after 10 hours of incubation. Each column represents the mean value of four feces donors, and each donor is tested twice.

[0308] Example 4 - Air pressure test of different saliva combined with Lactobacillus strains

[0309] The gas pressure tests performed in Example 3 were repeated using samples from Donor 9 with different Lactobacillus salivarius strains. Figure 6 The results presented in show that 8 out of 9 Lactobacillus salivarius strains were able to reduce gas pressure by 50%-70%. All strains tested in gas pressure showed high growth rates in growth assays on lactose as a single carbon source, demonstrating high lactose metabolism capacity, as shown in Table 3.

[0310] In this barometric assay, the fecal microflora created a highly competitive environment and the hypothesis for the outlier could be that this strain may not be able to adequately compete with the fecal microflora of donor 9. Strain No. 6 is Lactobacillus salivarius DSM 34078.

[0311] Table 3:

[0312] Strain number Average growth rate [mOD / min] 1 6.70 2 8.69 3 7.19 4 5.86 5 8.33 6 7.58 7 7.27 8 8.60 9 7.77

[0313] Example 5 - Identification and quantification of DSM 34078 in fecal fermentation by real-time qPCR

[0314] To demonstrate that Lactobacillus salivarius DSM34078 is able to proliferate in the fecal microbial community, the experimental setup described in Example 3 was analyzed by TaqMan qPCR using strain-specific primers and probes.

[0315] 500 μl of fecal fermentation from each of the four donors was sampled at time points 0 and 24 h. Bacterial cells were pelleted by centrifugation. DNA was extracted using the 96 Blood and Tissue Kit (Qiagen).

[0316] qPCR was performed on a qTower real-time PCR cycler (Analytik Jena) using innuMIX qPCR 2x master mix probe (Analytik Jena). Each reaction contained 2 μl DNA template, 0.30 μM of each primer, and 0.20 μM probe. PCR cycling conditions included initial denaturation at 95°C for 3 min, followed by denaturation at 95°C for 10 s, annealing and extension at 60°C for 45 s, and 40 cycles.

[0317] A standard curve was generated using serial dilutions of DNA extracted from 1E+09 cells of DSM 34078. The threshold cycle (Ct) values ​​were plotted against the log10 of the known cell number of bacteria present in the PCR reaction.

[0318] The results were analyzed by linear regression to calculate the slope. The PCR amplification efficiency (E) was determined by the equation E=10-1 / (-slope)-1.

[0319] Figure 7 It is shown that at time point 0 hours, Lactobacillus salivarius DSM 34078 was added to each donor fermentation in similar amounts of approximately 7.5-8 log cells / ml. After 24 hours of fermentation with lactose, an increase of up to 1 log was observed in each donor tested. Lactobacillus salivarius DSM 34078 not only survived, but also proliferated in the fecal microflora.

[0320] DNA sequence of Lactobacillus salivais: SEQ ID NO: 13

[0321] Forward primer: GGTTTCCCGGCCATTGAAAGG (SEQ ID NO: 14)

[0322] Reverse primer: TCTTATCCAATGCACTGTCCGC (SEQ ID NO: 15)

[0323] TagMan probe: CGACGCATCAGCTGGCCGCA (SEQ ID NO: 16) Example 6 - Microbiome analysis

[0324] The experimental setup described in Example 5 was sampled for metagenomic sequencing. The complete ribosomal RNA operon (rrn) from the DNA sampled in Example 5 was amplified using unique barcode primers for each sample. Each PCR reaction mixture consisted of the following: 300nM of each of the forward and reverse primers, 30ng of template DNA and 20μl of NEBNext Ultra IIQ5 mixture (New England Biolabs). PCR cycling conditions were initial denaturation at 98°C for 30s, followed by 10s at 98°C, 20s at 59°C and 2min 30s at 72°C for 25 cycles, and a final extension at 72°C for 4min.

[0325] The PCR products were purified with MagSi-NGS magnetic beads and quantified with Qubit fluorescent quantitative HS (Invitrogen, California, USA). Libraries were prepared by mixing equimolar amounts of each purified amplicon, and then sequencing adapters were connected using SGK-LSK-110 ligation sequencing kit (Oxford Nanopore Technologies) and NEBNext ligation kit (New England Biolabs).

