Application of plant extracts in the preparation of drugs against canine coronavirus

By using plant extracts such as root olein to prepare anti-canine coronavirus drugs, the problems of weakening efficacy and drug resistance in the prior art have been solved, and effective prevention and treatment effects are achieved without side effects.

CN119454678BActive Publication Date: 2025-06-06INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411640752.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-18
Publication Date
2025-06-06
Estimated Expiration
2044-11-18

AI Technical Summary

Technical Problem

The prior art has gradually weakened efficacy in the prevention and treatment of canine coronavirus, localized vaccines and antibodies, and drug resistance, and lacks novel and effective drug preparations that are safe and without side effects.

Method used

Plant extracts such as shikilic acid, rhizotin, caffeic acid, terrestris tribulus saponin, berberine hydrochloride and apple polyphenols are used as active ingredients in anti-canine coronavirus. Different dosage forms of drugs are formed by preparing drugs and combining pharmaceutically acceptable excipients.

Benefits of technology

Among plant extracts, root olein has the most significant effect, with antiviral activities that directly kill, inhibit virus adsorption and inhibit virus growth, providing a new safe and no side effects to effectively prevent and treat dog coronavirus.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119454678B_ABST
    Figure CN119454678B_ABST
Patent Text Reader

Abstract

The present invention discloses the application of plant extracts in the preparation of drugs against canine coronavirus, and relates to the technical field of biomedicine. The present invention studies and discovers that plant extracts, namely shikimic acid, phloretin, caffeic acid, tribulus saponins, berberine hydrochloride and apple polyphenols, have the activity against canine coronavirus, and among them, phloretin has the most significant effect. Phloretin has antiviral activity in three aspects: directly killing, inhibiting virus adsorption and inhibiting virus growth, and among them, the effect of inhibiting virus growth is the most significant. The EC 50 of phloretin on CCoV is 0.616 mg / L. The plant extracts of the present invention are derived from natural plants, and compared with chemical drugs, they have the advantages of low toxicity and good biocompatibility. The present invention provides technical support for the development of novel, effective, safe and side-effect-free drug preparations for the prevention and treatment of canine coronavirus.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention relates to the technical field of biomedicine, and in particular to application of plant extracts in preparing medicines against canine coronavirus. Background Art

[0002] Due to the booming pet market in China and the sharp increase in the number of pet dogs raised, the number of canine coronavirus infections in various types of dogs, including pet dogs, working dogs, and experimental dogs, has gradually increased. Canine coronavirus infections are mostly not fatal, but symptoms such as dehydration, vomiting, and diarrhea during the onset of the disease will still cause losses to the affected dogs, their families, and the dog breeding industry. In clinical treatment, the prevention and treatment of canine coronavirus mainly relies on vaccine immunization, as well as biological preparations such as triple serum, pentavalent serum, immunoglobulin, and monoclonal antibodies. However, due to the wide variety of brands on the market and different prevention and treatment effects, the efficacy of biological preparations such as serum and monoclonal antibodies has gradually weakened, and both vaccines and antibodies have certain limitations. In addition, various preparations used as auxiliary therapies have developed drug resistance to varying degrees. Therefore, the development of novel, effective, safe, and side-effect-free drug preparations for the prevention and treatment of canine coronavirus has become the latest development goal.

[0003] Generally speaking, compared with chemical drugs, natural plant secondary metabolites have lower toxicity and stronger affinity for biological macromolecules. At the same time, natural compounds often have multi-target and multi-pharmacological characteristics. Due to the increasingly serious drug resistance of antiviral drugs and the prohibition of antiviral drugs in veterinary clinics, the search for antiviral active substances from natural products has gradually become a hot topic in the field of antiviral research.

[0004] Plant extracts have been widely used in various fields, and have significant pharmacological effects in antibacterial, anti-inflammatory, antioxidant, anti-tumor and immunomodulatory aspects. However, there is a lack of systematic research reports on the antiviral effects of plant extracts, and the application of plant extracts in companion animal and small animal diseases is still vacant, and their efficacy and specific mechanism of action are still unclear.

