Aptamer detection techniques

Abstract

Aptamer detection techniques are described, which may include aptamer modifications to facilitate incorporation of adapter sequences. In one embodiment, the 3 '-terminus of the aptamer may be modified by deprotection and subsequent attachment to the deprotected 3'-terminus or extension of the deprotected 3 '-terminus. The modifications at the 3'end of the adapter may include adapter sequences for library preparation of sequencing libraries.

Description

Background Art

[0001] The disclosed technology generally relates to aptamer detection and / or identification technologies that can be used in conjunction with aptamer-based assays. Specifically, the disclosed technology relates to direct or indirect aptamer detection in conjunction with aptamer-based assays.

[0002] The subject matter discussed in this section should not be considered to be prior art simply because it is mentioned in this section. Similarly, problems mentioned in this section or associated with the subject matter provided as background technology should not be considered to have been previously recognized in the prior art. The subject matter in this section merely represents different approaches, which themselves may also correspond to specific implementations of the technology protected by the claims.

[0003] Protein expression patterns help define the identity and state of cells. RNA transcripts are often used as a surrogate for protein expression, but the relationship between protein abundance and mRNA is not one-to-one. There are differences caused by post-transcriptional, translational, and protein degradation regulation. Therefore, direct nucleic acid sequencing of RNA transcripts may not accurately estimate protein expression.

[0004] Aptamers are nucleic acids that bind to molecular targets (such as proteins) with high affinity and specificity. Advances in aptamer selection and design include systematic evolution of ligands (SELEX) of exponential enrichment. In SELEX, high-affinity nucleic acids of different analytes of interest can be separated from combinatorial libraries, allowing high-throughput characterization of aptamer-target binding and multiple determinations of analytes in complex biological samples. After aptamers are combined with analyte targets, binding events can be detected to characterize the presence and concentration of various analytes in biological samples. However, because protein or other analyte concentrations in different biological samples and / or between different biological samples may vary to a great extent, it is difficult to identify the useful detection range of multiple aptamer-based determinations. In addition, the specific design constraints of aptamer molecules may lead to challenges to downstream detection workflows. Summary of the invention

[0005] In one embodiment, the present disclosure provides a method for aptamer detection, the method comprising contacting an analyte of a sample with a plurality of aptamers under conditions that allow formation of analyte-aptamer complexes, wherein different aptamers in the plurality of aptamers have specific affinity for corresponding different analytes in the analytes, and detecting the analytes by detecting the aptamers in the analyte-aptamer complexes. Detecting the individual aptamer comprises contacting the individual aptamer with an exonuclease to deprotect the 3′ end of the individual aptamer to generate a deprotected 3′ end of the individual aptamer; modifying the deprotected 3′ end of the individual aptamer to generate a modified 3′ end of the individual aptamer; capturing the individual aptamer using the modified 3′ end; and detecting the captured individual aptamer.

[0006] In one embodiment, the present disclosure provides a method for aptamer detection, the method comprising contacting an analyte of a sample with a plurality of aptamers under conditions that allow formation of analyte-aptamer complexes, wherein different aptamers in the plurality of aptamers have specific affinity for corresponding different analytes in the analytes, and detecting the analytes by detecting the aptamers in the analyte-aptamer complexes. Detecting the individual aptamer comprises modifying the 3' end of the individual aptamer to generate a modified 3' end of the individual aptamer; hybridizing an oligonucleotide to the individual aptamer, wherein the oligonucleotide comprises a non-hybridized 5' region; extending the 3' end of the oligonucleotide to generate an extended chain; and using the extended chain to generate fragments of a sequencing library.

[0007] In one embodiment, the present disclosure provides an aptamer detection probe set. The probe set comprises a plurality of different probe mixtures, which are complementary to corresponding different aptamers in an aptamer group, wherein a single probe mixture in the plurality of different probe mixtures comprises a binding subset of probes, which is coupled to an affinity tag; and a pseudo subset of probes, which is not coupled to the affinity tag, wherein each probe in the binding subset and the pseudo subset of the single probe mixture comprises the same binding region, which is complementary to at least a portion of the single aptamer in the aptamer group, and wherein each probe in the binding subset and the pseudo subset of the single probe mixture comprises a non-hybridized region at the 3′ end.

[0008] In one embodiment, the present disclosure provides an aptamer detection probe set. The probe set comprises a plurality of different probe mixtures, which are complementary to corresponding different aptamers in an aptamer set, wherein a single probe mixture in the plurality of different probe mixtures comprises a binding subset of probes; and a pseudo subset of probes, wherein the pseudo subset of probes comprises a modified 5' end that cannot be ligated, wherein each probe in the binding subset and the pseudo subset of the single probe mixture comprises the same binding region, which is complementary to at least a portion of the single aptamer in the aptamer set, and wherein the binding subset of probes has an unmodified 5' end that can be ligated.

[0009] In one embodiment, the present disclosure provides a method for aptamer detection. The method includes contacting an analyte of a sample with a plurality of aptamers under conditions that allow the formation of an analyte-aptamer complex, wherein different aptamers in the plurality of aptamers have specific affinity for corresponding different analytes in the analytes, and detecting the analytes by detecting the aptamers in the analyte-aptamer complexes. Detecting a single aptamer in the plurality of aptamers includes contacting the single aptamer with a single-stranded nucleic acid reporter probe to form an aptamer-reporter probe complex, the reporter probe comprising: an aptamer binding region, the aptamer binding region binds to the single aptamer to form a first double-stranded region; a single-stranded region, the single-stranded region comprising a cleavage region and an identification sequence, the identification sequence uniquely identifying the single aptamer or the associated analyte. Detecting the single aptamer also includes extending the single aptamer from the 3′ end to form a second double-stranded region, the second double-stranded region comprising the identification sequence, and using the single-stranded region as a template; separating the first double-stranded region from the second double-stranded region at the cleavage region; and sequencing the second double-stranded region to detect the identification sequence.

[0010] In one embodiment, the present disclosure provides an aptamer detection reporter probe set, which comprises a plurality of different single-stranded nucleic acid reporter probes, which are complementary to corresponding different aptamers in an aptamer group. The first single-stranded nucleic acid reporter probe in these multiple different single-stranded nucleic acid reporter probes comprises a first aptamer binding region, which binds to a first individual aptamer to form a first double-stranded region; a first cleavage region; and a first identification sequence, which uniquely identifies the first individual aptamer. The second single-stranded nucleic acid reporter probe in these multiple different single-stranded nucleic acid reporter probes comprises a second aptamer binding region, which binds to a second individual aptamer to form a second double-stranded region; a second cleavage region; and a second identification sequence, which uniquely identifies the second individual aptamer; wherein the first aptamer binding region and the second aptamer binding region have different nucleotide sequences relative to each other.

[0011] In one embodiment, the present disclosure provides a method for aptamer detection. The method includes contacting a single aptamer with a reporter probe, the reporter probe hybridizing with the single aptamer at the aptamer binding region to form a first double-stranded region of the reporter probe, and wherein the reporter probe comprises a non-hybridized region, the non-hybridized region comprises a cleavage region and an identification sequence, the identification sequence uniquely identifies the single aptamer or an associated analyte; using the non-hybridized region as a template to extend the single aptamer from the 3′ end to form a second double-stranded region; separating the first double-stranded region from the second double-stranded region at the cleavage region; and detecting the identification sequence.

[0012] In one embodiment, the present disclosure provides a method for aptamer detection. The method includes contacting an analyte of a sample with a plurality of aptamers under conditions that allow the formation of an analyte-aptamer complex, wherein different aptamers in the plurality of aptamers have specific affinity for corresponding different analytes in the analytes; and detecting the analytes by detecting the aptamers in the analyte-aptamer complexes. Detecting a single aptamer in the plurality of aptamers includes contacting the single aptamer with an exonuclease to deprotect the 3′ end of the single aptamer to generate a deprotected 3′ end of the single aptamer; extending the deprotected 3′ end of the single aptamer using a polymerase to generate an extended 3′ end of the single aptamer; hybridizing the single aptamer with a reporter probe, wherein the reporter probe has a protected 3′ end that is not deprotected by the exonuclease or extended by the polymerase; capturing the single aptamer using the modified 3′ end; and detecting the captured single aptamer using the reporter probe. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] These and other features, aspects, and advantages of the disclosed embodiments will become better understood when the following detailed description is read with reference to the accompanying drawings, in which like characters refer to like parts throughout, and in which:

[0014] Figure 1 is a flow chart of an aptamer detection technology that can be used in conjunction with an aptamer and / or a reporter that binds to an aptamer according to one embodiment of the present disclosure;

[0015] Figure 2 is a schematic diagram of an aptamer modification technique using splint ligation according to one embodiment of the present disclosure;

[0016] Figure 3 is a schematic diagram of an aptamer bimolecular assay according to one embodiment of the present disclosure;

[0017] Figure 4 is a schematic diagram of an aptamer modification technique using terminal transferase and hybridized poly-A according to one embodiment of the present disclosure;

[0018] Figure 5 is a schematic diagram of an aptamer modification technique using a hybridized degenerate probe according to one embodiment of the present disclosure;

[0019] Figure 6 is a schematic diagram of an aptamer modification technology using oligonucleotides (oNTPs) according to one embodiment of the present disclosure;

[0020] Figure 7 is a schematic diagram of an aptamer modification technique using a hybridized reporter probe according to one embodiment of the present disclosure;

[0021] Figure 8 is a schematic diagram of an aptamer modification technique using a hybridized reporter probe according to one embodiment of the present disclosure;

[0022] Fig. 9 is a schematic diagram of an aptamer modification technique using a hybridized reporter probe according to one embodiment of the present disclosure;

[0023] Fig.10 is a schematic diagram of aptamer modification with an enzymatically cleavable protecting group according to one embodiment of the present disclosure;

[0024] Fig.11 shows the cleavage of an enzymatically cleavable protecting group according to one embodiment of the present disclosure;

[0025] Fig.12 is a schematic diagram of an aptamer modification technique using an enzymatically cleavable protecting group and a polymerase according to one embodiment of the present disclosure;

[0026] Fig.13 is a schematic diagram of aptamer modification with an enzymatically cleavable protecting group and a ligase according to one embodiment of the present disclosure;

[0027] Fig.14 is a schematic diagram of the aptamer detection workflow;

[0028] Fig.15 An example aptamer set and reporter probe set according to one embodiment are shown;

[0029] Fig.16 According to one embodiment, the reporter probe is connected to Fig.15 Example aptamer-reporter probe complexes formed by contact of a set of aptamers;

[0030] Fig.17 According to one embodiment, Fig.16 Example of aptamer-reporter probe complex 3′ end deprotection;

[0031] Fig.18According to one embodiment, Fig.17 The extended 3′ end after deprotection is shown;

[0032] Fig.19 According to one embodiment, Fig.18 Separation of double-stranded regions after extension as shown;

[0033] Fig. 20 shows the double-stranded region remaining after digestion of unbound reporter probes according to one embodiment;

[0034] Fig.21 shows incorporation of a sequencing adapter into a separated double-stranded region comprising an identification sequence according to one embodiment;

[0035] Fig.22A Data from a model system are shown that demonstrate that DNA without reverse dT can be extended by a polymerase with biotinylated nucleotides;

[0036] Fig. 22B Data from a model system are shown demonstrating that DNA with inverted dT can be deprotected by ExoIII and extended by a polymerase with nucleotides, and is inert to extension without deprotection;

[0037] Fig.23A Data from a model system are shown demonstrating that DNA with inverted dT can be deprotected by ExoIII and extended with nucleotides, and is inert to extension without deprotection;

[0038] Fig.23A Data from a model system are shown demonstrating that DNA with inverted dT can be deprotected by ExoIII and extended by a polymerase with multiple biotinylated nucleotides and is inert to extension in the absence of deprotection;

[0039] Fig. 23B Data from a model system are shown demonstrating that DNA with inverted dT can be deprotected by ExoIII and extended by a polymerase with biotinylated nucleotides, and is inert to extension in the absence of deprotection;

[0040] Fig.24 is an example reporter having an identification sequence or ID at the 3′ end according to one embodiment;

[0041] Fig.25 is an exemplary reporter having an identification sequence or ID at the 5′ end according to one embodiment;

[0042] Fig.26is an example deprotection and extension workflow according to one embodiment;

[0043] Fig. 27 shows that the 3' inverted dT can be removed and after removal, for one set of aptamers, extension with a biotinylated nucleotide occurs; and

[0044] 28 is a block diagram of a sequencing device configured to acquire sequencing data according to one embodiment. DETAILED DESCRIPTION

[0045] The following discussion is presented to enable any person skilled in the art to make and use the disclosed technology, and is provided in the context of a specific application and its requirements. Various modifications to the disclosed implementations will be apparent to those skilled in the art, and the general principles defined herein may be applied to other implementations and applications without departing from the spirit and scope of the disclosed technology. Therefore, the disclosed technology is not intended to be limited to the specific implementations shown, but is to be accorded the widest scope consistent with the principles and features disclosed herein.