[0326] Sequencing was initiated on a MinION Mk1c sequencer with an R9.4.1 flow cell. Base calling was performed with guppy v6.0.1 base caller (Oxford Nanopore Technologies) to convert the original fast5 sequencing files into fastq files. Demultiplexing was performed using guppy barcoder v6.0.1 (Oxford Nanopore Technologies). Readings were subsequently classified using the taxonomic classification system Kraken2 v.2.0.9beta for the Refseq database. Samples with less than 2000 reads and rare species (relative abundance <0.1%) were excluded from the analysis. Data were analyzed using the Qiime2 plugin.

[0327] The relative abundance of salivary Lactobacillus species was measured for each of the three donors at time point 0 h (grey bars) and time point 24 h (black bars) (Y axis) and Figure 8 . On the X-axis, different methods are shown: donor + lactose (denoted as DX + S) and donor + lactose + saliva combined with Lactobacillus DSM 34078 (denoted as DX + S + DSM 34078) at time point 0 hours and time point 24 hours. As expected, no probiotic strains were detected in any donor + lactose method. In the method of donor + lactose + saliva combined with Lactobacillus DSM 34078, a sharp increase in the relative abundance of probiotic strains was observed after 24 hours of fermentation compared to time point 0 hours.

[0328] Example 7 - Repeated Lactose Stimulation

[0329] In the gastrointestinal tract, probiotics are exposed to conditions that may limit their survival and activity, such as the chemical composition of the intestinal microenvironment, substrate fluctuations and continuous flushing due to the transition of intestinal contents from the stomach to the colon. These parameters can only be partially implemented into batch culture systems. In order to prove that Lactobacillus salivarius DSM 34078 is able to persist in the small intestine, metabolize lactose and respond to repeated lactose challenges as in vivo, the behavior of Lactobacillus salivarius strains was explored in intestinal fluid, under continuous flow and under repeated lactose challenges.

[0330] For this purpose, the bioreactor was filled with FeSSIF (intestinal simulation fluid in the fed state, commercially available from Biorelevant), milk (final lactose concentration of 10 g / L), yeast extract and PBS resuspended salivarius lyophilized powder (total cell count 10^7-10^9). After mixing and heating (37°C), the bacterial cells were kept in batch culture for 1 or 2 hours. After this period of time, the flow was switched to open, and FeSSIF without substrate was used as feed. The flow rate was selected to ensure that the bioreactor volume was completely exchanged within 4 hours to simulate the transition time in the small intestine. After 4 hours, the flow was stopped, and the substrate in the form of skim milk powder and yeast extract diluted in PBS were added to the fermenter to reach a final concentration of 10 g / l lactose. After standing for one hour, the flow was switched to open and continued for another 4 hours. Samples were taken every 1 to 2 hours to determine the cell number of salivarius lyophilus during the experiment. Fig. 9 Represent the experimental design as a flow chart.

[0331] In some experiments, Lactobacillus salivarius cell counts dropped within the first 1-2 h of the experiment. A possible explanation could be the lack of sufficient metabolic activity for rapid adaptation of the bacterial cells to FeSSIFE due to the short rehydration time of the lyophilized powder before addition to the bioreactor.

[0332] During the first period of continuous flow, the cell population of Lactobacillus salivarius did not decrease or even increased to 0.5 log, depending on the bacterial count at the start. This suggests that Lactobacillus salivarius proliferated rapidly in FeSSIF, despite continuous flushing of biomass and growth substrate, to the extent that it could persist in the bioreactor.

[0333] After the second addition of substrate, growth of Lactobacillus salivarius was observed with at least equal or even higher growth rates, such that in all experiments the cfu determined at the end of continuous flow (4 h after repeated addition of substrate) were at least 0.4 log higher. This demonstrates that the strain is resistant to substrate fluctuations. Based on the increased proliferation rate during the experiments, it can be concluded that the strain is adapted to the intestinal conditions simulated by FeSSIF. Fig.10 , the graph represents the time dependence of CFU in two bioreactors A and B (technical replicates) under identical conditions.

[0334] Therefore, this indicator strain can be effectively colonized in the human small intestine because it can adapt to the chemical composition of the intestinal fluid within a few hours, even when the substrate concentration is periodically very low. Although there is no surface suitable for bacterial attachment, the strain is still retained in the bioreactor. The conditions in the bioreactor are different from the small intestinal environment, where mucus can be used as a possible attachment site for the strain. In addition, in the selected experimental setting, the focus is on simulating a small intestinal transition time of 4h, rather than aligning the flow rate with the real conditions. For this reason, the flow rate applied may be higher than the physiological flow rate.