[0005] Based on this, the present invention plans to use canine coronavirus as the object to explore the specific mechanism of the antiviral effect of plant extracts and identify the key signal pathways affected by plant extracts, in order to provide a new idea for using plant extracts to prevent and treat small animal diseases. Summary of the invention

[0006] The purpose of the present invention is to provide an application of plant extracts in the preparation of drugs against canine coronavirus to solve the problems existing in the above-mentioned prior art. The present invention has found that plant extracts - shikimic acid, phloretin, caffeic acid, tribulus terrestris saponin, berberine hydrochloride and apple polyphenols have anti-canine coronavirus activity, and therefore can be used to prepare drugs against canine coronavirus.

[0007] To achieve the above object, the present invention provides the following solutions:

[0008] The present invention provides application of a plant extract in preparing a drug for resisting canine coronavirus, wherein the plant extract is at least one of shikimic acid, phloretin, caffeic acid, tribulus terrestris saponin, berberine hydrochloride and apple polyphenol.

[0009] Furthermore, the drug includes pharmaceutically acceptable excipients.

[0010] Furthermore, the auxiliary materials include solubilizers, binders, disintegrants, fillers, stabilizers, preservatives, coating materials and / or fragrances.

[0011] Furthermore, the dosage form of the drug is granules, tablets, capsules, powders, pills, injections or oral solutions.

[0012] The present invention discloses the following technical effects:

[0013] The present invention found that plant extracts - shikimic acid, phloretin, caffeic acid, tribulus saponin, berberine hydrochloride and apple polyphenols have anti-canine coronavirus activity, among which phloretin has the most significant effect. Phloretin has antiviral activity in three aspects: direct killing, inhibition of virus adsorption and inhibition of virus growth, among which the effect of inhibiting virus growth is the most significant. Phloretin acts on the EC of CCoV 50 It is 0.616mg / L.

[0014] The plant extract of the present invention is derived from natural plants and has the advantages of low toxicity and good biocompatibility compared with chemical drugs. The present invention provides technical support for developing novel, effective, safe and side-effect-free pharmaceutical preparations for preventing and treating canine coronavirus. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0016] Figure 1 This is the result of detecting the cytotoxicity of chlorogenic acid to CRFK by CCK-8 method;

[0017] Figure 2 This is the result of detecting the cytotoxicity of rubusoside to CRFK by CCK-8 method;

[0018] Figure 3 This is the result of detecting the cytotoxicity of shikimic acid to CRFK by CCK-8 method;

[0019] Figure 4 This is the result of detecting the cytotoxicity of phloretin to CRFK by CCK-8 method;

[0020] Figure 5 This is the result of detecting the cytotoxicity of caffeic acid to CRFK by CCK-8 method;

[0021] Figure 6 This is the result of the CCK-8 method to detect the cytotoxicity of apple polyphenols to CRFK;

[0022] Figure 7 The figure is the result of detecting the cytotoxicity of Tribulus terrestris saponins to CRFK by CCK-8 method;

[0023] Figure 8 This is the result of detecting the cytotoxicity of neomethyl hesperidin-dihydrochalcone to CRFK by CCK-8 method;

[0024] Fig. 9 This is the result of detecting the cytotoxicity of marigold flavonoids to CRFK by CCK-8 method;

[0025] Fig.10 This is the result of detecting the cytotoxicity of berberine hydrochloride to CRFK by CCK-8 method;

[0026] Fig.11 This is the standard curve of fluorescence quantitative PCR;

[0027] Fig.12 This is a statistical graph of viral load from a preliminary screening experiment of the plant extract's ability to inhibit CCoV;

[0028] Fig.13 This is a statistical chart showing the inhibition rate of phloretin at different concentrations on CCoV-induced CRFK cell pathology detected by CCK-8 method;

[0029] Fig.14 It is the growth curve of CCoV in CRFK under different phloretin concentrations;

[0030] Fig.15 The statistical graph of viral load of CCoV in CRFK at 4h under different phloretin concentrations;

[0031] Fig.16 The figure is the statistical graph of viral load of CCoV in CRFK at 8h under different phloretin concentrations;

[0032] Fig.17 The statistical graph of viral load of CCoV in CRFK at 12h under different phloretin concentrations;

[0033] Fig.18The statistical graph of viral load of CCoV in CRFK at 18h under different phloretin concentrations;

[0034] Fig.19 The figure is the statistical graph of viral load of CCoV in CRFK at 24h under different phloretin concentrations;

[0035] Fig. 20 The statistical graph of viral load of CCoV in CRFK at 36h under different phloretin concentrations;

[0036] Fig.21 The figure is a statistical graph of viral load of CCoV in CRFK at 48h under different phloretin concentrations;

[0037] Fig. 22 This is the result diagram of the direct virus killing experiment;

[0038] Fig.23 This is the result of the virus adsorption inhibition experiment;

[0039] Fig.24 This is the result of the virus growth inhibition experiment. DETAILED DESCRIPTION

[0040] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0041] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0042] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0043] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to the skilled artisan. The present invention description and examples are exemplary only.

