Application of NG-497 in preparation of medicine for relieving neuroinflammation

Abstract

The invention discloses application of NG-497 in preparation of a medicine for relieving neuroinflammation, and discloses that NG-497 is targeted to a melatonin receptor (MTNR1A) to increase the expression quantity of the MTNR1A so as to relieve inflammatory response for the first time. The composition can effectively inhibit decomposition of lipid droplets and release of inflammatory factors, and also can protect neurons derived from hiPSC.

Description

Technical Field

[0001] The present invention relates to an application of NG-497 in preparing a drug for alleviating neuroinflammation, and belongs to the field of medicine. Background Art

[0002] Neuroinflammation is an important pathogenesis and pathological manifestation of many neuroinflammatory diseases and non-neuroinflammatory diseases, and plays an important role in the process of multiple sclerosis, stroke, Alzheimer's disease, etc. Therefore, effective control of neuroinflammation is the basis for the treatment of various neurological diseases.

[0003] Microglia are innate immune cells resident in the central nervous system that can induce and regulate neuroinflammatory responses. A variety of proinflammatory factors released after microglia activation, such as TNF-α, IL-6, IL-1β, and CCL-2, can cause damage to peripheral neurons and affect the development of neurological diseases. Neuroinflammation can induce lipid droplet aggregation in microglia, but the effect of lipid droplet aggregation on neuroinflammation is still controversial.

[0004] NG-497 is an adipose triglyceride lipase (ATGL) inhibitor that targets the enzymatically active patatin-like domain of ATGL. It can selectively inactivate ATGL in humans and non-human primates and inhibit lipid droplet decomposition. Summary of the invention

[0005] Purpose of the invention: The purpose of the present invention is to provide an application of NG-497 in the preparation of drugs for alleviating neuroinflammation.

[0006] Technical solution: The present invention provides the use of NG-497 in the preparation of drugs for alleviating neuroinflammation.

[0007] Furthermore, the concentration of NG-497 is 125-500 nM.

[0008] Furthermore, the application is to inhibit the decomposition of lipid droplets in an inflammatory environment.

[0009] Furthermore, the application is to inhibit the release of inflammatory factors in an inflammatory environment.

[0010] Furthermore, the inflammatory factors include TNF-α, IL-6, IL-1β and CCL-2.

[0011] Furthermore, the application is to promote the expression of MTNR1A in an inflammatory environment.

[0012] Furthermore, the application is to protect hiPSC-derived neurons in an inflammatory environment.

[0013] The present invention also provides a drug for alleviating neuroinflammation, wherein the active ingredient for alleviating neuroinflammation is NG-497.

[0014] Furthermore, the concentration of NG-497 is 125-500 nM.

[0015] Furthermore, the medicine also includes other pharmaceutically acceptable excipients.

[0016] Beneficial effects: Compared with the prior art, the present invention has the following outstanding and significant advantages: This application discloses for the first time that NG-497 targets the melatonin receptor (MTNR1A) and increases its expression, thereby alleviating inflammatory responses. It can effectively inhibit the decomposition of lipid droplets and the release of inflammatory factors, while also protecting hiPSC-derived neurons. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The safe concentration range of NG-497 acting on HMC3 cells (A) and the chemical structure formula of NG-497 (B);

[0018] Figure 2 To verify that NG-497 inhibits the decomposition of lipid droplets in HMC3 cells under inflammatory conditions, A: BODIPY staining flow cytometry statistics; B: BODIPY immunofluorescence staining; C: BODIPY immunofluorescence staining lipid droplet number statistics; D: BODIPY immunofluorescence staining lipid droplet size statistics;

[0019] Figure 3 Results of NG-497 inhibiting the release of inflammatory factors induced by LPS in HMC3 and PMG cells. A: mRNA statistics of TNF-α in HMC3 cells; B: mRNA statistics of IL-6 in HMC3 cells; C: mRNA statistics of IL-1β in HMC3 cells; D: mRNA statistics of CCL-2 in HMC3; D: mRNA statistics of TNF-α in PMG cells; E: mRNA statistics of IL-6 in PMG cells; G: mRNA statistics of IL-1β in PMG cells; H: mRNA statistics of CCL-2 in PMG cells;