[0335] In the next set of experiments, there are plans to extend the acclimation time of Lactobacillus salivarius and to modify the flow rate to mimic physiological values, with the goal of demonstrating lactose metabolism under repeated lactose stimulation with continuous flow.

[0336] Biomaterial Deposit

[0337] The following biological material has been deposited under the terms of the Budapest Treaty with the Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSM), Mascheroder Weg 1B, D-38124 Braunschweig, Germany, and has been given the following accession numbers:

[0338] Collection: Saliva combined with Lactobacillus

[0339] Accession number DSM 34078

[0340] Deposit date: October 21, 2021

[0341] The source and geographical origin of the salivarius associated lactobacillus with accession number DSM 34078 are chicken manure and Germany, respectively. The strain is deposited under the following conditions: ensuring that the culture is available to the authorized person determined by the foreign patent law during the pendency of this patent application. The deposit represents a substantially pure culture of the deposited strain. It is necessary to provide the deposit according to the foreign patent law requirements of some countries, and submit a copy of the subject application in these countries, or its subsequent text. However, it should be understood that the availability of the deposit does not constitute a license for the practice of the subject of the present invention for the patent right approved by government action.

[0342]

[0343]

Claims

1. One or more saliva-associated Lactobacillus strains or compositions comprising the same are used for use selected from the group consisting of: a. Providing relief or prevention of lactose-induced abdominal discomfort; b. Digest lactose or improve lactose digestion; c. When consuming products containing lactose, provide digestive comfort after the lactose is digested; d. provide sustained support and / or action for lactose digestion; and e. Any combination thereof.

2. The use according to claim 1, wherein lactose-induced abdominal discomfort is diarrhea, constipation, bloating, pain, flatulence, nausea and / or flatulence induced by ingestion of a product containing lactose.

3. The use according to claim 1 or 2, wherein the Lactobacillus salivarius strain has a deposit accession number of DSM 34078, or the Lactobacillus salivarius strain is a Lactobacillus salivarius strain having all the identification characteristics of the Lactobacillus salivarius strain with a deposit accession number of DSM 34078 or a mutant thereof.

4. Use according to any one of the preceding claims, wherein the composition further comprises one or more lactase enzymes.

5. The use according to claim 4, wherein the one or more lactases are polypeptides selected from the group consisting of: a. a polypeptide having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, or SEQ ID NO: 12; b. a polypeptide derived from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 12 by having 1-30 alterations (e.g., substitutions, deletions and / or insertions) at one or more positions, for example 1 or 2 or 3 or 4 or 5 or 6 or 7 or 8 or 9 or 10 or 11 or 12 or 13 or 14 or 15 or 16 or 17 or 18 or 19 or 20 or 21 or 22 or 23 or 24 or 25 or 26 or 27 or 28 or 29 or 30 alterations, in particular substitutions, c. a polypeptide derived from the polypeptide of (a) or (b), wherein the N- and / or C-terminus has been extended by the addition of one or more amino acids, and d. A fragment of the polypeptide of (a), (b) or (c).

6. A Lactobacillus salivarius strain having the deposit number DSM 34078 or a Lactobacillus salivarius strain having all the identifying characteristics of the Lactobacillus salivarius strain having the deposit number DSM 34078 or a mutant thereof.

7. A composition for providing relief from or preventing lactose-induced abdominal discomfort; digesting lactose or improving the digestion of lactose; providing digestive comfort after lactose digestion when consuming a lactose-containing product; and / or providing sustained support and / or effect to a subject's lactose digestion, the composition comprising: (a) one or more Lactobacillus salivarius strains as claimed in claim 6; and (b) one or more lactases as claimed in claim 5.

8. The composition according to claim 7, wherein the amount of the one or more salivarius-associated Lactobacillus strains is in the range of 1E+08 colony forming units (CFU) to 1E+11 CFU.

9. The composition of claim 7, wherein the amount of the one or more lactases is at least 4500 Food Chemicals Codex (FCC) units.

10. A method for alleviating or preventing lactose-induced abdominal discomfort; digesting lactose or improving the digestion of lactose; providing digestive comfort after lactose digestion when consuming a lactose-containing product; and / or providing sustained support and / or effect for lactose digestion; the method comprising providing an effective amount of one or more Lactobacillus salivarius strains or a composition comprising the one or more Lactobacillus salivarius strains to a subject in need thereof.

Images