[0046] An aptamer is a short single-stranded nucleic acid molecule (ssDNA or ssRNA) that can bind to its specific target molecule with high affinity. Therefore, an aptamer can be used for multi-omics applications, such as proteomic characterization of a sample in a high-throughput manner. The quantification and detection of an aptamer can be used for indirect quantitative / measurement / detection of the target protein of an aptamer. There are many assays for protein detection using aptamers. Some aptamers can have modified nucleotides to enhance the affinity to the target protein by a slow dissociation rate. In order to facilitate detection by next generation sequencing (NGS) technology, the aptamer or alternative molecule retained from the assay is converted into a sequencing (NGS) library in a quantitative and repeatable manner. The detection method can directly sequence a copy of the aptamer sequence to identify it or translate the aptamer sequence into a barcode, which can be sequenced to indirectly identify the aptamer, and therefore identify the presence and / or concentration of the aptamer target in the sample of interest.

[0047] The aptamer may include a protective group for nuclease resistance. The 3′ end may contain a reverse dT to provide resistance to nucleases naturally present in biological samples or during storage of reagents. See Ni, S.; Yao, H.; Wang, L; Lu, J.; Jiang, F.; Lu, A.; Zhang, G. Chemical Modifications of Nucleic Acid Aptamers for Therapeutic Purposes. International Journal of Molecular Sciences (Int. J Mol. Sci.) 2017, 18, 1683. The disclosed embodiments show how the removal or replacement of 3′ dT can provide multiple opportunities for library preparation to prepare sequencing libraries from aptamers. The disclosed embodiments provide solutions for generating sequencing libraries (e.g., NGS libraries) from aptamers by modifying the aptamer end structure or the downstream retention step. In one embodiment, the modification may include deprotection of the 3′ aptamer group before adding a library preparation adapter or an element that facilitates further conversion into a library. Aptamers are typically protected from nuclease degradation by modifying a group on the 3' end. In one embodiment, this protection is removed following the aptamer-based assay to enable library preparation steps.

[0048] As used herein, an aptamer may refer to a non-naturally occurring nucleic acid with a specific binding affinity to a target molecule. The binding of an aptamer to a target molecule may result in a catalytic change in the target molecule, thereby reacting with the target molecule in a manner that modifies or changes the target molecule or the functional activity of the target molecule, covalently attaching to the target molecule (such as in a suicide inhibitor), and promoting the reaction between the target molecule and another molecule. In one embodiment, the target molecule is a three-dimensional chemical structure other than a polynucleotide, which is bound to an aptamer by a mechanism that is primarily independent of Watson / Crick base pairing or triple helix binding. In one embodiment, an aptamer is not a nucleic acid with a known physiological function that is bound by a target molecule.

[0049] Appamers include nucleic acids identified from candidate mixtures of nucleic acids. The specific binding affinity of an aptamer to its target may refer to a much higher affinity of the binding of an aptamer to its target than its binding to other non-target components in a mixture or sample. Different aptamers may have the same number or different numbers of nucleotides. An aptamer may be DNA or RNA, and may be single-stranded, double-stranded or contain a double-stranded region. The aptamers discussed herein may be used in any diagnosis, imaging, high-throughput screening or target validation techniques or procedures or assays that may use aptamers, oligonucleotides, antibodies and ligands (but not limited thereto). As disclosed herein, aptamers may be used in assays based on aptamers, such as those disclosed in U.S. Patent Nos. 7,855,054 and 7,964,356 and U.S. Publication Nos. US / 2011 / 0136099 and US / 2012 / 0115752.

[0050] Figure 1 An example workflow for aptamer detection via aptamer-based assays is shown. Fig.10 In one example, a set of aptamers for different target molecules is provided (frame 12), for example, a set of aptamers attached to a solid support is provided. Attachment of the aptamers to the solid support is achieved by contacting a first solid support with one or more aptamers and associating a releasable first tag included on the aptamer directly or indirectly with an appropriate first capture agent attached to the first solid support or as part of the first solid support. The test sample is then prepared and contacted with the fixed aptamers, which have specific affinity for their respective target molecules, which may or may not be present in the sample. If the test sample contains the target molecule, an aptamer-target affinity complex will be formed in the mixture with the test sample. The aptamer that forms a complex with the analyte (e.g., target) is retained (frame 14) or separated from other components of the assay. In one embodiment, retention is achieved using Catch-1 and Catch-2 allocation as generally discussed herein. See Kraemer S, Vaught JD, Bock C, Gold L, Katilius E, et al. (2011) From SOMAmer-Based Biomarker Discovery to Diagnostic and Clinical Applications: A SOMAmer-Based, Streamlined Multiplex Proteomic Assay. PLoS ONE 6(10): e26332.

[0051] In addition to the analyte-aptamer complex, uncomplexed aptamers will also be attached to the first solid phase carrier. The aptamer-target affinity complex and uncomplexed aptamers that have been associated with the probe on the solid support are then distributed from the remainder of the mixture, thereby removing free targets and all other uncomplexed substances in the test sample (sample matrix); that is, the components of the mixture are not associated with the first solid support. This distribution step is referred to as Catch-1 distribution in this article (see definition below). After distribution, the aptamer-target affinity complex is released from the first solid support together with any uncomplexed aptamers using a method suitable for the specific releasable first label used.

[0052] In one embodiment, the aptamer-target affinity complex bound to the solid support is treated with a reagent that introduces the second tag into the target molecule component of the aptamer-target affinity complex. In one embodiment, the target is a protein or peptide, and the target is biotinylated by treating it with NHS-PEO4-biotin. The second tag introduced into the target molecule may be the same or different from the aptamer capture tag. If the second tag is the same as the first tag or the aptamer capture tag, the free capture site on the first solid support may be closed before the labeling step begins. In this exemplary embodiment, the first solid support is washed with free biotin before the target labeling begins. Labeling methods, particularly labeling targets such as peptides and proteins, are described in U.S. Patent No. 7,855,054.

[0053] Partitioning is accomplished by releasing uncomplexed aptamers and aptamer-analyte complexes from the first solid support. In one embodiment, the first releasable tag is a photocleavable moiety that is cleaved by irradiation with UV light under conditions that cleave ≥ 90% of the first releasable tag. In other embodiments, release is accomplished by a method appropriate for the selected releasable moiety in the first releasable tag. The aptamer-target affinity complex can be eluted and collected for further use in the assay, or can be contacted with another solid support to perform the remaining steps of the assay.

[0054] In one embodiment, a second partition (referred to herein as Catch-2 partition, see definition below) is performed to remove free aptamers. As described above, in one embodiment, a second tag for Catch-2 partitioning can be added to the target while the aptamer-target affinity complex is still in contact with the solid support for Catch-0 capture. In other embodiments, the second tag can be added to the target at another point in the assay before the start of Catch-2 partitioning. The mixture is contacted with a solid support having a capture element (second) attached to its surface, which is capable of binding to the target capture tag (second tag), preferably with high affinity and specificity. In one embodiment, the solid phase support is a magnetic bead (such as DynaBeads MyOne Streptavidin C1) contained in a well of a microtiter plate, and the capture element (second capture element) is streptavidin. Magnetic beads provide a convenient method for separating partition components in a mixture. The aptamer-target affinity complex contained in the mixture is thus bound to the solid support through the binding interaction of the target (second) capture tag and the second capture element on the second solid support. The aptamer-target affinity complex is then partitioned from the remainder of the mixture, for example, by washing the support with a buffer solution, including a buffer comprising an organic solvent, including but not limited to glycerol.

[0055] The aptamer is then eluted from the aptamer-target complex with a buffer containing a chaotropic salt selected from the group including but not limited to sodium perchlorate, lithium chloride, sodium chloride, and magnesium chloride. Aptamers retained on the Catch-2 beads by means of aptamer / aptamer interactions are not eluted by this treatment.

[0056] In another embodiment, the aptamers released from the Catch-2 distribution are detected and optionally quantified by a detection method (box 16) as discussed herein, such as by next generation sequencing technology. For example, detection can occur by amplification and / or sequencing of probes bound to the eluted aptamers. In certain embodiments, the detection includes providing a detection result of the relative and / or estimated absolute concentration of the detected aptamer. The detection result can include a notification or output of a positive or negative detection result or a relative or estimated concentration for a specific aptamer ID or a specific target of the aptamer.

[0057] The disclosed embodiments relate to processes that can be used with Fig.10 Aptamer detection techniques used in combination. In certain embodiments, the techniques include direct modification of aptamers. The modification facilitates the incorporation of adaptors to generate sequencing libraries, which are sequenced as part of aptamer detection. In embodiments, the techniques include incorporating or modifying reporter probes that hybridize to aptamers, whereby the reporter probes are used to generate sequencing libraries and are sequenced as part of aptamer detection.

[0058] Figure 2 An example workflow for aptamer modification of the aptamer 20 shown is shown. As shown, the aptamer 20 can be converted into a sequencing library using a direct method. The aptamer 20 shown includes an aptamer binding sequence 24, the function of which is to bind to the target of interest and to be retained for detection in an aptamer-based assay due to target binding. The aptamer 20 includes an inverted dT 26 at the 3' end, and in an embodiment, a label 28 can be included at the 5' end. One or more adjacent sequences 30, 32 are located at the 5' position and / or 3' position of the aptamer binding sequence 24, and in an embodiment, do not form part of the aptamer-target direct binding. For example, these adjacent sequences 30, 32 can be sequences used during the SELEX process and attached to the aptamer 20. In one embodiment, the adjacent sequences 30, 32 are flanked by the aptamer binding sequence 24. In one embodiment, the neighboring sequences 30, 32 have corresponding nucleotide sequences that are fixed sequences uniquely associated with individual aptamer binding sequences 24 and are distinguishable from each other and from neighboring sequences 30, 32 of different aptamers 20. Therefore, for an aptamer set of N different aptamers 20 having corresponding N different aptamer binding sequences 24, there may also be N different neighboring sequences 30 and / or N different neighboring sequences 32. In one embodiment, only the 3′ neighboring sequence 32 is present. Neighboring sequences 30 and 32 may also be shared between different aptamer binding sequences.

[0059] The adjacent sequences 30, 32 are shown as N polymers of 5 nucleotides. However, other lengths are also contemplated. In one embodiment, the length of one or both of the adjacent sequences 30, 32 can be 4-25 nucleotides. In one embodiment, one or both of the adjacent sequences 30, 32 can be directly adjacent to the aptamer binding region 24, so that there is no intervening nucleotide between these sequences. As discussed below, due to the direct connection of the adjacent sequence 32 to the splint oligonucleotide, the adjacent sequence 32 can be directly adjacent to the reverse dT 26 at the 3' end.

[0060] In the first step of the illustrated workflow, an exonuclease and a first oligonucleotide 36 are provided and contacted with an aptamer 20. The first oligonucleotide comprises a complementary region 38 to the adjacent sequence 32 located at the 3' end and an adapter sequence 40 (shown as CS1' as an example). The first oligonucleotide 36 is provided as a single-stranded oligonucleotide, which becomes at least partially double-stranded when contacted with the aptamer 20 having the complementary adjacent sequence 32. The adapter sequence 40 is located at 5' of the complementary region 38 and does not bind directly to the aptamer 20, but is coupled by complementary binding of the complementary region 38. The adapter sequence 40 provides a common adapter for PCR in the subsequent process.

[0061] The first oligonucleotide 36 and the exonuclease can be provided sequentially or together. In one embodiment, the exonuclease is a single-stranded or double-stranded exonuclease provided before the first oligonucleotide 36, so that the deprotection or reverse dT26 removal is performed on the single-stranded region of the aptamer 20. The exonuclease can be a single-stranded DNA 3' to 5' exonuclease, such as Exo I or can be ExoIII. The exonuclease removes the 3' reverse dT group from the 3' end of the aptamer 20 to allow the connection of the second oligonucleotide 42 including the complementary adapter sequence 44 (shown as CS1) to be combined with its complementary sequence through the splint connection process. The 3' end of the second oligonucleotide 42 is biotinylated 46. The second oligonucleotide 42 is provided as a single-stranded oligonucleotide, which becomes part of the double-stranded structure after combining with the adapter sequence 40. The 3' end of the aptamer 20 that allows the deprotection is connected to the 5' end of the second oligonucleotide 42 by the 3' terminal nucleotide of the adjacent sequence 32 through the binding of the ligase. Thus, the first oligonucleotide 36 includes a first portion, such as the complementary region 38 , that binds to the aptamer 20 , and a second portion, such as the adapter sequence 40 , that binds to the second oligonucleotide 42 .