[0020] Figure 4 To verify the effect of Atglistatin in inhibiting the release of inflammatory factors induced by LPS in HMC3 cells, A: TNF-α; B: IL-6; C: IL-1β; D: CCL-2;

[0021] Figure 5Verification that the reduction of lipid droplet decomposition mediated by ATGL reduction aggravates the LPS-induced inflammatory response; A: verification diagram of ATGL mRNA level knockdown; B: Western blot diagram of ATGL knockdown; C: mRNA statistics of TNF-α after ATGL knockdown; D: mRNA statistics of IL-6 after ATGL knockdown; E: mRNA statistics of IL-1β after ATGL knockdown; F: mRNA statistics of CCL-2 after ATGL knockdown;

[0022] Figure 6 NG-497 exerts anti-inflammatory effects by upregulating the protein expression of MTNR1A; A: Schematic diagram of Swiss Target predicting NG-497 targets; B, C: Western blot and quantitative graph of MTNR1A in CON, DMSO+LPS, and NG497+LPS groups; D, E: Western blot and quantitative graph of MTNR1B in CON, DMSO+LPS, and NG497+LPS groups; F, G: si-RNA knockdown of MTNR1A Verification diagram of mRNA and protein levels; H: mRNA statistics of TNF-α after si-NC and si-MTNR1A were treated with LPS and NG-497, respectively; I: mRNA statistics of IL-6 after si-NC and si-MTNR1A were treated with LPS and NG-497, respectively; J: mRNA statistics of IL-1β after si-NC and si-MTNR1A were treated with LPS and NG-497, respectively; K: mRNA statistics of CCL-2 after si-NC and si-MTNR1A were treated with LPS and NG-497, respectively;

[0023] Figure 7 To demonstrate the protective effect of NG-497 on hiPSC-derived neurons in an inflammatory environment through hiPSC-induced neurons; A: Representative images of hPSC differentiation into neurons along the timeline; B: Fluorescence staining of NeuN and βIII tubulin; C: PI (propidium iodide) staining of hiPSC-derived neurons stimulated with conditioned medium for 3 hours in CON group, DMSO group, and NG-497 (500nM) group; D: Cell death statistics. DETAILED DESCRIPTION

[0024] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0025] Example 1 Determination of the safe concentration range of NG-497 for HMC3 cells

[0026] The viability of HMC3 cells (Human Microglia Clone 3, purchased from Pronocell Biotech) was detected using Cell Counting Kit-8 (CCK-8) (Dojindo Laboratories, Japan). 3 HMC3 cells were seeded in 96-well plates and treated with different concentrations of NG-497 (0, 15.625nM, 31.25nM, 62.5nM, 125nM, 250nM and 500nM, purchased from MCE) for 24 hours. After adding CCK-8 reagent to MEM culture medium (purchased from Pronosai Biotech) at a ratio of 1:10, 200μL of the prepared CCK-8 solution was added to each well, and the well was placed in a 37°C, 5% CO2 incubator incubated in the dark for 2 hours, and then the absorbance (OD) at 450nm was detected using a multifunctional microplate reader (Bio-Rad, Hercules, CA, USA). The results are shown in Figure 2. Figure 1 As shown in A, the safe concentration range of NG-497 for HMC3 cells is 0-500nM.

[0027] Example 2 Verification of NG-497 inhibiting lipid droplet decomposition in HMC3 cells under inflammatory conditions

[0028] 1. LPS (purchased from Invitrogen, USA) was used to induce a neuroinflammatory environment. After HMC3 cells adhered to the wall, different concentrations of NG-497 (125nM, 250nM and 500nM) were used to pretreat the cells for 2 hours, and then stimulated with LPS (500ng / ml) for 3 hours. After washing with MEM medium three times, BODIPY dye (diluted in 1×PBS at 1:10000) was added, and the cells were stained in the dark for 30 minutes, and then washed with MEM medium three times. After digestion with 0.25% trypsin (Gibco), centrifuged at 1000rpm for 5 minutes, the precipitate was resuspended with 300μl 1×PBS, and the fluorescence intensity was detected by flow cytometry (BD Bioscience). A blank control group (CON) and a DMSO control group were also set up.