[0044] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0045] Terminology Note:

[0046] Phloretin, also known as trihydroxyphenol acetone 2,4,6-trihydroxy-3-(4-hydroxyphenyl) phenylacetone, belongs to the flavonoids and is mainly distributed in the peel and root bark of juicy fruits such as apples and pears. Its molecular formula is C 15 H 14 O 5 , CAS number is 60-82-2, and the structural formula is as follows:

[0047]

[0048] Shikimic acid, molecular formula is C 7 H 10 O 5 , CAS No. 138-59-0, structural formula is as follows:

[0049]

[0050] Caffeic acid, molecular formula is C 9 H 8 O 4 , CAS number is 331-39-5, and the structural formula is as follows:

[0051]

[0052] The molecular formula of Tribulus terrestris saponin is C 30 H 26 O 13 , CAS number is 22153-44-2, and the structural formula is as follows:

[0053]

[0054] The molecular formula of berberine hydrochloride is C 20 H 18 NO 4 Cl, CAS number is 633-65-8, the structural formula is as follows:

[0055]

[0056] Apple polyphenols are polyphenols extracted from apples, with a CAS number of 85251-63-4.

[0057] Example 1

[0058] 1 Test materials

[0059] 1.1 Cells and viruses

[0060] Primary feline kidney cells (CRFK); canine coronavirus (CCoV).

[0061] 1.2 Main reagents (see Table 1)

[0062] Table 1 Main reagents

[0063]

[0064] 1.3 Main instruments and equipment (see Table 2)

[0065] Table 2 Main instruments and equipment

[0066]

[0067]

[0068] 1.4 Primer sequences

[0069] The primer sequences involved in the present invention are shown in Table 3.

[0070] Table 3 Primer sequences

[0071] Primer name Nucleotide sequence (5'-3') CCoV24-F CCCATTGTTTTGGCTCT CCoV24-R CCATCCTGTTGCACTACTT CCoVII-F CCTGAGACTAATGCAATTC CCoVII-R CCCTGAAAGCAATGTTAA Probe ACACCAGTTGGCACACCTTCTA

[0072] 2. Test methods

[0073] 2.1 Cell culture

[0074] 2.1.1. Cell recovery

[0075] Quickly remove the CRFK cell cryopreservation tube from liquid nitrogen and immediately place it in a 37°C water bath, shaking it while immersing it to melt the cell cryopreservation solution as quickly as possible. Wipe the cryopreservation tube with 75% alcohol cotton, open the tube cover in a biosafety cabinet, aspirate the cell suspension, centrifuge at 1000rpm for 5 minutes, aspirate and discard the cryopreservation solution, and prepare for cell culture.

[0076] 2.1.2 Cell culture

[0077] The centrifuged cells were resuspended in DMEM medium containing 10% fetal bovine serum (FBS) and inoculated into T25cm 2 Place the cell flask in a cell culture incubator (37°C, 5% CO 2), observe the growth status of cells on the second day, and subculture when the cells basically fill the monolayer.

[0078] When subculturing, discard the old cell fluid and wash once with PBS. Then add 1 mL of trypsin to immerse the cell monolayer and place it in a cell culture incubator for digestion for 1 minute. When the cell layer falls off like quicksand as observed by the naked eye, use a pipette to collect all the trypsin and cells, centrifuge at 1000 rpm for 5 minutes, discard the trypsin after centrifugation, add 10% FBS DMEM medium to terminate digestion, repeatedly blow the cells with a graduated pipette until they are completely dispersed and resuspended, transfer them to a new cell bottle according to the one-to-two method, and place them in an incubator (37°C, 5% CO 2 )nourish.