[0062] After splinting to connect the second oligonucleotide 42 to the aptamer 20, the aptamer 20 includes a complementary adapter sequence 44 at the 3′ end and is therefore partially adapterized. A solid phase (that is, beads 50 bound to biotin) can be used to capture individual aptamers 20 and wash away any unbound first oligonucleotide 36 that is not bound to the aptamer 20. The first oligonucleotide 36 can be separated from the modified (adapted) aptamer 20. In one embodiment, the oligonucleotide 36 can be removed before or after the bead binding wash. This can occur using denaturation and annealing steps. After washing, extension from the primer 48 bound to the complementary adapter sequence 44 can produce a double-stranded DNA copy of the aptamer 20. When attempting to copy the aptamer 20, a polymerase that can tolerate modified bases can be used. The copy chain can be used to generate amplification products for DNA library preparation by available single-stranded library preparation methods, which can include additional ligation steps and / or use adapter-overhang primers for amplification using the copy chain as a template. The use of a universal or fixed adapter sequence 40 that does not vary between different adjacent sequences 32 associated with different aptamer binding sequences 24 allows all aptamers 20 of a set to be extended using a common primer 48. That is, while different first oligonucleotides 36 used with a set of aptamers may have different complementary regions 38 with correspondingly different sequences, all adapter sequences 40 between different first oligonucleotides may be the same. In addition, all second oligonucleotides 42 may have the same complementary adapter sequence 44.

[0063] Thus, for a given set of aptamers, a plurality of different first oligonucleotides 36 and the same second oligonucleotide 42 can form a probe set for use in conjunction with aptamer detection.

[0064] Embodiments of the present disclosure can be used in combination with dynamic range compression technology. For example, different aptamers retained in aptamer-based assays can exist in different ranges, depending on the overall abundance of their targets. The disclosed oligonucleotides connected or annealed to aptamer 20 can include affinity tags so that the bound aptamer is retained by affinity tag binding. By providing a pseudo oligonucleotide mixture without affinity tags, the overall retention of aptamers can be affected. That is, pseudo oligonucleotides will bind to aptamer 20 so that it cannot bind to oligonucleotides with affinity tags. Those aptamers 20 that are not composited with labeled oligonucleotides are not retained by affinity tag capture molecules (e.g., beads 50, affinity tag capture molecules linked to substrates), and can be removed (e.g., by magnetic-based technology) during the washing step of retaining beads 50. Therefore, by selecting more pseudo oligonucleotides, the abundant aptamers 20 in the mixture can be reduced, and by not using any pseudo oligonucleotides, low-concentration aptamers 20 can be relatively increased compared to other aptamers 20 in the mixture. In one example, an affinity tag (e.g., biotin 46) is present on the first oligonucleotide 36 but not on the second oligonucleotide 42. Because each individual oligonucleotide is specific for a particular aptamer 20, an appropriate ratio of pseudo first oligonucleotides (without an affinity tag) and reporter first oligonucleotides (with an affinity tag) can be selected to reduce retention of the individual aptamer 20 of interest by varying the pseudo:reporter ratio of the first oligonucleotide containing the complementary region 38 targeting the individual aptamer 20.

[0065] Figure 3An example of an indirect detection workflow using a reporter probe 60 is shown. The workflow shown shows a bimolecular arrangement in which an aptamer 20 hybridizes with a reporter probe 60 to form a bimolecular complex that can be retained by an affinity tag. The workflow includes a step of contacting the aptamer 20 with the reporter probe 60. The hybridization of the reporter probe 60 with the aptamer 20 is mediated by a complementary binding region 60 (denoted as H2). The reporter probe 60 includes an identification sequence 64 and primer sequences 66, 68 (shown as A14 and B15' as examples) for subsequent PCR. In this method, the hybridized reporter probe 60 is used as a template to extend the aptamer 20. In an embodiment, the template portion of the primer sequence 66 can form a mismatch with the reverse dT 26. If the available polymerase is a polymerase with 3' to 5' exonuclease activity, the polymerase can remove the 3' reverse dT group 26 by its exonuclease activity. The polymerase can be T7 DNA polymerase or any other polymerase with "3-5" activity. A polymerase can be used to extend the aptamer 20 (using the bound reporter probe 60) with the biotinylated nucleotide 72, using the aptamer 20 as a template. Alternatively, an exonuclease (double-stranded or single-stranded, such as ExoI or ExoIII) can be used for deprotection prior to contact with the reporter probe 60, and the polymerase can be provided to the reaction mixture as a separate enzyme, or the polymerase (e.g., taq) and exonuclease can be included as a mixture or kit.

[0066] This biotinylated nucleotide 72 can be used as a handle for the solid support to perform stringent washing and remove excess reporter probe 60 from the system. Adding a biotin group to the 3′ end of the aptamer 20 allows more aptamers 20 to bind to the reporter probe complementary binding region 62 and thus have a higher Tm and, if necessary, increased stringency. The retained reporter probe 60 can be amplified and sequenced.

[0067] The reporter probe 60 includes a complementary binding region 62, which can be selected to be long enough to selectively bind to the target aptamer 20. In the described embodiment, the complementary binding region 62 is 20 nucleotides long. In one embodiment, the length of the complementary binding region 62 can be 5-50 nucleotides. The reporter probe includes a non-hybridized region 74 extending away from the complementary binding region 62 and not hybridized with the aptamer 20. Therefore, the sequence of the non-hybridized region 74 can be selected to avoid being substantially complementary to the sequence of the aptamer 20. The non-hybridized region 74 can be used as a substitute for the aptamer 20 for detection. Therefore, the non-hybridized region 74 identification sequence 64 is unique to the individual aptamer 20. Therefore, different aptamers 20 are associated with corresponding different identification sequences 64 that are different from each other and are uniquely identified. In one embodiment, the unique identification sequence 64 is uniquely identified when considering barcode errors (e.g., 1-2 nucleotide sequence errors) during sequencing. In addition, the identification sequence 64 can be designed so that the identification sequence 64 is different from the aptamer sequence.

[0068] To facilitate detection, the non-hybridized region 74 may include a first adapter region 66 and a second adapter region 68 flanking the identification sequence 64 to facilitate amplification of the non-hybridized region 74 using universal or conservative primers to generate an amplified product as part of a sequencing library prepared for sequencing. The adapter regions 66, 68 can be part of an adapter sequence of a sequencing library. As shown, the length of the first primer region 66 is 14 nucleotides, and the length of the second adapter region 68 is 15 nucleotides. The length of the identification sequence 64 is 15 nucleotides. Therefore, as shown, the total length of the reporter probe 60 is, for example, 54 nucleotides.

[0069] As provided herein, identification sequences, for example, identification sequences 64 can include one or more nucleotide sequences that can be used to identify one or more specific aptamers 20. The identification sequence can be an artificial sequence. The identification sequence can include at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more continuous nucleotides. In some embodiments, the identification sequence includes at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more continuous nucleotides.

[0070] The length of the adapter as provided herein can be 5-50 nucleotides, such as 5-50 consecutive nucleotides. Thus, the total reporter probe length can be 20-200 nucleotides or more.

[0071] Figure 420a. The example workflow of different embodiments of the aptamer 20, wherein the poly-T region is incorporated in a template-independent manner. As an initial step, the aptamer 20a including a 3' reverse dT can have a 3' reverse dT group removed with a nuclease (e.g., a single-stranded nuclease). In the same reaction (or a subsequent reaction), terminal transferase (TdT) is used to add base 80 (poly T) to the 3' end of the aptamer 20a in a template-independent reaction. PolyT 80 can be used as a primer site for primer 86, which includes a polyA region 88 and a PCR primer region 90 (e.g., shown as A14). The single-stranded aptamer 20 is effectively copied into the copy strand 100 using a polymerase extension primer 86, and the adapter including the PCR primer region 90 is attached to the 5' end of the copy strand 100. After extension using a modified tolerant polymerase, a second adapter is required for PCR and sequencing. This can be added by A-tailing and connecting a second adapter 102 at the end of the duplex. Copied aptamers 20 can be amplified and sequenced as shown.

[0072] In multiple amplification cycles, the strand population including 5′ and 3′ adapter sequences will become predominant because the initial adapter 20 having only the first adapter 90 and the strands copied therefrom will not be picked up by the primer targeting the second adapter 102. The generated amplification products having adapters at both ends can form all or part of a sequencing library, which is used in a sequencing reaction to generate sequencing data.

[0073] Other embodiments of aptamer 20 can enter the workflow at different stages. For example, aptamer 20b including a conventional or unprotected 3′ end can be free of exonuclease treatment. Aptamer 20c modified with an aldehyde group at the 3′ end can also be excised based on polymerase proofreading activity or can be used for chemical biotinylation reactions. The aldehyde group can be used to protect the 3′ end from nucleases, and a variety of polymerases with aldehyde lesion removal activity can be used.

[0074] Figure 5 A reaction is shown in which the first oligonucleotide 112 is composed of a degenerate sequence 114 (NNNNN). Such a mixture of degenerate sequences 114 can be synthesized in a single reaction and provided to an aptamer set including a single aptamer 20. That is, relative to the reaction in which each oligonucleotide complementary to the aptamer 20 is synthesized separately. Figure 2, a degenerate sequence can be generated in a less complex manner. The first oligonucleotides 112 all include a common or shared adapter sequence 116 and a different degenerate sequence 114. Any first oligonucleotide having a complementary binding site on the aptamer 20 binds to provide an available binding site for the second oligonucleotide 115. Exonuclease deprotection and polymerase extension of the reverse dT end 26 allows the second oligonucleotide 115 including a common 3' adapter 118 to be directly connected to the 3' end of the aptamer 20. In this way, the 3' end of the aptamer 20 is adapter-encapsulated. Although the use of the degenerate sequence 114 can enable binding to a position of the aptamer 20 located 5' of the desired 3' end binding site, such binding will not provide a protruding 5' end of the first oligonucleotide 112 that allows splint ligation.

[0075] The 5′ end of aptamer 20 may be adapter-ligated, such as Figure 4 A polymerase extension from the first oligonucleotide 112 or primer 120 complementary to the adaptor 118 generates a copy strand 122. A ligation reaction can then be performed to add a 3′ adaptor 126 to the copy strand 122, as shown in FIG. Figure 4 For example, Figure 4 Subsequent amplification using primers complementary to the terminal adapters can be used to generate an amplification product having adapters on both ends. The amplification product can form all or part of a sequencing library, which is used in a sequencing reaction to generate sequencing data.

[0076] The presence of Cy3 dye at the 5′ end of aptamer 20, used as part of an aptamer-based assay, may render the ligation of the 3′ adapter to the copy strand inefficient ( Figure 4-5 ). To overcome this, one can use Figure 6 The oligonucleotide ligation nucleotide library preparation method shown in the present invention. Oligonucleotide ligation (oNTP) as discussed in WO2022251510A2 can be used, which document is incorporated herein by reference in its entirety for all purposes. oNTP utilizes the ability of a polymerase to catalyze the incorporation of nucleotides coupled to an oligonucleotide adapter (or other functional sequence). Therefore, in an embodiment, the desired sequence can be added to the 3′ end of the nucleic acid via a polymerase-mediated reaction rather than a ligation reaction, and the use of a polymerase allows a higher yield of the desired final product relative to ligation. As Figure 6As shown, the disclosed oligonucleotide modified nucleotide analogs include adapter sequences for incorporation into adapters during sequencing library preparation. Direct incorporation of modified nucleotides conjugated to sequencing adapters by polymerases improves the efficiency of library preparation and simplifies user workflows compared to ligase-mediated adapterization of nucleic acid samples. Embodiments also facilitate asymmetric adapterization of libraries, for example, with different 5′ and 3′ adapters to allow generation of strand libraries and paired-end sequencing.

[0077] oNTPs contain oligomers as modified linkages to base groups. It has been demonstrated that, following incorporation of one of these oNTPs, extension can occur from an adapter linked to the oNTP base that will pass through an uncommon "lesion" in the DNA and extend through the original DNA template used for oNTP addition. Thus, the adapter linked to the base can be added as a sequence to the 3' end of a nucleic acid. Figure 6 In the embodiment, the aptamer 20 may include an inverted dT protected end (removed by exonuclease) or a conventional end. In an embodiment, the 3′ end of the aptamer 20 may be tailed (dA tailing using TdT) to provide a reactive end. The oNTP 160 is added after the probe 150 is hybridized to the specific aptamer sequence, although as Figure 5 A degenerate method can be used in .

[0078] The oNTP nucleotide 161 is incorporated into the 3′ end of the aptamer 20 during the polymerase reaction. As shown, the 3′ end 152 of the probe 150 can be blocked (using ddNTP) so that the polymerase reaction that incorporates the oNTP at the 3′ aptamer end does not incorporate the oNTP onto the probe 150. For example, the oNTP adapter 162 directly linked to the oNTP-incorporating nucleotide 161 contains a sample index and sequencing primers (ME′ and B15′). In one embodiment, the oNTP adapter 162 has a blocked 3′ end to prevent incorporation by the polymerase during subsequent oNTP addition. A phosphatase can be used to process any unincorporated oNTP 160 so that excess oNTP 160 is not incorporated during the later addition of a second, different oNTP.