[0029] 2. HMC3 cells were cultured at 8×10 4The cells were planted at a density of 1:1000 in a confocal dish. After attachment, they were pretreated with NG-497 (500 nM) for 2 hours and stimulated with LPS (500 ng / ml) for 3 hours. They were fixed with 4% paraformaldehyde (PFA) for 15 minutes, washed 3 times with 1×PBS, and then permeabilized with 0.25% PBST for 20 minutes. After washing 3 times with 1×PBS, BODIPY dye (diluted in 1×PBS at 1:1000) was added, stained in the dark for 15 minutes, washed 3 times with 1×PBS, and DAPI (1:1000, Beyotime, China) was added, stained in the dark for 15 minutes, and washed 3 times with 1×PBS. Fluorescence images were obtained using a laser scanning confocal microscope (FV3000, Olympus, Japan). Images were further analyzed by ImageJ. A blank control group (CON) and a DMSO control group were also set up.

[0030] Flow cytometry staining results Figure 2 As shown in A, with the increase of NG-497 concentration, NG-497 (500nM) can significantly inhibit the decomposition of lipid droplets in HMC3 cells under inflammatory conditions (p<0.05); the results of immunofluorescence staining are shown in Figure 2 As shown in B, the lipid droplets in the NG-497 (500 nM) group were significantly more than those in the DMSO group; the statistical results of the number of lipid droplets by immunofluorescence staining are shown in Figure 2 As shown in C, NG-497 (500nM) can significantly increase the number of lipid droplets in HMC3 cells induced by LPS (500ng / ml) (p<0.01); the statistical results of lipid droplet size by immunofluorescence staining are shown in Figure 2 As shown in D, NG-497 (500 nM) can significantly increase the size of lipid droplets in HMC3 cells induced by LPS (500 ng / ml) (p<0.0001).

[0031] The above results indicate that LPS (500 ng / ml) can induce the production of lipid droplets in HMC3 cells, and NG-497 (500 nM) can inhibit the decomposition of lipid droplets in HMC3 cells under inflammatory conditions.

[0032] Example 3 NG-497 inhibits the release of inflammatory factors induced by LPS in human microglia

[0033] Primary microglia (PMG) were prepared from 1-day-old male C57 / BL6J mice (purchased from Jicui). The cells were cultured in Dulbecco's modified Eagle medium (Gibco) containing 10% fetal bovine serum (Gibco) and 100U / mL antibiotics in an incubator at 37°C and 5% CO2. After 10-12 days of culture, the primary microglia were harvested and transplanted into new cell plates after shaking at 200rpm for 5-10 minutes at room temperature.

[0034] After HMC3 / PMG cells adhered to the wall, they were pretreated with NG-497 (125nM, 250nM, 500nM) for 2 hours, and then stimulated with 500ng / ml LPS for 3 hours. After discarding the supernatant, the cells were washed with 1×PBS, and the total RNA of the cells was extracted with Trizol reagent (purchased from Acre Biotech). Then, the PrimeScriptRT kit (purchased from Acre Biotech) was used to transcribe into cDNA. qRT-PCR was used to detect the mRNA level of inflammatory factors. qRT-PCR was performed according to the instructions of SYBR green Kit (purchased from Acre Biotech). The amplification system was 10 μl and was performed on an ABI7500 PCR instrument (Applied Biosystems). According to the instrument instructions, the parameters were set as follows: Step 1: 95°C, 30 s, 1 cycle; Step 2: 94°C, 5 s, 60°C, 34 s, 45 cycles; Step 3: Melting curve, analyzed by ABI7500 PCR analysis software, calculated the CT value of all samples, and the average CT value of the sample was obtained by the CT value of the duplicate wells. The gene expression was quantitatively normalized to β-Actin, and the relative expression of each group of genes was calculated by the 2-ΔΔCT method, and then plotted by Prism9. A blank control group (CON) and a DMSO control group were also set up.