[0079] 2.2 Virus culture:

[0080] When the monolayer cells grew to 80%, the culture medium was discarded and washed once with PBS; the stored CCoV strain was taken out from the -80°C refrigerator, thawed on ice, and 100 μL was taken and inoculated into the cell bottle. After that, the cell bottle was placed in a cell culture incubator for 1 hour for virus adsorption. After 1 hour, DMEM culture medium with 10% FBS was added, and the cell bottle was placed in a cell culture incubator for continuous observation for 72 hours to observe the cell pathological state.

[0081] 2.3 TCID 50 )

[0082] CRFK cells were inoculated in a 96-well plate. When the cells were 80% full, the cell culture medium was discarded and the cells were rinsed once with PBS. The CCoV stock solution was diluted 10 times in a series of gradients using serum-free DMEM medium to make the virus dilution 10. -1 -10 -9 ; Add each dilution of virus solution to each well, 100 μL per well, and set up 8 replicate wells for each dilution. After completion, place the 96-well plate at 37°C and 5% CO 2 The cells were cultured in a cell culture incubator for 72 h, the cytopathic effect was observed, and the TCID50 of the virus was calculated according to the Reed-Muench formula. 50 ).

[0083] 2.4 CCK-8 assay to detect the cytotoxicity of plant extracts to CRFK cells

[0084] Dissolve each plant extract in DMSO, filter through a 0.22 μm filter, and prepare a 200 mg / L stock solution. Use 2% FBS DMEM cell culture medium to perform a two-fold serial dilution of each plant extract solution to obtain a final concentration of 200, 100, 50, 25, 12.5, 6.25, 3.13, and 1.56 mg / L of drug solution.6 / mL CRFK cell suspension was inoculated into a 96-well plate. After the cells grew to a monolayer, the culture medium was discarded and plant extract solutions with different concentrations were added, 100 μL per well, and 3 replicates were set for each concentration. The 96-well plate with the drug solution was placed at 37°C and 5% CO 2 Incubate in the incubator for 48 hours, then discard the culture medium, rinse once with PBS, add 10 μL CCK-8 reagent to each well, return to the incubator and incubate for 1 hour. After completion, use an enzyme reader to detect OD 450nm The absorbance of each well at the wavelength was used to calculate the cytotoxicity of plant extracts at different concentrations on CRFK cells.

[0085] 2.5 Real-time fluorescence quantitative PCR detection of the effect of plant extracts on CCoV M gene expression

[0086] 2.5.1 Establishment of the absolute fluorescence quantification method for CCoV

[0087] (1) Primer design

[0088] According to the canine coronavirus M gene sequence published in NCBI GenBank, a pair of primers CCoV24-F / R (see Table 3) were designed using Premier 6.0 software and synthesized by Beijing Ruibo Kexing Gene Technology Co., Ltd. The PCR amplification product was expected to be 420 bp in length.

[0089] (2) Extraction of CCoV virus genes and synthesis of cDNA

[0090] The diseased cells were harvested according to the previous virus culture procedures, and the viral RNA was extracted according to the kit procedures after repeated freezing and thawing. The concentration was detected using a nucleic acid protein meter and then immediately placed at -80°C for use. At the same time, a portion of the RNA was immediately reverse transcribed according to the kit procedures, and the obtained cDNA was placed at -20°C for use.

[0091] The reverse transcription reaction system and conditions are as follows:

[0092] Reverse transcription reaction system: 5×FastKing-RT SuperMix 4μL, RNA 50ng-2μg, RNase free water (RNase free H 2 O) make up to 20 μL.

[0093] The reverse transcription reaction conditions were set as: 42°C for 15 min and 98°C for 3 min for enzyme inactivation.

[0094] (3) Establishment of standard positive template of gene plasmid:

[0095] The cDNA obtained by reverse transcription was used as a template and amplified according to the common PCR reaction system and reaction conditions. The PCR amplification reaction system and reaction conditions are as follows:

[0096] PCR amplification reaction system: Prime Star Mix (10×) 10 μL, upstream primer 1 μL, downstream primer 1 μL, cDNA 1 μL and RNase free water (RNase free H 2 O)7 μL.

[0097] The PCR amplification reaction conditions were set as follows: pre-denaturation at 98°C for 3 min; denaturation at 98°C for 15 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, 30 cycles; and extension at 72°C for 5 min.