[0079] Once incorporated, a strand displacement polymerase can be used to prime from B15′ (using primer 166) and span across the oNTP base “lesion” and through aptamer 20, as shown. This effectively adds the 5′ adapter to the copy strand 170, which is the complementary sequence of the oNTP adapter 162. The same process can be repeated to add a second adapter 172 by polymerase incorporation at the 3′ end by adding a second oNTP 174. Polymerase incorporation can be more robust than ligation-based reactions and therefore can be unaffected by the presence of the tag 176 at the 56′ end of the aptamer 20. The copy strand 170 is the complementary sequence of the aptamer 20 and has the adapter sequence appended to both ends. The amplification product of the copy strand can be used to generate a sequencing library to generate sequencing data.

[0080] Figure 7-9 A variety of methods for deprotecting 3' and 5' sequences for library preparation are shown. The aptamer with 5'Cy3 is inert from library preparation at the 5' end in the same manner as the reverse dT at the 3' end. In the method shown, the complementary sequence is hybridized with aptamer 20 (anti-aptamer). The anti-aptamer can be full-length or partial-length. The aptamer 20 can be captured on the probe using an affinity tag, and if dynamic range compression is required, its signal can be titrated downward, as generally discussed herein. Using a combination of exonucleases and polymerases (3-5ssExo and 5-3 extension or 5-3ssExo), the aptamer hybridization complex can be "flattened" with the three different results shown. The choice of exonucleases / polymerases depends on the idT and Cy3 bond types, that is, phosphodiester, phosphorothioate or phosphoramidite. After flattening, three different double-stranded molecules can be used for template switching (polymerase extension library preparation) or direct connection of two or single adapters to the ends shown.

[0081] exist Figure 7 In the present invention, the aptamer 20 is annealed with the probe 200 to generate a partially double-stranded complex having overhangs on both sides of the aptamer 20. In addition, the probe 200 includes non-hybridized portions corresponding to the 3' end and the 5' end. The 3' overhangs of the aptamer 20 and the probe 200 can be removed by a 3' to 5' single-stranded exonuclease. Excess probe 200 can also be digested by the exonuclease.

[0082] The removal of the non-hybridized portion at the 3′ end can be completed after the affinity tag is retained and washed, so that the non-hybridized 3′ portion containing the affinity tag 210 exists to facilitate affinity tag-based technology. The 3′ end of the probe contains an affinity tag 210 (e.g., a biotin tag). In one embodiment, the probe 200 can be provided as a probe set that contains a mixture of a subset of pseudo probes 200b and a subset of capture probes (e.g., biotin-containing probes) 200a. The probes 200 can be otherwise identical in sequence, but include or exclude a biotin tag to facilitate dynamic range compression. Compared to the lower abundance aptamer 20, the higher abundance aptamer 20 can be provided with different pseudo: biotin probes 200. For example, relative to the lower abundance aptamer 20, the higher abundance aptamer 20 can have a higher proportion of pseudo probes. It should be understood that in an embodiment, the probe 200 can only include a biotin-containing probe 200a.

[0083] After retention and any dynamic range compression, a 3' to 5' exonuclease and 5' to 3' extension can be performed. This step can remove any attached affinity tag binding structures, such as beads or substrates. The 5' to 3' extension generates a blunt-ended double-stranded structure 220 using the 5' overhang as a template. The resulting double-stranded structure 220 with an adaptor on one end can be provided to a template switching library preparation protocol.

[0084] Figure 8 Shown include Figure 7 but wherein the probe 200 does not include a 5' adapter sequence 212 (see Figure 7 ). Therefore, Figure 7 The steps in generate a blunt-ended structure 230 without an adapter sequence 212 at one end. In this example, the blunt-ended double-stranded structure 230 can be provided to an adapter ligation technique to generate a partially adapterized or single-sided adapter-containing double-stranded structure 236.

[0085] As an alternative to providing a set of probes 200 having dummy probes 200b and biotin-containing probes 200a, probes 200 may include a set having modifications 240 at the 5' end that prevent adapter ligation and, therefore, subsequent library preparation steps. By adjusting the presence and / or ratio of dummy non-ligatable ends 240 in a population of probes 200, dynamic range compression may be achieved.

[0086] Fig. 9 Shown include Figure 8 Alternative arrangements of some of the steps. Figure 8 In the Figure 7The steps in generate a blunt-ended structure 230 without an adapter sequence 212 at one end. However, by using a 3′ to 5′ exonuclease and a 5′ to 3′ exonuclease, all single-stranded regions are digested, leaving a blunt-ended double-stranded structure 250. Adapters can be ligated to the two blunt ends to generate adapter-enhanced fragments 256.

[0087] As about Figure 8 As discussed, as an alternative to providing a set of probes 200 having dummy probes 200b and biotin-containing probes 200a, probes 200 may include a set having modifications 240 at the 5' end that prevent adapter ligation and, therefore, subsequent library preparation steps. By adjusting the presence and / or ratio of dummy non-ligatable ends 240 in a population of probes 200, dynamic range compression may be achieved.

[0088] Figure 10-13 An alternative method without reverse dT for initial protection of aptamers is shown. Fig.10 As shown, aptamer 20 may include a 5′ protecting group 300 and a 3′ group that can be conveniently removed using an effective enzyme in subsequent library preparation. Here, the 3′ end is protected by a nucleotide containing 3′O 302 (e.g., 3′O glycoside). The 3′O ABF nucleoside is effectively deprotected by incubation with ABFase, such as Fig.11 As shown. For the library preparation system, aptamer 20 is synthesized with 3'O protecting group 302. Figure 12-13 In the library preparation workflow shown, reporter oligonucleotides 320, 340 are hybridized to aptamer 20 and incubated with ABFase to deprotect the 3' end. Fig.12 The workflow shows an example of DNA polymerase extension, while Fig.13 The workflow of shows a DNA ligase example. Two options are shown for polymerase extension and ligation. Both methods will directly attach the adapter or barcode 322 (and its complementary sequence 330) to the aptamer 20. This method can be used as an alternative to any of the deprotection methods herein.

[0089] In certain embodiments, the aptamer in the aptamer-based assay can be detected by sequencing. However, the aptamer sequence may not be optimized for clarity or distinguishability in the sequencing results. That is, the aptamer can be designed with a sequence to optimize the analyte interaction, and any changes to these sequences may negatively affect the binding quality to improve the sequencing results. Therefore, it may be beneficial to detect alternative sequences, such as reporter probe identification sequences. For example, aptamer detection may involve indirect detection using a reporter probe, which is combined with an aptamer (e.g., hybridization) and is detected, for example, by sequencing. Therefore, the reporter probe may include an identification sequence associated with a specific aptamer, so that the presence of the identification sequence in the sequencing result is associated with the positive result of the presence of the aptamer and / or the associated analyte. The use of the reporter probe may allow the incorporation of additional detection functions. The reporter probe may be designed to allow downstream incorporation of sequencing adapters and / or may have other features to enhance amplification or sequencing. Report probes are provided herein, which include an integrated cleavage region and allow the identification sequence to be separated from the aptamer binding region. In this way, the identification sequence can be more effectively detected. In certain embodiments, separation can be completed without an initial amplification step.

[0090] Fig.14 An example workflow for combining a reporter probe that can be used in conjunction with an aptamer-based assay is shown. An aptamer-based assay can include an analyte contacting step and one or more separation steps to generate an eluate or solution containing the aptamer 350 shown. The aptamer 350 can include features that facilitate these assay steps, such as a label or dye (e.g., Cy5), shown here as being located at the 5′ end 356 of the aptamer and a blocking or protecting group located at the 3′ end 354 of the aptamer. In one embodiment, the blocking or protecting group provides resistance to exonucleases and endonucleases. In one embodiment, the 3′ cap is an inverted thymidine, such as a (3′-3′-linked) dT nucleotide. The aptamer 350 shown can be part of the assay eluate that is separated from other aptamers (not shown) that do not bind to the target and are not retained by the separation step.

[0091] Using the conserved sequence of the aptamer 350, a nucleic acid (e.g., DNA or RNA) reporter probe 358 can be designed. The reporter probe 358 includes an aptamer binding region 360 that is complementary to the aptamer 350. Therefore, the sequence of the aptamer binding region 360 is based on the sequence of the aptamer 350. The reporter probe 358 also includes a non-hybridized region 368 that extends away from the aptamer binding region 360 and does not hybridize with the aptamer 350. Therefore, the sequence of the non-hybridized region 368 can be selected to avoid being substantially complementary to the sequence of the individual aptamer 350 or the sequence of other aptamers 350. The non-hybridized region 368 can be used as a substitute for the aptamer 350 for detection. Therefore, the non-hybridized region 368 can include an identification sequence 372 that is unique to the individual aptamer 350. Therefore, different aptamers 350 are associated with corresponding different identification sequences 372 that are all different from each other and are uniquely identified. In one embodiment, the uniquely identified sequence is uniquely identified when barcode errors (e.g., 1-2 nucleotide sequence errors) are considered during sequencing. Furthermore, the identification sequence 372 can be designed such that the identification sequence 372 is different from and / or does not overlap with the aptamer sequence.

[0092] The non-hybridized region 368 may include an integral cleavage region 370. The cleavage region, although shown here in single-stranded form, forms a double-stranded cleavage site when double-stranded after extension as disclosed herein. In one embodiment, the cleavage region forms all or part of a restriction site to facilitate cleavage using an appropriate restriction enzyme. The cleavage region 370 may be conserved in all aptamers 350 so that only a single restriction enzyme is required to cleave the non-hybridized region. The cleavage site may be specific for double-stranded or single-stranded DNA cleavage.

[0093] In one embodiment, a unique molecular identifier (UMI) 374 can be incorporated into the reporter probe 358. The UMI 374 is a short sequence used to uniquely label each molecule in the sample library to provide error correction and reduce sequencing bias. Therefore, in one embodiment, different reporter probe molecules with the same aptamer binding region sequence can have different UMI sequences.

[0094] In the arrangement shown, the reporter probe 358 is shown with a 5' end 376 and a 3' end 378, such that the identification sequence 372 is 5' of the cleavage region 370. The cleavage region 370 is located between the identification sequence 372 and the aptamer binding region 360. In one embodiment, the aptamer binding region 360 is 3' of the cleavage region 370. In one embodiment, the aptamer binding region 360 extends to the 3' end 378.

[0095] The reporter probe 358 may include a UMI 374, an identification sequence 372, a linker sequence between the cleavage region 370 and / or the aptamer binding region 360. In one embodiment, in addition to the aptamer binding region 360 and / or the UMI 374, the individual reporter probes 358 may have a universal or conserved sequence.

[0096] The junction sequence can be conserved between different reporter probes 358 having corresponding different aptamer binding regions 360 and / or UMIs 374.

[0097] The reporter probe is complementary to aptamer 350 such that contact with aptamer 350 under hybridization conditions allows hybridization, e.g., binding. Thus, bound reporter probe 358 produces double-stranded region 362 and single-stranded non-hybridized region 368.

[0098] After hybridization, the 3' end 354 of the aptamer 350 can be deprotected. In one embodiment, deprotection can be by exonuclease treatment, such as by ExoI or EXoIII. In one embodiment, deprotection occurs by timed incubation. In certain embodiments, the incubation is a timed incubation at 37°C (e.g., 10 minutes) followed by a timed inactivation incubation at 70°C (e.g., 10 minutes).

[0099] Deprotection of the 3′ end 354 allows extension from the 3′ end 354 using the non-hybridized region 368 as a template. That is, the aptamer 350 acts as a primer for extension. Thus, after deprotection, polymerase extension can be performed using a polymerase 391, such as a taq polymerase using an appropriate buffer and dNTP reagent. In the case where the exonuclease is heat-inactivated, a thermostable polymerase can be provided in a single reagent mixture with the exonuclease.

[0100] In another embodiment, deprotection and extension can be accomplished using a polymerase with 3' to 5' exonuclease activity, such as taqplus. Other contemplated polymerases include NEB Q5, Pfu, Phi29, DNA pol, T4 Pol, Vent.

[0101] Extension from the 3' end of the aptamer 350 generates a strand 382 complementary to the non-hybridized region 368 and a double-stranded structure. In one embodiment, the cleavage region 370 can generate a restriction site 390 alone or when a complementary strand is present. In addition, the identification sequence 372 can be one or both of a sequence present on the non-hybridized region 368 or a complementary sequence.