[0035] The following primers were used:

[0036] β-Actin Forward primer (Human) (5'to3'): GGCACCACACCTTCTACAATGAG β-Actin Reverse primer (5'to3'): GGATAGCACAGCCTGGATAGCA

[0037] TNF-αForward primer(Human)(5'to3'):GTTGTAGCAAACCCTCAAGCTG

[0038] TNF-αReverse primer(5'to3'):CCAGCTGGTTATCTCTCAGCTC

[0039] IL-6Forward primer(Human)(5'to3'):TTCCTGCAGAAAAAGGCAAAGA

[0040] IL-6Reverse primer(5'to3'):CTGCGCAGAATGAGATGAGT

[0041] IL-1βForward primer(Human)(5’to3’):TTCGACACATGGGATAACGAGG

[0042] IL-1βReverse primer(5’to3’):TTTTTGCTGTGAGTCCCGGAG

[0043] CCL-2Forward primer(Human)(5’to3’):GAATCACCAGCAGCAAGTGTC

[0044] CCL-2Reverse primer(5’to3’):CGGAGTTTGGGTTTGCTTGTC

[0045] β-Actin Forward primer(Mouse)(5’to3’):AGATGTGGATCAGCAAGCAG

[0046] β-Actin Reverse primer(5’to3’):GCGCAAGTTAGGTTTTGTCA

[0047] TNF-αForward primer(Mouse)(5’to3’):CATCTTCTCAAAATTCGAGTGAC

[0048] TNF-αReverse primer(5’to3’):TGGGAGTAGACAAGGTACAACCC

[0049] IL-6Forward primer(Mouse)(5’to3’):CTAGGTTTGCCGAGTAGATCTC

[0050] IL-6Reverse primer(5’to3’):GACAAAGCCAGAGTCCTTCAGAGAG

[0051] IL-1βForward primer(Mouse)(5’to3’):TGCCACCTTTTGACAGTGATG

[0052] IL-1βReverse primer(5’to3’):ATGTGCTGCTGCGAGATTTG

[0053] CCL-2Forward primer(Mouse)(5'to3'):TTAAAAACCTGGATCGGAACCAACCL-2Reverse primer(5'to3'):GCATTAGCTTCAGATTTACGGGT

[0054] The results of HMC3 and PMG cells are as follows Figure 3 As shown in the figure, the expression of inflammatory factors (TNF-α, IL-6, IL-1β, CCL-2) in the DMSO group after LPS induction was significantly increased, proving that the induction was successful. Compared with the DMSO group, the NG-497 (500nM) group was able to reduce the release of TNF-α (p<0.01), IL-6 (p=0.07), IL-1β (p<0.01), and CCL-2 (p<0.05) in HMC3 cells after LPS induction ( Figure 3 A~D); the results of PMG cells are as follows Figure 3 As shown in E to H, compared with the DMSO group, the NG-497 group failed to significantly reduce the release of TNF-α, IL-6, IL-1β and CCL-2 in PMG after LPS induction.

[0055] The above results indicate that NG-497 is only effective on the release of inflammatory factors induced by LPS in human cells, and is basically ineffective on mouse cells.

[0056] Example 4 Effect of Atglistatin on the release of inflammatory factors induced by LPS in HMC3 cells

[0057] After HMC3 cells adhered to the wall, they were pretreated with Atglistatin (500 nM, purchased from MCE) for 2 hours and then stimulated with LPS for 3 hours. After discarding the supernatant, the cells were washed with 1× PBS and the total RNA of the cells was extracted with Trizol reagent (purchased from Acre Bio). Then, the cells were transcribed into cDNA using the PrimeScriptRT kit (purchased from Acre Bio). The mRNA levels of inflammatory factors were detected by qRT-PCR, and the detection method and primers used were the same as those in Example 3.

[0058] The results are as follows Figure 4As shown, in HMC3 cells, compared with the DMSO group, the Atglistatin group can only reduce the release of TNF-α (p<0.05), and cannot reduce the release of IL-6, IL-1β, and CCL-2. The "Pharmacological Upregulation of Microglial Lipid Droplet Alleviates Neuroinflammation and Acute Ischemic Brain Injury" published by Li H. et al. mentioned that Atglistatin can reduce the expression of inflammatory factors (IL-1a, IL-1b, IL-6 and TNF), but it was experimented in primary mouse microglia and was not verified in human cells. After experimental verification in this application, it was proved that Atglistatin has a poor inhibitory effect on the expression of inflammatory factors in human cells, and can only reduce the release of TNF-α, which is far less effective than NG-497.