[0098] After amplification, 5 μL of the reaction solution was taken for 1% agarose gel electrophoresis detection, and the target DNA fragment was recovered using a gel recovery kit. The recovered target DNA fragment was connected to the pTOPO vector (purchased from Beijing Adelaide Biotechnology Co., Ltd.), transformed into DH5α competent cells, and cultured overnight in LB agar containing ampicillin resistance. A single colony was picked and sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing after PCR identification. The positive plasmid with correct sequencing can be used for later experiments.

[0099] (4) qRT-PCR primer and probe design

[0100] The sequences obtained from the sequencing results were imported into NCBI for BLAST comparison. Then, according to the CCoV sequence published in NCBI GenBank, the primer pair CCoV II-F / R and probe Probe (see Table 3) were designed using Beacon Designer 8.14 software. The reaction system was confirmed and synthesized by Beijing Ruibo Kexing Gene Technology Co., Ltd. The estimated length of the PCR amplification product was 102 bp.

[0101] The qRT-PCR reaction system and reaction conditions are as follows:

[0102] qRT-PCR reaction system: Premix EX Taq (Probe qRT-PCR) (2×) 10 μL, upstream primer 0.4 μL, downstream primer 0.4 μL, probe 0.8 μL, ROX Reference Dye II (50×) 0.2 μL, cDNA 2 μL and RNase free H 2 O 6.2μL.

[0103] The experiment was performed using Applied Biosystems 7500 Real-Time PCR System. The reaction conditions were a two-step amplification standard program, set at 98°C for 30 seconds, 95°C for 5 seconds, 60°C for 34 seconds, and 40 cycles.

[0104] (5) Preparation of standard curve

[0105] The obtained positive plasmid was diluted 10 times in series. -5 , 10 -6 , 10 -7 , 10 -8 , 10 -9 , 10 -10 , 10 -11 Seven serial dilutions were used as reaction templates for qRT-PCR. 2 O is the template as a negative control; the logarithm of the template standard copy number is used as the horizontal axis, and the Ct value of the amplification curve is used as the vertical axis to establish a standard curve. Calculate the standard curve equation and the curve correlation coefficient R 2 , amplification efficiency E.

[0106] 2.6 Evaluation of the inhibitory effect of plant extracts on CCoV

[0107] 12.5 mg / L was selected as the initial screening concentration. CRFK cells were inoculated on a 6-well cell culture plate. When the cell abundance reached 80%, the culture medium was discarded, and after washing 3 times, 100 μL of 100 TCID 50 The CCoV virus solution was placed in an incubator for adsorption for 1 hour, and then 12.5 mg / L of plant extract solution was added. Three replicates were made in each group.

[0108] The cell culture plates of each group were placed in a 5% CO 2 , 37 ℃ cell culture incubator, discard the supernatant after 48 hours, collect cells to extract RNA, and perform reverse transcription. qRT-PCR was performed on each group of samples to detect the CCoV M gene in each group of samples, and the CCoV copy number in each sample was calculated according to the standard curve formula.

[0109] 2.7 Effect of phloretin on EC of CCoV 50 Detection

[0110] In a 96-well plate filled with monolayer CRFK cells, add 50 μL of 100 TCID 50CCoV virus solution, and different concentrations of phloretin were added at the same time, so that the final concentrations of phloretin in each culture well were 12.5 mg / L, 6.25 mg / L, 3.125 mg / L, 1.563 mg / L, 0.781 mg / L, 0.391 mg / L, 0.195 mg / L and 0.098 mg / L. The treated cell culture plates were placed at 37°C and 5% CO 2 After 48 hours of culture in a cell culture incubator, the cytopathic effect (CPE) was observed, photographed, and recorded. The half effective concentration of the drug was calculated according to the Reed-Muench formula. The calculation formula is as follows:

[0111] EC 50 =C×2 -S ;

[0112] S = N-1 + (HR) / (HL);

[0113] In the formula, N represents the drug concentration number with an inhibition rate higher than 50%; H represents an inhibition rate higher than 50%; L represents an inhibition rate lower than 50%; R is 50%; and C represents the concentration of the drug experimental group with the number 1.

[0114] 2.8 Effect of phloretin on the growth curve of CCoV in CRFK

[0115] CRFK cells were inoculated on a 6-well cell culture plate. When the cell abundance reached 80%, the culture medium was discarded, and after washing three times, 100 μL of 100 TCID 50 The CCoV virus solution was placed in an incubator for adsorption for 1 hour. Then different concentrations of phloretin solution were added at the same time, so that the final concentrations of the solution were 12.5 mg / L, 6.25 mg / L and 3.125 mg / L, respectively. A virus control group without drug was set up, and three replicates were performed for each group.