[0102] The first double-stranded region 362 is separated from the second double-stranded region 388 by cleavage at the restriction site 390 using a restriction enzyme 392. Thus, the identification sequence 372 is no longer coupled to the associated aptamer 350. In one embodiment, this allows separation of the separated double-stranded regions 362, 388 for downstream sequencing steps. In one embodiment, the aptamer binding region 360 and / or the aptamer 350 can be coupled to a solid support (e.g., beads, substrate) so that the second double-stranded region 388 is cleaved from the solid support. In one embodiment, the arrangement can be reversed so that the second double-stranded region 388 is coupled to the solid support and the cleavage releases the aptamer 350 and the aptamer binding region 360, which can be removed by washing.

[0103] exist Fig.14 In the figure, a single aptamer type of an individual aptamer 350 is shown. It should be understood that the workflow shown can be extended to all aptamers in a multiplex aptamer-based assay in parallel. In addition, the assay eluate can include multiple aptamers 350, depending on the concentration of the target molecule of the aptamer 350 in the sample being evaluated. The aptamer 350 is a single-stranded nucleic acid with a fixed or substantially fixed nucleic acid sequence. Therefore, copies or multiples of the individual aptamer 350 can all share a conserved sequence. In one embodiment, the aptamer 350 can include modified nucleotides. Different aptamers, generally referred to as aptamers 350, can have different nucleic acid sequences relative to each other, which promotes different target specificities for the corresponding different aptamers 350, such as Figure 15-20 As usually shown in .

[0104] Fig.15 A workflow is shown including the steps of contacting a group 400 of different aptamers 350a, 14b, 14c with a group 404 of reporter probes 358a, 358b, 358c, 358d, 358e, 358f, 24g. Group 400 may be generated by an aptamer-based assay that uses a fixed or known population of aptamers 350. Following the aptamer-based assay, only a subset of aptamers 350 are retained based on their binding to an analyte present in the sample, represented by group 100. For uncharacterized samples, the concentration and / or type of aptamers 350 present in the sample eluate or solution may be unknown prior to detection.

[0105] The groups 400 and groups 404 shown are exemplary, and it should be understood that there may be more or fewer aptamers 350 and / or reporter probes 358. In one example, the group 404 may be a commercial group having a fixed number or composition of different types of reporter probes 358 specific to the aptamer 350 of interest. In one embodiment, the group 404 represents reporter probes 358 specific to all aptamers 350 used in the assay. In one embodiment, the aptamer-based assay uses at least 100, 500, 1000, or 50,000 different aptamers, and the group 404 has a corresponding number of different reporter probes 358.

[0106] The length of the reporter probe 358 can be based on the length of the individual aptamers 350. In one embodiment, the reporter probes 358 have the same length within the group 404 or have variable lengths relative to each other. In one embodiment, the length of the reporter probes is 30-200 nucleotides. The group 404 can be provided as a mixture of different reporter probes in a single-stranded state. Therefore, the sequence of the reporter probe 358 can be designed to avoid cross-complementation.

[0107] Fig.16 Hybridization of reporter probes 358a, 358b, 358c specific for aptamers 350a, 350b, 350c of population 100 is shown to produce aptamer-reporter probe complex 410. Other reporter probes 358d, 358e, 358f, 358g do not have corresponding aptamers 350 in population 100, and thus single-stranded reporter probe subset 412 is produced.

[0108] For example, Fig.17 Deprotection of the 3′ end 354 of the reporter probes 358a, 358b, 358c in the complex 410 using an exonuclease 380 is shown. As discussed herein, deprotection can include a heat inactivation step. However, in other embodiments, the reaction can be isothermal. Furthermore, in certain embodiments, deprotection can be accomplished using a DNA polymerase with exonuclease activity (such as DNA Pol 1). Fig.18 The deprotected end 354 ( Fig.17 ) to produce a double-stranded structure after the aptamer-reporter probe complex 410. Thus, the aptamers 350a, 14b, 14c are extended using the sequence of the reporter probes 358a, 358b, 358c as a template. This produces a strand having a sequence complementary to the full length of the reporter probes 358a, 358b, 358c.

[0109] like Fig.19As shown, cleavage at cleavage region 370 separates the first double-stranded region 36a, 36b, 36c from the second double-stranded region 388a, 388b, 388c of each complex 410. The remaining single-stranded reporter probe 358 of the unbound subset 412 can be digested so that only the double-stranded structure remains, as shown in FIG. Fig. 20 After digestion of any unbound reporter probes 358, the second double-stranded region 388 can be processed and detected. Digestion or removal of the subset 412 of unbound reporter probes 358 prevents false positives in subsequent detection steps.

[0110] As described above, the second double-stranded region 388 can be separated by elution or by using a solid phase carrier. However, in certain embodiments, the separation step may not be performed because only the second double-stranded region 388 can be an operable substrate for the downstream library preparation step. For example, the cleavage end can be a substrate for sequencing adapters. In one embodiment, the second double-stranded region 388 may include a primer binding region that allows the adapter to be incorporated by amplification. In one embodiment, the second double-stranded region 388 can be captured using an affinity tag, such as a capture bead coupled to an affinity tag binding agent. In one embodiment, each reporter probe 358 can be provided with an affinity tag. However, other arrangements are also contemplated, including column-based, flow cell-based or substrate-based separations using capture entities bound to affinity tags. After separation, the sample undergoes a sequence library preparation step, which is shown as being connected to a PCR reaction. However, other preparation workflows are also contemplated, such as direct amplification, stepwise PCR, or other amplification and / or connection preparations as discussed herein. The end product of this workflow includes oligonucleotide fragments, which can then be sequenced as part of a sequencing reaction to generate sequence data.

[0111] Fig.21 An exemplary adapterization technique is shown that can be used to make the isolated double-stranded region 388 including the identification sequence 372 conform to the input of the sequencing library preparation, or in embodiments conform to the sequencing library including the adapterized fragments 220 that can be sequenced to generate sequence data. Thus, the disclosed embodiments can provide the advantage of incorporating one or more sequencing library preparation steps into the detection of the aptamer 350 in embodiments. In addition, the disclosed embodiments can allow certain steps of the sequencing library preparation to be omitted or combined, thereby improving the detection efficiency. In embodiments, the disclosed embodiments also relate to sequencing technologies that allow sequence data to be generated from sequence reads.

[0112] Adaptors 420 can be incorporated into isolated double-stranded region 388 by ligation and / or by one or more amplification steps. In certain embodiments, reporter probe 358 can include a conserved primer region for subsequent incorporation of the adaptor by amplification.

[0113] Embodiments of the present disclosure include indirect detection of aptamers by deprotection and extension techniques, such as those described in Figure 2 Generally shown and discussed. During extension, a biotinylated or affinity-tagged nucleotide or sequence is added to the 3' end of the aptamer, which allows hybridization capture by the label. Detection can be performed using the reporter probes discussed.

[0114] Fig.22A and Fig. 22B Results from an assay demonstrating that when in place, the reverse dT serves to protect the 3′ end of the aptamer from polymerase extension are shown. Table 1 shows the assay conditions. In some cases, the aptamer can be in a sodium perchlorate buffer to inhibit enzyme activity. In this case, the reaction volume should be increased to dilute the perchlorate buffer, and the reaction buffer components can be adapted to have low salt (e.g., NaCl) or ionic strength.

[0115] Table 1: Aptamer extension assay conditions

[0116]

[0117] ExoIII can remove the reverse dT from the 3′ end of the DNA oligonucleotide. The 5′-Cy3 DNA oligomer is hybridized to the longer unlabeled oligomer so that the Cy-3 labeled oligomer is double-stranded and the unlabeled oligomer has a 5′-overhang. After enzyme treatment, the products are analyzed by 10% TBE-UREA gel electrophoresis and Cy3 detection. Fig.22A In the present invention, hybridized 5'-Cy3 DNA oligomers (DNA) without 3' modification can be extended by polymerase (Pol) with dNTPs. Treatment with 3' to 5' exonuclease ExoIII under these reaction conditions is not sufficient to completely digest the DNA oligomers or the extended DNA. Fig. 22B In the experiment, the hybridized 5′-Cy3 DNA oligomer with 3′ reverse dT (DNA-T) cannot be extended by the polymerase (Po1) with dNTP. Treatment with 3′ to 5′ exonuclease ExoIII and polymerase allows DNA extension by removing the 3′ reverse dT by ExoIII, thus allowing polymerase extension. The 5′-Cy3 oligomer runs on the gel as a band for the ssDNA Cy-3 labeled oligomer and a higher band for the dsDNA Cy-3 labeled oligomer: extension oligomer.

[0118] Fig.23A Data from a model system are shown demonstrating that DNA with inverted dT can be deprotected by ExoIII and extended by a polymerase with multiple biotinylated nucleotides and is inert to extension in the absence of deprotection. Fig. 23BData from a model system are shown demonstrating that DNA with inverted dT can be deprotected by ExoIII and extended by a polymerase with biotinylated nucleotides and is inert to extension without deprotection. A 5Cy-3 DNA oligomer is hybridized to a longer unlabeled oligomer such that the Cy3 labeled oligomer is double stranded and the unlabeled oligomer has a 5′ overhang. After enzyme treatment, the products are analyzed by 10% TBE-UREA gel electrophoresis and Cy3 detection. The polymerase Pol can incorporate biotinylated dNTPs such as dCTP-biotin ( Fig.23A ) or a biotinylated dNTP with a 3′ block, such as FFC-biotin ( Fig. 23B ), generating extended DNA with multiple biotinylated nucleotides or a single terminal biotinylated nucleotide, respectively. The polymerase can only extend DNA oligomers with 3′ inverted dT after ExoIII deprotection.

[0119] Fig.24 An example reporter having an identification sequence or ID at the 3' end is shown, and Fig.25 An example reporter having an identification sequence or ID at the 5' end is shown. The reporter probe can hybridize with an aptamer having an overhang at the 5' end of the reporter, as shown in (1) in the figure shown. The 5' overhang can include a base complementary to the incorporated biotinylated nucleotide. For example, the sequence can include a G to incorporate biotinylated FFC-biotin in the enzyme reaction mixture. The reporter can be purified after synthesis to ensure full length. A 5' aldehyde (as shown in reference (2)) can be incorporated at the 5' end of the reporter to facilitate reporter purification. The reporter hybridization region can be the full length of the aptamer or shorter to facilitate manufacturing accuracy. In one embodiment, the identification sequence is flanked by adapter sequences to facilitate PR-based library preparation techniques for NGS (shown as references (3) and (4)). The reporter can be protected at the 3′ end to prevent modification during the assay, for example, if the 3′ end becomes double-stranded, the reporter is directly biotinylated by a polymerase, or digested by an exonuclease. The protection can be a dideoxynucleotide added to the 3′ end via an RP-isomer phosphorothioate linkage (ddN*) (as shown in reference (5)), which will resist both ExoIII digestion and DNA polymerase extension.

[0120] Fig.26 The deprotection and extension workflow is shown. Fig. 27 A proof of concept for the aptamer is shown showing that the 3' inverted dT can be removed and after removal extension with biotinylated nucleotides occurs. The deprotection and extension reactions considered are shown in Table 2.

[0121] Table 2: Deprotection and extension reaction considerations

[0122]

[0123] In the illustrated workflow, a single aptamer of a single aptamer type is shown, such as aptamer 20 and / or aptamer 350. In addition, the assay eluate may include multiple aptamers. An aptamer may be a single-stranded nucleic acid having a fixed or substantially fixed nucleic acid sequence. Thus, copies or multiples of a single aptamer may all share a conserved sequence. Different aptamers, often referred to as aptamers, may have different nucleic acid sequences relative to each other, which promotes different target specificities for the respective different aptamers.

[0124] In certain embodiments of the present disclosure, the disclosed probes may include one or more conserved regions, such as conserved primer regions, e.g., a first conserved primer region and a second conserved primer region. The conserved region is conserved between at least some other probes of the probe set, such that the conserved region has the same or similar nucleotide sequence compared between the probes.

[0125] One or more probes as discussed herein may include affinity tags. Affinity tags can be used for a variety of applications, such as large separations of target nucleic acids that hybridize with hybridization tags. As used herein, the term "affinity tag" and grammatical equivalents may refer to components of a multi-component complex, wherein the components of the multi-component complex specifically interact or bind to each other. For example, an affinity tag may include biotin or poly-His that can bind streptavidin or nickel, respectively. Other examples of multi-component affinity tag complexes are listed in, for example, U.S. Patent Application Publication No. 2012 / 0208705, U.S. Patent Application Publication No. 2012 / 0208724, and International Patent Application Publication No. WO 2012 / 061832, each of which is incorporated by reference in its entirety.

[0126] The disclosed embodiments may include a composition of one or more primers and / or probes. The probes and / or primers of the disclosed embodiments are designed to be complementary to a target sequence (a target sequence of a sample or other probe sequence) so that the target sequence and the probe of the present invention hybridize. As outlined below, this complementarity does not have to be perfect; there may be any number of base pair mismatches, which interfere with the hybridization between the target sequence and the single-stranded nucleic acid of the present invention. However, if the number of mutations is so large that hybridization cannot occur even under the least stringent hybridization conditions, the sequence is not a complementary target sequence. Therefore, the so-called "substantially complementary" herein means that the probe is fully complementary to the target sequence to hybridize under normal reaction conditions.