[0059] Example 5 Verification of ATGL-mediated reduction in lipid droplet decomposition aggravates LPS-induced inflammatory response and exerts anti-inflammatory effects

[0060] HMC3 cells were seeded in a cell plate, and si-NC group and si-ATGL group were set up. The si-NC group was the control group, and the si-ATGL group was the ATGL expression control group. The si-ATGL was a kit provided by Shanghai Heyuan Biotechnology Co., Ltd. KeygenMax (purchased from Keygen Bio) was used as a transfection reagent. The mixture of KeygenMax, Opti-MEM and si-RNA was incubated at room temperature for 15-20 minutes and added to the culture plate seeded with HMC3 cells. After 6 hours, fresh MEM medium (containing 10% fetal bovine serum and 100U / mL antibiotics) was replaced. The mRNA level of the ATGL gene was detected by qRT-PCR on the second day of transfection: the supernatant was discarded, washed with 1×PBS, and the total RNA of the cells was extracted with Trizol reagent (purchased from Acre Bio). Then, cDNA was transcribed using the PrimeScriptRT kit (purchased from Acre Bio). qRT-PCR was performed on an ABI7500 PCR instrument (Applied Biosystems) and SYBRgreenKit (purchased from Acre Biosystems). The gene expression was quantitatively normalized to β-Actin. The detection method and primers used were the same as those in Example 3.

[0061] The primers used to detect PNPLA2 (ATGL) were Forward primer (Human) (5' to 3'): GGCTTCCTCGGCGTCTACTA; Reverse primer (5' to 3'): TTTACCAGGTTGAAGGAGGGG.

[0062] The si-RNA sequences used are: si-NC (5'to3'): sense UUCUCCGAACGUGUCACGUT T, antisense ACGUGACACGUUCGGAGAATT; si-ATGL-1 (5'to3'): sense CCUUCAACCUGGUAAAGAUTT, antisense AUCUUUACCAGGUUGAAGGTT; si-ATGL-2(5'to3'): senseCUGCCACUCUAUGAGCUUATT, antisense UAAGCUCAUAGAGUGGC AGTT; si-ATGL-3(5'to3'): sense CUGGUGCCAAGUUCAUUGATT, antisense UCA AUGAACUUGGCACCAGTT.

[0063] The results are as follows Figure 5 As shown in A, compared with the si-NC group, the si-ATGL groups were able to significantly reduce the mRNA level of ATGL in HMC3 cells, among which si-ATGL-1 had the best effect.

[0064] On the third day after transfection, the expression level of ATGL gene was detected by Western Blot: after discarding the supernatant, the cells were washed with 1×PBS buffer, NP-40 protein lysis buffer (purchased from Beyotime, China) was added, the protein was scraped into a 1.5ep tube, centrifuged at 12000rpm for 30 minutes, and the supernatant was aspirated. The protein was quantified using the BCA method, and then dissolved in 5×Loading buffer and boiled for 5 minutes. Electrophoresis was performed on a 12.5% ​​polyacrylamide gel, and the protein was transferred to a PVDF membrane, blocked with 5% skim milk at room temperature for 2 hours, and the first antibody (ATGL, Proteintech, 55190-1-AP; β-actin, Bioworld, AP0060) was added respectively, overnight at 4°C, and the horseradish peroxide-labeled secondary antibody (1:5000) was combined for 2 hours, and the protein expression was determined by enhanced chemiluminescence, with β-actin as the internal reference.

[0065] The results are as follows Figure 5As shown in B, all si-ATGL groups were able to reduce the protein level of ATGL in HMC3 cells, among which si-ATGL-1 had the best effect.

[0066] Determine the si-RNA (si-ATGL-1) with the best knockout efficiency to transfect HMC3 cells, and change the medium after 6 hours. After 3 hours of LPS (500ng / ml) stimulation on the second day, discard the supernatant, wash with 1×PBS, and extract the total RNA of the cells with Trizol reagent (purchased from Acre Biotech). Then use PrimeScriptRT kit (purchased from Acre Biotech) to transcribe cDNA. qRT-PCR was performed on ABI7500PCR instrument (Applied Biosystems) and SYBRgreenKit (purchased from Acre Biotech). Gene expression was quantitatively normalized to β-Actin. qRT-PCR detected the mRNA level of inflammatory factors, and the detection method and primers used were the same as in Example 3. In addition, HMC3 cells that were not treated with LPS were set as the control group CON.