[0116] The cell culture plates of each group were placed in a 5% CO 2 , 37 ℃ cell culture incubator, and discard the supernatant at 4h, 8h, 12h, 18h, 24h, 36h, 48h to collect cells to extract RNA for reverse transcription. The cDNA samples of each group were subjected to qRT-PCR, the CCoV M gene in each sample was detected, and the CCoV copy number in each sample was calculated according to the standard curve formula, and the virus growth curve under the influence of phloretin was drawn.

[0117] 2.9 Determination of the mode of action of phloretin in inhibiting CCoV

[0118] (1) Direct inactivation of viruses

[0119] 100 μL 100 TCID 50CCoV virus solution was mixed with 12.5 mg / L drug solution, and 100 TCID 50 The virus solution was used as a control. The two were placed in a 37°C incubator for 1 h and then inoculated into a 6-well cell culture plate with a monolayer of CRFK cells at 37°C and 5% CO. 2 After 1 h under the conditions, the supernatant was discarded, the cell culture plate was washed 3 times, 2% cell maintenance medium was added and cultured for 48 h, RNA of each sample was collected, and the number of viral copies was detected by qRT-PCR.

[0120] (2) Inhibition of virus adsorption process:

[0121] 100 μL 100 TCID 50 CCoV virus solution was inoculated into a 6-well cell culture plate with a monolayer of CRFK cells, and 12.5 mg / L drug solution was added. A control group without drug was set up and the culture medium was kept at 37°C and 5% CO. 2 After 1 h under the conditions, the supernatant was discarded, the cell culture plate was washed 3 times, 2% cell maintenance medium was added and cultured for 48 h, RNA of each sample was collected, and the number of viral copies was detected by qRT-PCR.

[0122] (3) Inhibit virus growth and reproduction:

[0123] 100 μL 100 TCID 50 The CCoV virus solution was inoculated into a 6-well cell culture plate with a monolayer of CRFK cells and incubated at 37°C and 5% CO 2 After incubation for 1 h under the same conditions, the supernatant was discarded, the cell culture plate was washed 3 times, and 12.5 mg / L of each drug solution and a medium without drug were added as a control group at 37°C and 5% CO 2 The cells were cultured under the same conditions for 48 h, and RNA from each sample was collected and the viral copy number was detected by qRT-PCR.

[0124] 3 Test results

[0125] 3.1 TCID 50 )

[0126] The CCoV virus solution of different dilutions was added to the cell culture plate with a monolayer of CRFK and incubated in 5% CO 2 The cells were incubated at 37°C for 72 h, and the cytopathic effect (CPE) was observed and recorded. The results are shown in Table 4. TCID 50 Value is 10 5.903 / 100μL.

[0127] Table 4 Virus TCID 50 The results of the measurement

[0128]

[0129] 3.2 Results of CCK-8 assay for drug cytotoxicity to CRFK

[0130] The CCK-8 method was used to detect the effects of different concentrations of plant extracts on CRFK cell viability. Figure 1-Figure 10 The results showed that at a concentration of 12.5 mg / L and below, each plant extract exhibited a mild cytotoxicity to cells.

[0131] 3.3 Real-time fluorescence quantitative PCR detection of the effect of plant extracts on viral expression

[0132] (1) Construction of CCoV recombinant positive plasmid:

[0133] The amplified CCoV gene fragment was about 420 bp in size through a common PCR reaction system, which was consistent with the expected product size, indicating that the target gene fragment was correctly amplified. The amplified product was recovered by gel and connected to the pTOPO-TA vector. The positive plasmid with correct sequencing was named pTOPO-CCoV. The extracted plasmid was measured by a nucleic acid protein detector, and its concentration was 199.5 ng / μL, and OD 260 / OD 280 The number of copies converted to 1.98 is 4.3×10 11 copies / μL.

[0134] (2) Preparation of CCoV absolute fluorescence quantitative standard curve:

[0135] Select positive standard 10 -5 , 10 -6 , 10 -7 , 10 -8 , 10 -9 , 10 -10 , 10 -11 Seven dilutions were used as reaction templates in ddH 2 O is the negative control, the logarithm of the template standard copy number is used as the horizontal axis, and the Ct value of the amplification curve is used as the vertical axis to establish a standard curve. The results are shown in Fig.11 .