[0127] A variety of hybridization conditions can be used in the present invention, including high, medium and low stringency conditions. Longer sequences specifically hybridize at higher temperatures. Generally speaking, stringent conditions are selected to be about 5°C-10°C lower than the thermal melting temperature (Tm) of a specific sequence at a determined ionic strength and pH. Tm is the temperature (under a determined ionic strength, pH and nucleic acid concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (due to the excessive presence of the target sequence, at Tm, 50% of the probes are occupied at equilibrium). Stringent conditions are conditions where the salt concentration is less than about 1.0M sodium ions, typically about 0.01M to 1.0M sodium ion concentration (or other salts), the pH is 7.0 to 8.3, and the temperature is at least about 30°C for short probes (e.g., 10 to 50 nucleotides) and at least about 60°C for long probes (e.g., greater than 50 nucleotides).

[0128] In certain embodiments, the probe contact step can be run under stringent conditions that allow hybridization complexes to be formed only in the presence of the target. Strictness can be controlled by changing step parameters (including but not limited to temperature, formamide concentration, salt concentration, chaotropic salt concentration, pH, organic solvent concentration, etc.) as thermodynamic variables. The size of the primer nucleic acid can vary, and as understood by those skilled in the art, the length generally varies between 5 to 500 nucleotides. Primer can be between 10 and 100, between 15 and 50, and between 10 and 35, depending on purposes and amplification techniques.

[0129] In certain embodiments, reporter probe 358 is single-stranded or part of a double-stranded structure including a restriction enzyme cleavage site having a sequence that can be cleaved by a restriction enzyme. The restriction enzyme can be a type I enzyme (EC 3.1.21.3), a type II enzyme (EC 3.1.21.4), a type III enzyme (EC 3.1.21.5), or a type IV enzyme (EC 3.1.21.5). Restriction enzymes can include, for example, Alu I, Ava I, Bam HI, Bgl II, Eco P15 I, Eco RI, Eco RII, Eco RV, HaeIII, Hga I, HhaI, HindIII, HinfI, HpaI, KpnI, Mbo I, NotI, PstI, PvuII, Sac I, Sal I, Sau3A, Sca I, Sma I, Spe I, Sph I, Sst I, Stu I, Taq I, Xba I, or Xma I. The restriction enzyme can be a recombinant restriction enzyme. In one embodiment, the restriction enzyme cleavage is a blunt end cleavage. In one embodiment, the restriction enzyme cleavage is a sticky end cleavage. Therefore, the cleavage region 40 can form a double-stranded restriction site when it is double-stranded.

[0130] In one embodiment, the cleavage region, such as cleavage region 370, can use guide RNA to form the cleavage site of the CRISPR-Cas system when it is double-stranded. The CRISPR-Cas system provided herein includes an engineered and / or programmed nuclease system derived from a naturally occurring CRISPR-Cas system. In one embodiment, the CRISPR-Cas system is a CRISPR-Cas9 system. The CRISPR-Cas system may include an engineered and / or mutated Cas protein. The CRISPR-Cas system may contain an engineered and / or programmed guide RNA. In some embodiments, the crRNA or its derivative provided herein is a polynucleotide having a crRNA polynucleotide fused to a tracrRNA polynucleotide. In one embodiment, the Cas protein or its variant provided herein can be directed to any genomic locus by a chimeric sgRNA, followed by a 5′-NGG prototype spacer adjacent motif (PAM). For example, in some embodiments, crRNA and tracrRNA are synthesized by in vitro transcription using a synthetic double-stranded DNA template containing a T7 promoter. The tracrRNA can have a fixed sequence, and the target sequence determines a portion of the sequence of the crRNA. Equimolar concentrations of crRNA and tracrRNA were mixed and heated at 55°C for 30 seconds. Cas9 was added at the same molar concentration at 37°C and incubated with the RNA mixture for 10 minutes. A 10-20-fold molar excess of Cas9 complex was then added to the target DNA. The binding reaction can occur within 15 minutes.

[0131] The disclosed technology relates to one or more applications, such as aptamer detection in the eluate for analyzing aptamer-based determinations. These technologies can be a part of sequencing library preparation, which can include oligonucleotide adapters, for example, which can be coupled to reporter probes for downstream sequencing. The adapter can be integrated with the probe and / or can be coupled in any other suitable manner. In some embodiments, the adapter is introduced in a multi-step process (such as a two-step process), and the multi-step process involves connecting a portion of the adapter to a target polynucleotide with a universal primer sequence. The second step includes extending using a primer, such as by PCR amplification, and the primer includes a 3' end with a sequence complementary to the attached universal primer sequence and a 5' end of other sequences containing the adapter. By way of example, such extensions can be performed as described in U.S. Patent No. 8,053,192, which is incorporated herein by reference in its entirety. Additional extensions can be performed to provide additional sequences connected to the 5' ends of the polynucleotides obtained by the previous extension.

[0132] In some embodiments, the adapter can be connected to the reporter probe. Any suitable adapter can be attached to the target polynucleotide (such as the reporter probe) via any suitable process (such as those discussed herein). The adapter can include a library-specific index tag sequence (e.g., i5, i7). Before the sample is fixed for sequencing, the index tag sequence can be attached to the target polynucleotide from each library. The index tag itself is not formed by a part of the target polynucleotide, but becomes a part of the amplification template. The index tag can be a synthetic nucleotide sequence added to the target as a part of the template preparation step. Therefore, the library-specific index tag is a nucleic acid sequence tag attached to each target molecule of a specific library, which is indicated or used to identify the library from which these target molecules are separated. In one embodiment, the length of the index tag sequence is 20 nucleotides or less nucleotides. For example, the length of the index tag sequence can be 1 to 10 nucleotides, or 4 to 6 nucleotides. Tetranucleotide index tags provide the possibility of multiplexing 256 samples on the same array, and six base index tags enable 4,096 samples to be processed on the same array. Adaptors can contain more than one index tag, thereby increasing multiplexing possibilities.

[0133] In addition to the index tag sequence, the adapter may also include any other suitable sequence. For example, the adapter may include a universal extension primer sequence, which is generally located at the 5' end or 3' end of the adapter and the resulting polynucleotide for sequencing. The universal extension primer sequence can hybridize with a complementary primer bound to a solid substrate surface. The complementary primer includes a free 3' end, from which a polymerase or other suitable enzyme can add nucleotides to extend the sequence using the hybridized library polynucleotide as a template so that the reverse strand of the library polynucleotide is coupled to the solid surface. Such extensions can be part of a sequencing run or cluster amplification.

[0134] In some embodiments, the adapter includes one or more universal sequencing primer sequences. The universal sequencing primer sequence can be combined with a sequencing primer to allow the index tag sequence, the target sequence, or the index tag sequence and the target sequence to be sequenced. In some embodiments, the disclosed reporter probe (e.g., reporter probe 24) may include a "sequencing adapter" or a "sequencing adapter site", that is, a region containing one or more sites that can hybridize with a primer. In some embodiments, a sequence may include at least a first primer site for amplification, sequencing, etc.

[0135] After the adapter is incorporated, the disclosed reporter probe can be sequenced. In one example, sequencing can be performed by Illumina's sequencing by synthesis and sequencing chemistry based on reversible terminators. Illumina's sequencing technology relies on attaching fragmented genomic DNA to a flat, optically transparent surface to which oligonucleotide anchors are bound. The template DNA is end-repaired to generate 5'-phosphorylated blunt ends, and a single A base is added to the 3' end of the blunt phosphorylated DNA fragment using the polymerase activity of the Klenow fragment. This addition prepares DNA fragments for connection to oligonucleotide aptamers, which have overhangs of a single T base at their 3' ends to increase connection efficiency. The adapter oligonucleotide is complementary to the flow cell anchor. Under limiting dilution conditions, the adapter-modified single-stranded template DNA is added to the flow cell and fixed by hybridization with the anchor. The attached DNA fragments are extended and bridge-amplified to produce an ultra-high density sequencing flow cell with hundreds of millions of clusters, each containing about 1,000 copies of the same template. In one embodiment, the randomly fragmented genomic DNA is amplified using PCR before it is cluster amplified. Alternatively, a non-amplified genomic library preparation is used, and only cluster amplification is used to enrich the randomly fragmented genomic DNA. The template is sequenced using a robust four-color DNA sequencing-by-synthesis technique that uses a reversible terminator with a removable fluorescent dye. Laser excitation and total internal reflection optics are used to achieve high sensitivity fluorescence detection. The sequence is compared to a truth table or a stored correlation between the aptamer identity and the identification sequence using a specially developed data analysis pipeline software.

[0136] In some embodiments, one or more nucleic acids, such as aptamers 14 or reporter probes 24 may include a label or dye that functions as a detection moiety. In some embodiments, the detection moiety is a hapten that can be detected by a binding partner-fluorescent moiety conjugate. In some embodiments, the rbNTP conjugate comprises one or both of a fluorescent moiety and a hapten connected to the rbNTP by one or more joints. In some embodiments, the hapten is biotin, digoxin (DIG) or dinitrophenol (DNP). In some embodiments, the hapten is detected by a binding partner-fluorescent moiety conjugate. In some embodiments, the binding partner is a small molecule or an antibody or a fragment thereof, such as streptavidin, anti-DIG or anti-DNP. In some embodiments, the detection moiety is an optically detectable moiety, such as a fluorescent moiety or a derivative thereof.Optically detectable moieties according to the disclosed embodiments include, but are not limited to, fluorescein and fluorescein derivatives such as carboxyfluorescein, tetrachlorofluorescein, hexachlorofluorescein, carboxynaphthofluorescein, fluorescein isothiocyanate, NHS-fluorescein, iodoacetamide fluorescein, fluorescein maleimide, SAMSA-fluorescein, fluorescein thiosemicarbazide, carbohydrazinomethylthioacetamidofluorescein, rhodamine and rhodamine derivatives such as TRITC, TMR, lissamine rhodamine, and fluorescein derivatives. rhodamine), Texas Red, Rhodamine B, Rhodamine 6G, Rhodamine 10, NHS-rhodamine, TMR-iodoacetamide, lissamine rhodamine B sulfonyl chloride, lissamine rhodamine B sulfonyl hydrazide, Texas Red sulfonyl chloride, Texas Red hydrazide, coumarin and coumarin derivatives such as AMCA, AMCA-NHS, AMCA-sulfo-NHS, AMCA-HPDP, DCIA, AMCE-hydrazide, BODIPY and derivatives such as BODIPY FL C3-SE, BODIPY 530 / 550C3, BODIPY 530 / 550C3-SE, BODIPY 530 / 550C3 hydrazide, BODIPY 493 / 503C3 hydrazide, BODIPY FL C3 hydrazide, BODIPY FL IA, BODIPY 530 / 551IA, Br-BODIPY493 / 503, Cascade Blue and derivatives such as Cascade Blue acetyl azide, Cascade Blue cadaverine, Cascade Blue ethylenediamine, Cascade Blue hydrazide, Fluorescent Yellow and derivatives such as Fluorescent Yellow iodoacetamide, Fluorescent Yellow CH, Cyanine and derivatives such as indole-based cyanine dyes, benzindolium-based cyanine dyes, pyridinium-based cyanine dyes, thiazolium-based cyanine dyes, quinolinium-based cyanine dyes, imidazolium-based cyanine dyes, Cy 3, Cy5, lanthanide chelates and derivatives such as BCPDA, TBP, TMT, BHHCT, BCOT, europium chelates, terbium chelates, Alexa Fluor dyes, DyLight dyes, Atto dyes, LightCycler Red dyes, CAL Flour dyes, JOE and their derivatives, Oregon Green dye (OregonGreen dye), WellRED dyes, IRD dyes, phycoerythrin and phycobilin dyes, malachite green, stilbene, DEG dyes, NR dyes, and / or near-infrared dyes.

[0137] The adaptors disclosed herein may include It should be understood that these are examples only and that any of the disclosed arrangements can be used in conjunction with the disclosed techniques. Adapters can include adapter sequences, such as those used during amplification. Examples of sequences of primers 1 and 2 or their complementary sequences in sequencing preparations A14 and B15. In other embodiments, universal capture primer sequences and / or sample index sequences can be incorporated into oligonucleotides generated by reporter probes 358, such as by amplification and / or connection and extension. Certain arrangements including indexes can incorporate custom or bridging primers during sequencing to accommodate different indexes. Other embodiments can include, for example, custom options for sequencing libraries using single reads from surface P5, or custom options for dark sequencing added by synthesis cycles, where common sequences are present in adapter regions.