[0067] The results are as follows Figure 5 As shown in C to F, compared with the NC group, the mRNA levels of TNF-α, IL-6, IL-1β, and CCL-2 in the si-ATGL group were significantly increased after 3 hours of LPS (500 ng / ml) stimulation. This result indicates that in HMC3 cells, knocking down ATGL promoted the release of LPS-induced inflammatory factors, thereby proving that NG-497 does not exert its anti-inflammatory effect by inhibiting ATGL.

[0068] Example 6 NG-497 inhibits LPS-induced inflammatory response in HMC3 cells by promoting the expression of MTNR1A

[0069] Swiss Target was used to predict possible targets of NG-497. Figure 6 As shown in A, the top three possible targets of NG-497 are MTNR1A, MTNR1B and CDK1. The first two targets, MTNR1A and MTNR1B, are melatonin receptors and are related to inflammation, so the main focus is on these two receptors.

[0070] HMC3 cells were seeded in a cell plate, pretreated with NG-497 (500nM) for 2 hours on the next day, and then stimulated with LPS (500ng / ml) for 3 hours. The expression levels of MTNR1A and MTNR1B genes were detected by Western Blot. After discarding the supernatant, the cells were washed with 1×PBS buffer, and NP-40 protein lysis buffer was added. The protein was scraped into a 1.5ep tube, centrifuged at 12000rpm for 30 minutes, and the supernatant was aspirated. The protein was quantified using the BCA method, and then dissolved in 5×Loading buffer and boiled for 5 minutes. Electrophoresis was performed on 12.5% ​​polyacrylamide gel, and the protein was transferred to PVDF membrane, blocked with 5% skim milk at room temperature for 2 hours, and the first antibody MTNR1A or MTNR1B (MTNR1A, Santa, sc-390328; MTNR1B, Abcam, ab203346; β-actin, Bioworld, AP0060) was added, respectively, overnight at 4°C, and the horseradish peroxide-labeled secondary antibody (1:5000) was combined for 2 hours. The expression of the protein was determined by enhanced chemiluminescence, and β-actin was used as an internal reference. A blank control group (CON) and a DMSO control group were also set up. Each group was repeated 3 times.

[0071] The results are as follows Figure 6 As shown in B and C, NG-497 (500 nM) can upregulate the expression level of MTNR1A in HMC3 cells after LPS treatment; Figure 6 As shown in D and E, NG-497 (500 nM) failed to significantly regulate the expression level of MTNR1B in HMC3 cells after LPS treatment, so it was speculated that MTNR1A was a possible target of NG-497.

[0072] To further confirm the hypothesis, si-NC group and si-MTNR1A group were set up, si-NC group was the control group, si-MTNR1A group was the MTNR1A expression control group, si-MTNR1A was a kit provided by Shanghai Heyuan Biotechnology Co., Ltd., and the method for verifying the knockdown level was the same as in Example 5. On the second day, NG-497 (500 nM) was added for pretreatment for 2 hours, and LPS (500 ng / ml) was added for stimulation for 3 hours, and the mRNA level of inflammatory factors was detected by qRT-PCR, and the detection method and primers used were the same as in Example 3.

[0073] The primers used to detect MTNR1A were Forward primer (Human) (5' to 3'): AGGGACTCTCCAGTACGACC; Reverse primer (5' to 3'): GTTTGCGGTCAGGTTTCACC.

[0074] The si-RNA sequence used was si-MTNR1A (5' to 3'): sense CAGUCUCAAGUACGACAA ATT, antisense UUUGUCGUACUUGAGACUGTT.

[0075] The results are as follows Figure 6 As shown in F~K, Figure 6 F and G show that si-MTNR1A can downregulate the mRNA and protein levels of MTNR1A in HMC3 cells; Figure 6 H-K showed that in the si-MTNR1A group, compared with the DMSO+LPS group, the NG-497+LPS group failed to reduce the mRNA levels of TNF-α, IL-6, IL-1β, and CCL-2, proving that NG-497 inhibited the LPS-induced inflammatory response by promoting the expression of MTNR1A.