[0136] The results show that in 10 -5 -10 -9 Within the dilution range, a good linear relationship was shown.

[0137] The standard curve and regression equation are Y = -3.4794X + 0.2896, and the curve correlation coefficient R 2=0.998, amplification efficiency E =93.8%, which meets the requirements and can be used for quantitative detection of CCoV.

[0138] 3.4 Evaluation of the inhibitory effect of plant extracts on CCoV

[0139] Combined with the results of the cytotoxicity test, the present invention conducted a preliminary screening of the antiviral effects of each plant extract, and the viral load test results of each treatment group were shown in Fig.12 The results showed that shikimic acid, phloretin, caffeic acid, tribulus terrestris saponin, berberine hydrochloride and apple polyphenols had anti-canine coronavirus effects (P < 0.0001), among which phloretin had the most significant effect, so phloretin was selected for the next test.

[0140] 3.5 Effect of phloretin on EC of CCoV 50

[0141] In order to verify the antiviral effect of phloretin, the present invention selected CCoV as the test virus, inoculated CCoV and phloretin solution on CRFK cells, and carried out EC 50 The test results are shown in Tables 5, 6 and Fig.13 By observing CPE and combining CCK-8 method to detect the inhibitory effect of phloretin on CRFK cell pathology caused by CCoV at various concentrations, the EC value of phloretin on CCoV was finally calculated. 50 It is 0.616mg / L.

[0142] Table 5 The inhibitory effect of different concentrations of phloretin on CCoV

[0143]

[0144] Table 6 Mean absorbance of CCK-8 at different phloretin concentrations

[0145]

[0146] 3.6 Effect of phloretin on the growth curve of CCoV in CRFK

[0147] Cells from the phloretin treatment group and the virus infection group were collected at 4h, 8h, 12h, 18h, 24h, 36h and 48h, and RNA was extracted using the RN27 virus RNA rapid extraction kit, and the RNA was immediately reverse transcribed into cDNA. The purity was detected using a nucleic acid protein detector, and the absolute fluorescence quantitative PCR detection method established above was used to detect the number of CCoV copies in each sample, and the growth curve was drawn. The overall trend and the comparison results at each time point are shown in Figure 14-Figure 21 shown.

[0148] In the virus control group, the copy number of CCoV gradually increased 4-24 hours after the virus infected CRFK cells, reached a peak during 24-36 hours, and gradually decreased during 36-48 hours. This may be due to the massive reproduction of virus particles at this stage, which caused a large number of cell deaths and affected the further proliferation of the virus. After the addition of phloretin treatment, the proliferation of CCoV in CRFK cells can be significantly inhibited during virus infection.

[0149] 3.7 Results of the determination of the mode of action of phloretin in inhibiting CCoV

[0150] Phloretin was dissolved in culture medium to prepare a solution with a concentration of 12.5 mg / L. CRFK cells infected with CCoV were inoculated at different times for co-culture, and a pure virus control was set up at the same time. The cells were then harvested to extract nucleic acid, and the canine coronavirus load under the action of phloretin was detected by the fluorescent quantitative PCR method determined above. The results are shown in Figure 22-Figure 24 .

[0151] according to Figure 22-Figure 24 It can be seen that phloretin has antiviral activity in three aspects: direct killing, inhibition of virus adsorption and inhibition of virus growth, among which the effect of inhibiting virus growth is the most significant.

[0152] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. The use of plant extracts in the preparation of drugs against canine coronavirus, characterized in that: The plant extract is at least one of shikimic acid, phloretin, caffeic acid, tribulus terrestris saponin, berberine hydrochloride and apple polyphenol.

2. The use according to claim 1, characterized in that: The drug includes pharmaceutically acceptable excipients.

3. The use according to claim 2, characterized in that: The auxiliary materials include solubilizers, binders, disintegrants, fillers, stabilizers, preservatives, coating materials and / or fragrances.

4. The use according to claim 2, characterized in that: The dosage form of the medicine is granules, tablets, capsules, powders, pills, injections or oral solutions.

Citation Information

Patent Citations

  • Composition and Method for Preventing, Reducing, Alleviating or Treating Idiopathic Vomiting

    US20140271949A1

  • Viral treatment regimens

    WO2021202245A1