[0138] Adapter sequences A14-ME, ME, B15-ME, ME', A14, B15, and ME are provided below and can be used alone or in combination with the disclosed adapters. In certain embodiments, the adapter sequence can be directly incorporated into the reporter probe 358. Example adapter sequences are provided and can be used in conjunction with the disclosed embodiments as part of the library preparation technique. However, other adapter sequences are also contemplated. Adapter sequences A14-ME, ME, B15-ME, ME', A14, B15, and ME are provided below:

[0139] A 14-ME: 5′-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3′ (SEQ ID NO: 1)

[0140] B 15-ME: 5′-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3′ (SEQ ID NO: 2)

[0141] ME′: 5′-phos-CTGTCTCTTATACACATCT-3′ (SEQ ID NO: 3)

[0142] A14: 5′-TCGTCGGCAGCGTC-3′ (SEQ ID NO: 4)

[0143] B15: 5′-GTCTCGTGGGCTCGG-3′ (SEQ ID NO: 5)

[0144] ME: AGATGTGTATAAGAGACAG (SEQ ID NO: 6)

[0145] Modified aptamers and / or reporter probes as disclosed herein may include those having a universal The capture primer sequence is in the region or The region to which the capture primer specifically hybridizes. Capture primers include, for example, P5 5′-AATGATACGGCGACCACCGA-3′ ((SEQ ID NO: 7)) or P7 (5′-CAAGCAGAAGACGGCATACGA-3′ (SEQ ID NO: 8)) or fragments thereof. The region to which the capture primer specifically hybridizes may include, for example The reverse complement sequence of capture primer P5 ("anti-P5": 5'-TCGGTGGTCGCCGTATCATT-3' (SEQ ID NO: 9) or P7 ("anti-P7": 5'-TCGTATGCCGTCTTCTGCTTG-3' (SEQ ID NO: 10)) or fragments thereof.

[0146] The conserved primer region may additionally or alternatively include The region of the sequence of the sequencing primer or its fragment, or The region to which a sequencing primer or its fragment specifically hybridizes. Sequencing primers include, for example, SBS3 (5′-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ (SEQ ID NO: 11)) or SBS8 (5′-CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT-3′ (SEQ ID NO: 12)). The region to which a sequencing primer or fragment thereof specifically hybridizes may include, for example Sequencing primers SBS3 (“anti-SBS3”: 5′-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT-3′ (SEQ ID NO: 13)) or SBS8 (“anti-SBS8”:

[0147] 5'-AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG-3' (SEQ ID NO: 14)) or the reverse complement sequence of a fragment thereof. Incorporation of the sequencing primer sequence into the reporter probe can be direct or via subsequent amplification, ligation or other sequencing library preparation steps.

[0148] In one embodiment, the disclosed amplification products include amplification products that are different from each other based on different identification sequences but have conserved or universal primer regions. In this way, a single primer set can be used to amplify oligonucleotides with variable identification sequences. Library preparation kits are provided herein, which include primers that can produce amplification products with incorporated adapters to generate sequencing libraries. The kit can include aptamer-binding oligonucleotides and corresponding primers as discussed herein.

[0149] In one embodiment, sequencing can be performed using NGS Primers. The following primers are shown by way of example.

[0150] Read 15′TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3′ (SEQ ID NO: 15)

[0151] Read 25′GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG (SEQ ID NO: 16)

[0152] Paired-end read 15′ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO: 17)

[0153] Paired-end read 25′CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT (SEQ ID NO: 18)

[0154] Index 1 read 5′CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG (SEQ ID NO: 19)

[0155] Index 2 read 5′AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC (SE Q IDNO: 20)

[0156] It will be appreciated that the index read primers can be designed to include a specific index sequence associated with a specific sample in an aptamer-based assay. Thus, the index primer may have a nucleotide region shown as i5 or i7 whose sequence differs between different samples in a multiplex. Other samples in the run may be prepared with primers including their corresponding indexes. Thus, certain sequence reads may be obtained with universal primers, while other sequence reads may be obtained with primers or mixtures of primers specific to the index of one or more samples in the multiplex reaction.

[0157] In one embodiment, the adapter sequence may include CS1 consensus sequence 1 (CS1) (5'-ACACTGACGACATGGTTCTACA-3') (SEQ ID NO: 21) or consensus sequence 2 (CS2) (5'-TACGGTAGCAGAGACTTGGTCT-3') (SEQ ID NO: 22), which are universal primer sequences used for Illumina's MiSeq amplicon tagging and indexing. It should be understood that the generated sequencing library may include double-stranded fragments having the disclosed adapter sequence on one strand and a complementary sequence on the opposite strand.

[0158] In one embodiment, a unique molecular identifier (UMI) can be incorporated into an oligonucleotide as provided herein, for example by ligation. A UMI is a short sequence used to uniquely label each molecule in a sample library to provide error correction and reduce sequencing bias.

[0159] Fig.14Schematic diagram of a sequencing device 500 that can be used in conjunction with the disclosed embodiments for obtaining sequencing data for identification sequences and / or index sequences as generally discussed herein. The sequencing device 500 can be implemented according to any sequencing technology, such as those incorporating sequencing-by-synthesis methods described in U.S. Patent Publication Nos. 2007 / 0166705, 2006 / 0188901, 2006 / 0240439, 2006 / 0281109, 2005 / 0100900, U.S. Patent No. 7,057,026, WO05 / 065814, WO06 / 064199, WO 07 / 010,251, the disclosures of which are incorporated herein by reference in their entirety. Alternatively, sequencing-by-ligation technology can be used in the sequencing device 500. Such techniques use DNA ligase to incorporate oligonucleotides and identify the incorporation of such oligonucleotides, and are described in U.S. Pat. No. 6,969,488; U.S. Pat. No. 6,172,218; and U.S. Pat. No. 6,306,597; the disclosures of which are incorporated herein by reference in their entirety. Some embodiments may utilize nanopore sequencing, whereby a target nucleic acid strand or nucleotides removed from a target nucleic acid exotomy pass through a nanopore. As the target nucleic acid or nucleotide passes through the nanopore, each type of base can be identified by measuring the fluctuations in the conductivity of the pore (U.S. Pat. No. 7,001,792; Soni & Meller, Clin. Chem. 53, 1996-2001 (2007); Healy, Nanomed 2, 459-481 (2007); and Cockroft et al., J Am. Chem. Soc. 130, 818-820 (2008), the disclosures of which are incorporated herein by reference in their entirety). Some other embodiments include detecting the proton released when nucleotides are incorporated into extension products. For example, sequencing based on the detection of releasing protons can use the commercially available electrical detectors and related technologies available from Ion Torrent Company (Guilford, CT, Life Technologies subsidiary) or the sequencing methods and systems described in US2009 / 0026082A1, US2009 / 0127589A1, US2010 / 0137143A1 or US2010 / 0282617A1, each of which is incorporated herein by reference in its entirety. Specific embodiments can utilize the method for real-time monitoring related to DNA polymerase activity.Nucleotide incorporation can be detected by fluorescence resonance energy transfer (FRET) interactions between a polymerase carrying a fluorophore and a γ-phosphate labeled nucleotide or by using a zero-mode waveguide, as described, for example, in Levene et al., Science 299, 682-686 (2003); Lundquist et al., Opt. Lett. 33, 1026-1028 (2008); Korlach et al., Proc. Natl. Acad Sci. USA 105, 1176-1181 (2008), the disclosures of which are incorporated herein by reference in their entirety. Other suitable alternative technologies include, for example, fluorescent in situ sequencing (FISSEQ) and massively parallel signature sequencing (MPSS). In a particular embodiment, the sequencing device 500 can be a HiSeq, MiSeq, or HiScanSQ from Illumina (La Jolla, CA). In other embodiments, sequencing apparatus 500 may be configured to operate using a CMOS sensor having nanowells fabricated over the photodiodes such that DNA deposition is aligned one-to-one with each photodiode.

[0160] The sequencing device 500 can be a "single channel" detection device, in which only two of the four nucleotides are labeled and detectable for any given image. For example, thymine can have a permanent fluorescent label, while adenine uses the same fluorescent label in a separable form. Guanine can be permanently dark, and cytosine can be dark initially, but can have added labels during the cycle. Therefore, each cycle can involve an initial image and a second image, in which the dye is cleaved from any adenine and added to any cytosine, so that only thymine and adenine are detectable in the initial image, but only thymine and cytosine are detectable in the second image. Any base that is dark through two images is guanine, and any base that is detectable through two images is thymine. The base that is detectable in the first image but not in the second image is adenine, and the base that is not detectable in the first image but detectable in the second image is cytosine. By combining the information from the initial image and the second image, a single channel can be used to distinguish all four bases.

[0161] In the depicted embodiment, the sequencing device 500 includes a separate sample processing device 502 and an associated computer 504. However, as described above, these can be implemented as a single device. In addition, the associated computer 504 can be located locally in the sample processing device 502 or networked or otherwise communicated with it. In the depicted embodiment, the biological sample can be loaded onto a sample substrate 510 (e.g., a flow cell or a slide) in the sample processing device 502, and the sample substrate is imaged to generate sequence data. For example, the reagent interacting with the biological sample emits fluorescence at a specific wavelength in response to the excitation light beam generated by the imager 512, and thus returns radiation for imaging. For example, the fluorescent component can be generated by a fluorescently labeled nucleic acid, which hybridizes with a complementary molecule of the component or with a fluorescently labeled nucleotide incorporated into an oligonucleotide using a polymerase. As will be understood by those skilled in the art, the wavelength of the dye that excites the sample and the wavelength at which it fluoresces will depend on the absorption and emission spectra of the specific dye. Such returned radiation can be propagated back by guiding optical devices. The reverse beam can generally be directed to the detection optical device of the imager 512.

[0162] The imager detection optics may be based on any suitable technology and may be, for example, a charge coupled device (CCD) sensor that generates pixelated image data based on photons that affect positions in the device. However, it should be understood that any of a variety of other detectors may also be used, including but not limited to detector arrays configured for time delay integration (TDI) operation, complementary metal oxide semiconductor (CMOS) detectors, avalanche photodiode (APD) detectors, Geiger mode photon counters, or any other suitable detectors. TDI mode detection may be coupled with line scanning, as described in U.S. Patent No. 7,329,860, which is incorporated herein by reference. Other available detectors are described, for example, in the references previously provided herein in the context of various nucleic acid sequencing methods.

[0163] Imager 512 may be controlled by a processor, for example, via processor 514, and sample receiving device 502 may also include I / O controls 516, an internal bus 518, non-volatile memory 520, RAM 522, and any other memory structure that enables the memory to store executable instructions, and other suitable hardware components that may be similar to those described with respect to FIG. 31. In addition, associated computer 504 may also include processor 524, I / O controls 526, communication circuitry 527, and a memory architecture including RAM 528 and non-volatile memory 530 that enables the memory architecture to store executable instructions 532. The hardware components may be linked by an internal bus that may also be linked to a display 534. In embodiments where sequencing device 500 is implemented as an integrated device, certain redundant hardware elements may be eliminated.

[0164] Processors 514, 524 can be programmed to assign individual sequencing reads to samples based on one or more associated index sequences according to the techniques provided herein. In a specific embodiment, based on the image data acquired by the imager 512, the sequencing device 500 can be configured to generate sequencing data including base calls for each base of the sequencing reads. In addition, based on the image data, even for sequencing reads performed in tandem, individual reads can be linked to the same position via the image data, and therefore linked to the same template strand. In this way, the index sequencing reads can be associated with the sequencing reads of the inserted sequence before being assigned to the original sample. Processors 514, 524 can also be programmed to perform downstream analysis on the sequence corresponding to the insert of a specific sample after the sequencing reads are assigned to the sample.

[0165] In certain embodiments, I / O controls 516, 526 may be configured to receive user input that automatically selects sequencing parameters based on an associated sequence library preparation technique. In one embodiment, the user input may be a selection of a sequence library preparation kit or a barcode or identifier of a sequence library preparation kit.

[0166] In an embodiment of the disclosed technology, aptamer detection can be based on the presence of uniquely identified identification sequences 64 of individual aptamers 20 in sequencing data generated by the sequencing device 500. Thus, in one embodiment, the sequencing device 500 can perform sequence read analysis to identify one or more identification sequences 64 of a set of aptamers 20. In one embodiment, all or a portion of an aptamer 20 can be directly sequenced to identify the aptamer 20. Based on the identified aptamer 20, a notification or report of a positive aptamer identification can be generated. In one embodiment, the notification is provided on a display 534 or transmitted to a remote device or cloud server via the communication circuit system 527.

[0167] This written description uses examples to enable any person skilled in the art to practice the disclosed embodiments, including making and using any devices or systems and performing any incorporated methods. The patentable scope is defined by the claims, and may include other examples that occur to those skilled in the art. Such other examples are intended to be within the scope of the claims if they have structural elements that do not differ from the literal language of the claims, or if they include equivalent structural elements with insubstantial differences from the literal language of the claims.