[0076] Example 7 NG-497 has a protective effect on neurons in an inflammatory environment

[0077] To induce differentiation, hiPSC (human induced pluripotent stem cells, purchased from Saibei Bio) clones were digested with dispase (Life Technologies) in an incubator for 1 minute, washed once with DMEM / F12 (Gibco), and then resuspended in neural differentiation medium (NIM). hiPSC clones require 7 days to form embryoid bodies (EBs). On the 7th day, EBs were aspirated with a 1ml pipette, centrifuged at 800rpm for 1 minute, resuspended in NIM (containing 10% fetal bovine serum, Gibco) medium, and placed in a six-well plate. From the 7th to the 16th day, EBs attached to the six-well plate to form rosettes. On the 17th day, the rosettes were blown off, centrifuged at 1000rpm for 1 minute, and resuspended in a T25 bottle with NIM (containing 2% B27, Gibco) to form neurospheres (NS). On day 26, NS were collected, digested with TryplE (Life Technologies) for 5-10 minutes, and seeded at an appropriate density in a confocal microplate coated with Matrigel (BD Biosciences) in advance. On day 28, hiPSC-derived neurons were verified by immunofluorescence staining. After discarding the culture medium, the membrane was fixed with 4% paraformaldehyde (PFA) for 30 minutes, washed three times with 1×PBS, and then permeabilized with 0.25% PBST for 20 minutes. After washing three times with 1×PBS, the membrane was blocked with 2% BSA for 2 hours, and the primary antibody NeuN (1:500, Abcam) and βIII tubulin (1:500, Genetex) were added at 4°C overnight, washed three times with 1×PBS, and the secondary fluorescent antibody (1:500, Invitrogen, USA) was added, incubated at room temperature in the dark for 2 hours, washed three times with PBS, and DAPI (1:1000, Beyotime, China) was added, incubated at room temperature in the dark for 15 minutes, and washed three times with 1×PBS. Fluorescence images were obtained using a laser scanning confocal microscope (FV3000, Olympus, Japan). Figure 7 A shows representative images of hiPSC-to-neuron differentiation along the timeline. Figure 7 B shows the results of NeuN and βIII tubulin fluorescence staining, which proves that hiPSCs have successfully induced neurons. 4 hiPSC-derived neurons were resuspended in confocal microplates.

[0078] PI staining was used to verify the protective effect of NG-497 on hiPSC-derived neurons. Conditioned culture media (CON-CM, DMSO+LPS-CM, NG-497+LPS-CM) of HMC3 cells stimulated with LPS (500 ng / ml) for 24 hours in the CON group, DMSO group, and NG-497 (500 nM) group were collected respectively, and 500 μl was added to hiPSC-derived neurons, cultured for 3 hours, and PI (propidium iodide) was added for light staining for 15 minutes, and washed 3 times with 1× PBS. Fluorescence images were obtained using a laser scanning confocal microscope (FV3000, Olympus, Japan). Images were further analyzed by ImageJ.

[0079] like Figure 7 As shown in C, the death rate of neurons in the NG-497 group was lower than that in the DMSO group (p<0.01); Figure 7 As shown in D, there was no statistical difference in neuronal mortality between the NG-497+LPS-CM group and the CON-CM group.

[0080] The above results indicate that NG-497 has a protective effect on hiPSC-derived neurons in an inflammatory environment.

Claims

1. Application of NG-497 in the preparation of drugs for alleviating neuroinflammation.

2. The use according to claim 1, characterized in that: The concentration of NG-497 is 125-500 nM.

3. The use according to claim 1, characterized in that: The application is to inhibit the decomposition of lipid droplets in an inflammatory environment.

4. The use according to claim 1, characterized in that: The application is to inhibit the release of inflammatory factors in an inflammatory environment.

5. The use according to claim 4, characterized in that: The inflammatory factors include TNF-α, IL-6, IL-1β and CCL-2.

6. The use according to claim 1, characterized in that: The application is to promote the expression of MTNR1A in an inflammatory environment.

7. The use according to claim 1, characterized in that: The application is to protect hiPSC-derived neurons in an inflammatory environment.

8. A drug for alleviating neuroinflammation, characterized in that: The active ingredient used to relieve neuroinflammation is NG-497.

9. The drug according to claim 8, characterized in that The concentration of NG-497 is 125-500 nM.

10. The drug according to claim 8, characterized in that The medicine also includes other pharmaceutically acceptable excipients.

Images