Claims

1. A method for detecting an aptamer, the method comprising: contacting an analyte of the sample with a plurality of aptamers under conditions that allow for formation of analyte-aptamer complexes, wherein different aptamers in the plurality of aptamers have specific affinities for corresponding different analytes in the analytes; as well as The analyte is detected by detecting the aptamer in the analyte-aptamer complex, wherein detecting an individual aptamer in the plurality of aptamers comprises: contacting the individual aptamer with an exonuclease to deprotect the 3′ end of the individual aptamer to generate a deprotected 3′ end of the individual aptamer; modifying the deprotected 3′ end of the individual aptamer to generate a modified 3′ end of the individual aptamer; capturing the individual aptamers using the modified 3' end; and The captured individual aptamers are detected.

2. The method of claim 1, wherein modifying the deprotected 3' end comprises: hybridizing a first portion of a first oligonucleotide to a region of the individual aptamer including the deprotected 3' end; as well as A second oligonucleotide is attached to the deprotected 3' end, wherein the second oligonucleotide hybridizes to the second portion of the first oligonucleotide, and wherein the second oligonucleotide comprises an affinity tag. The method according to claim 2 , wherein the individual aptamers are captured by affinity tag capture molecules. The method of claim 3 , wherein the affinity tag is biotin and the affinity tag capture molecule is avidin or streptavidin.

5. The method of claim 3, wherein the affinity tag capture molecule is coupled to a bead or a substrate. The method of claim 2 , wherein the second oligonucleotide comprises an adaptor sequence.

7. The method of claim 1, wherein detecting the captured individual aptamers comprises sequencing the captured individual aptamers.

8. The method of claim 1, wherein detecting the captured individual aptamers comprises generating a sequencing library comprising one or more amplification products of the captured individual aptamers.

9. The method of claim 1, further comprising washing unbound first oligonucleotide from the captured individual aptamers.

10. The method of claim 1, wherein modifying the deprotected 3' end of the individual aptamer to generate a modified 3' end of the individual aptamer comprises incorporating an oligonucleotide (oNTP) onto the deprotected 3' end of the individual aptamer.

11. The method of claim 1, wherein modifying the deprotected 3' end of the individual aptamer to generate a modified 3' end of the individual aptamer comprises incorporating a biotin-labeled nucleotide onto the deprotected 3' end of the individual aptamer.

12. The method of claim 11, further comprising hybridizing a reporter probe to the individual aptamers, wherein the reporter probe comprises an identification sequence flanked by conserved primer sequences.

13. The method of claim 12, wherein detecting the individual aptamers comprises amplifying the identification sequence using the conserved primer sequence or a sequence complementary to the conserved primer sequence.

14. A method for detecting an aptamer, the method comprising: contacting an analyte of the sample with a plurality of aptamers under conditions that allow for formation of analyte-aptamer complexes, wherein different aptamers in the plurality of aptamers have specific affinities for corresponding different analytes in the analytes; as well as The analyte is detected by detecting the aptamer in the analyte-aptamer complex, wherein detecting an individual aptamer in the plurality of aptamers comprises: modifying the 3' end of the individual aptamer to generate a modified 3' end of the individual aptamer; hybridizing an oligonucleotide to the individual aptamers, wherein the oligonucleotide comprises a non-hybridizing 5' region; extending the 3' end of the oligonucleotide to generate an extended strand; and The extended strands are used to generate fragments for a sequencing library.

15. The method of claim 14, wherein the non-hybridizing 5' region comprises a first adaptor sequence.

16. The method of claim 15, further comprising ligating a second adaptor sequence to the 3' end of the extended strand.

17. The method of claim 16, wherein generating the fragments of a sequencing library using the extended strand comprises generating amplification products using primers for the first adapter sequence and the second adapter sequence or their complementary sequences.

18. The method of claim 14, wherein the oligonucleotide comprises an affinity tag capture molecule.

19. The method of claim 14, wherein the 3' end of the individual aptamer comprises an inverted dT, and wherein generating the modified 3' end comprises removing the inverted dT.

20. The method of claim 14, wherein the 3' end of the individual aptamer comprises an aldehyde.

21. The method of claim 14, wherein the 3' end of the individual aptamers comprises an enzymatically cleavable O-glycoside.

22. The method of claim 14, wherein generating the modified 3' end comprises extending the 3' end with a terminal deoxynucleotidyl transferase in a template-independent manner.

23. The method of claim 14, wherein the oligonucleotide comprises a degenerate sequence.

24. An aptamer detection probe set, comprising: A plurality of different probe mixtures, the plurality of different probe mixtures being complementary to corresponding different aptamers in the set of aptamers, wherein individual probe mixtures in the plurality of different probe mixtures comprise: a binding subset of probes coupled to an affinity tag; and A pseudo-subset of probes, the pseudo-subset of probes is not coupled to the affinity tag, wherein each probe in the binding subset and the pseudo-subset of the separate probe mixture comprises a same binding region that is complementary to at least a portion of an individual aptamer in the set of aptamers, and wherein each probe in the binding subset and the pseudo-subset of the separate probe mixture comprises a non-hybridizing region at the 3′ end.

25. The probe set of claim 24, wherein each probe in the binding subset and the pseudo subset of the separate probe mixture comprises a second non-hybridizing region at the 5' end.

26. The probe set of claim 25, wherein the second non-hybridizing region comprises an adapter sequence.

27. The probe set of claim 24, wherein the affinity tag comprises biotin.

28. An aptamer detection probe set, comprising: A plurality of different first probe mixtures complementary to corresponding different aptamers in the aptamer set, wherein individual probe mixtures in the plurality of different first probe mixtures comprise: a binding subset of probes; and A pseudo-subset of probes comprising a modified 5' end that is incapable of ligation, wherein each probe in the binding subset and the pseudo-subset of the individual probe mixture comprises an identical binding region that is complementary to at least a portion of an individual aptamer in the set of aptamers, and wherein the binding subset of probes has an unmodified 5' end that is capable of ligation.

29. A method for detecting an aptamer, the method comprising: contacting an analyte of the sample with a plurality of aptamers under conditions that allow for formation of analyte-aptamer complexes, wherein different aptamers in the plurality of aptamers have specific affinities for corresponding different analytes in the analytes; as well as The analyte is detected by detecting the aptamer in the analyte-aptamer complex, wherein detecting an individual aptamer in the plurality of aptamers comprises: The individual aptamers are contacted with a single-stranded nucleic acid reporter probe to form an aptamer-reporter probe complex, the reporter probe comprising: an aptamer binding region that binds to the individual aptamer to form a first double-stranded region; and a single-stranded region comprising a cleavage region and an identification sequence, The identification sequence uniquely identifies the individual aptamer or associated analyte; extending the individual aptamer from the 3′ end to form a second double-stranded region, the second double-stranded region comprising the identification sequence, and using the single-stranded region as a template; separating the first double-stranded region from the second double-stranded region at the cleavage region; and The second double-stranded region is sequenced to detect the identification sequence.

30. The method of claim 29, further comprising deprotecting the 3' end prior to the extending.

31. The method of claim 30, wherein deprotecting the 3' end comprises contacting the aptamer-reporter probe complex with an exonuclease.

32. The method of any one of the preceding claims, wherein extending the individual aptamers comprises using a taq polymerase.

33. The method of claim 32, wherein the exonuclease comprises exoI or exoIII.

34. The method of claim 29 or 30, comprising using a DNA polymerase having 3' to 5' exonuclease activity for said extending.

35. The method of claim 34, wherein the DNA polymerase deprotects the 3' end.

36. The method of any one of the preceding claims, further comprising digesting the reporter probe not bound to the aptamer using a single-stranded endonuclease after the extending.

37. The method of any one of the preceding claims, wherein the cleavage region is located between the aptamer binding region and the identification sequence.

38. The method of any of the preceding claims, wherein the reporter probe comprises a unique molecular identifier that is different from the identification sequence.

39. The method of any one of the preceding claims, wherein the reporter probe comprises an affinity tag.

40. The method of any one of the preceding claims, wherein sequencing the second double-stranded region comprises sequencing the identification sequence or its complement.

41. The method of any preceding claim, further comprising generating a notification associated with the individual aptamer based on the sequencing.

42. The method of any one of the preceding claims, further comprising separating the first double-stranded region from the second double-stranded region using an affinity tag binding agent.

43. The method of claim 42, wherein the affinity tag binding agent is coupled to beads.

44. The method according to any one of the preceding claims, wherein contacting the individual aptamers with the single-stranded nucleic acid reporter probe to form the aptamer-reporter probe complex is performed under conditions that allow hybridization of the aptamer binding region to the aptamer.

45. The method of any of the preceding claims, wherein the cleavage region forms a double-stranded restriction site after the extension, wherein the double-stranded restriction site is configured to be recognized by a restriction enzyme.

46. ​​An aptamer detection reporter probe set, the aptamer detection reporter probe set comprising: a plurality of different single-stranded nucleic acid reporter probes, wherein the plurality of different single-stranded nucleic acid reporter probes are complementary to corresponding different aptamers in the aptamer set, The first single-stranded nucleic acid reporter probe among the plurality of different single-stranded nucleic acid reporter probes comprises: a first aptamer binding region that binds to a first individual aptamer to form a first double-stranded region; A first cleavage zone; as well as a first identification sequence that uniquely identifies the first individual aptamer; and Wherein the second single-stranded nucleic acid reporter probe among the plurality of different single-stranded nucleic acid reporter probes comprises: a second aptamer binding region that binds to a second individual aptamer to form a second double-stranded region; Second cleavage zone; as well as a second identification sequence that uniquely identifies the second individual aptamer; wherein the first aptamer binding region and the second aptamer binding region have different nucleotide sequences relative to each other.

47. The reporter probe set of claim 46, wherein the first identification sequence does not overlap with the sequence of the first individual aptamer.

48. The reporter probe set of claim 46 or claim 47, wherein the second identification sequence does not overlap with the sequence of the second individual aptamer.

49. The reporter probe set according to any one of claims 46 to 48, wherein the first identification sequence and / or the second identification sequence is 20 nucleotides or less in length.

50. A reporter probe set according to any one of claims 46 to 49, wherein the first cleavage region and The first identification sequence is located in a non-hybridizing region of the first single-stranded nucleic acid reporter probe that does not hybridize to the first individual aptamer.

51. The reporter probe set according to any one of claims 46 to 50, wherein the second cleavage region and the second identification sequence are located in a non-hybridizing region of the second single-stranded nucleic acid reporter probe that does not hybridize to the second individual aptamer.

52. The reporter probe set of any one of claims 46 to 51, wherein the first cleavage region and the second cleavage region have the same sequence.

53. The reporter probe set according to any one of claims 46 to 51, wherein other reporter probes in the plurality of different single-stranded nucleic acid reporter probes comprise the same sequence of the first cleavage region and the second cleavage region.

54. The reporter probe set according to any one of claims 46 to 52, wherein the first cleavage region is located between the first aptamer binding region and the first identification sequence.

55. A method for detecting an aptamer, the method comprising: contacting an individual aptamer with a reporter probe that hybridizes to the individual aptamer at the aptamer binding region to form a first double-stranded region of the reporter probe, and wherein the reporter probe comprises a non-hybridized region comprising a cleavage region and an identification sequence that uniquely identifies the individual aptamer or an associated analyte; extending the individual aptamer from the 3′ end using the non-hybridized region as a template to form a second double-stranded region; separating the first double-stranded region from the second double-stranded region at the cleavage region; and The identified sequence is detected.

56. The method of claim 55, wherein detecting the identification sequence comprises sequencing one or both strands of the second double-stranded region.

57. The method of claim 55 or 56, comprising incorporating sequencing adapters onto the ends of the double-stranded regions.

58. The method according to any one of claims 55 to 57, wherein the incorporation is performed by ligation and / or amplification.

59. A method for detecting an aptamer, the method comprising: contacting an analyte of the sample with a plurality of aptamers under conditions that allow for formation of analyte-aptamer complexes, wherein different aptamers in the plurality of aptamers have specific affinities for corresponding different analytes in the analytes; as well as The analyte is detected by detecting the aptamer in the analyte-aptamer complex, wherein detecting an individual aptamer in the plurality of aptamers comprises: contacting the individual aptamer with an exonuclease to deprotect the 3′ end of the individual aptamer to generate a deprotected 3′ end of the individual aptamer; extending the deprotected 3′ end of the individual aptamer using a polymerase to generate an extended 3′ end of the individual aptamer; hybridizing the individual aptamers to a reporter probe, wherein the reporter probe has a protected 3′ end that is not deprotected by the exonuclease or extended by the polymerase; capturing the individual aptamers using the modified 3' end; and The captured individual aptamers are detected using the reporter probe.

60. The method of claim 59, wherein the protected 3' end of the reporter probe comprises a dideoxynucleotide.

61. The method of claim 59, wherein the 3' end of the aptamer comprises an inverted dT.

Images