Rice SDV1 gene as well as encoding protein and application thereof

Abstract

At present, most reported rice dwarf mutants are drastically changed in plant height and seriously influence the yield, so that the rice dwarf mutants are difficult to actually use in breeding. However, at present, a'fine tuning gene 'capable of dwarfing the plant height in a small range under the background of sd1 is extremely lacked. The invention relates to a gene SDV1 for regulating the plant height. According to the nucleotide sequence of the SDV1 gene, one or more nucleotides can be added, substituted, inserted or deleted in the nucleotide sequence shown in SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.4 to generate a mutant, an allele or a derivative. Through phenotype analysis, genetic analysis, gene cloning and expression analysis of the two dwarf mutants, the function of the dwarf mutants participating in rice plant height development regulation is defined, and favorable gene resources are provided for lodging-resistant breeding of rice.

Description

Technical Field

[0001] The present invention relates to the field of plant molecular breeding, and in particular to a rice SDV1 gene, a protein encoded therein and an application thereof. Background Art

[0002] Lodging is a phenomenon in which upright-growing crops become crooked in patches or even fall to the ground. Lodging not only leads to a decrease in crop yield and quality, but also makes harvesting extremely difficult. For example, when wheat and rice suffer from severe lodging, the yield may even be reduced by more than half. Since lodging often occurs in the middle and late stages of crop growth, which is the most critical stage for crop inoculation, if cereal crops such as rice and wheat lodge after jointing, the losses will be even more severe. Among them, plant height is one of the main factors that affect crops and may cause lodging. Therefore, the height of rice plants is closely related to its high / stable yield.

[0003] The reasons for rice lodging can be summarized as follows:

[0004] The first is the variety factor. The lodging resistance of different varieties varies greatly. High-quality rice varieties that are resistant to lodging usually have characteristics such as short plant height, thick stems and firm leaves;

[0005] The second factor is fertility. Excessive application of nitrogen fertilizer, especially in the late stage of rice growth, will lead to a decrease in the cellulose content of cells at the base of the stalk, thinning of the cell wall, and loosening of the tissue structure, which makes it easy for the plant to fall over.

[0006] In addition, water management is also an important factor. If the water level is kept too high for a long time, the soil permeability will be poor, the root system will be poorly developed, and it will be easy to be poisoned. The root system is weak, which will cause the rice to grow too high, the stems will be soft, and the resistance to lodging will be reduced;

[0007] In addition, the invasion of pests and diseases can also cause rice to become weak and fall over, such as sheath blight;

[0008] Finally, tillage management is also an important factor. For example, dense planting and shallow tillage will cause the internodes at the base of the rice to become elongated, the tissue to become loose, and it will be easy to fall over.

[0009] At present, a semi-dwarf mutant gene (sd1) encoding gibberellins (GAs) biosynthetic enzyme in the prior art has been introduced into modern cultivated rice, making it have the dual advantages of tolerance to dense planting and resistance to lodging, thereby greatly increasing rice yield. It can be said that this is a "green revolution" based on plant height. In the current rice breeding process, the semi-dwarf phenotype has become one of the most important breeding goals and is the basis for high and stable yields of modern rice, indicating the importance of plant height to rice yield. A large number of genetic studies have shown that the plant type of rice is mainly related to the synthesis, metabolism and signal transduction pathways of various plant hormones (such as gibberellins (GA), brassinolide (BR), strigolactone (SL) and auxin (IAA)) and their mutual influence.

[0010] Some literature related to plant height regulation is also disclosed in the prior art, such as the OsNramp5 mutant and its related products and applications disclosed in CN117447567A, which mentions the application of the amino acid sequence of the OsNramp5 mutant in plant height regulation.

[0011] However, with the changes in modern cultivation conditions, such as direct seeding, light and simple cultivation, and mechanized operation, higher requirements are placed on rice plant type and lodging resistance. In order to adapt to these changes, breeders have proposed a new idea of ​​further reducing plant height slightly on the basis of semi-dwarf mutant genes to cultivate "dwarf among dwarf" type rice. This scheme has the following advantages: 1) further improve lodging resistance; 2) adapt to direct seeding and mechanized operation; 3) increase planting density, ensure total effective panicles, and avoid the impact of reduced plant height on yield. Recently, Liu et al. discovered a new rice plant height regulation gene called Shortened Basal Internodes (SBI), and used its allelic variation to cultivate some new rice varieties with lodging resistance, high and stable yield, and strong adaptability, proving that the molecular breeding strategy of cultivating "dwarf among dwarf" type rice based on semi-dwarf mutant genes is feasible.

[0012] Obviously, the realization of this plan depends on the exploration of genetic resources that can fine-tune plant height based on semi-dwarf mutant genes. However, such genes for fine-tuning plant height are relatively scarce at present. Therefore, continuing to explore and conduct in-depth research on new rice semi-dwarf gene resources will have the potential to further improve the yield potential and stability of rice, which has clear practical application value.

[0013] This study, through phenotypic analysis, genetic analysis, gene cloning and expression analysis of two dwarf mutants, identified the genes involved in the regulation of rice plant height development and internode development of stems, and laid the foundation for further analysis of the molecular regulatory network of rice straw development, providing genetic resources for breeding. In addition, on the one hand, due to differences in understanding among those skilled in the art; on the other hand, because the applicant studied a large number of literature and patents when making the present invention, but due to space limitations, not all details and contents are listed in detail, however, this is by no means that the present invention does not have the characteristics of these prior arts, on the contrary, the present invention already has all the characteristics of the prior art, and the applicant reserves the right to add relevant prior art in the background technology. Summary of the invention

[0014] At present, the control of rice plant height and lodging resistance is mainly based on the sd1 gene discovered and applied many years ago. In the new era, intensive rice production faces a series of challenges of changes in cultivation conditions, such as direct seeding, light and simple cultivation, and mechanized operation, which put forward higher requirements on rice plant type and lodging resistance. In theory, it is necessary to further dwarf the plant height slightly under the background of sd1 and cultivate "dwarf among dwarf" type rice to further improve its lodging resistance. Since most of the rice dwarf mutants reported so far have drastic changes in plant height and seriously affect yield, they are difficult to use in breeding. At present, there is an extreme lack of "fine-tuning genes" that can slightly dwarf plant height under the background of sd1.

[0015] In one aspect, the present application relates to a protein SDV1 for regulating plant height. The amino acid sequence of the protein SDV1 is shown in A1), A2) or A3) below:

[0016] A1) SEQ ID NO.1;

[0017] A2) a protein derived from rice and having more than 90% identity with the protein described in A1) and having the same function;

[0018] A3) A fusion protein obtained by connecting a tag to the N-terminus or / and the C-terminus of A1) or A2). Preferably, the sequence of the protein SDV1 regulating plant height is the amino acid sequence shown in SEQ ID NO.1.

[0019] Another aspect of the present application relates to a gene SDV1 for regulating plant height. The nucleotide sequence of the SDV1 gene can generate a mutant, allele or derivative by adding, replacing, inserting or deleting one or more nucleotides in the nucleotide sequence shown in SEQ ID NO.2 or SEQ ID NO.3. Preferably, the nucleotide sequence encoding the protein SDV1 is shown in SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.4.

[0020] Another aspect of the present application relates to the use of protein SDV1 or a gene encoding protein SDV1 in controlling the thickness of the stem wall of the basal internodes of a plant.

[0021] Another aspect of the present application relates to the use of protein SDV1 or a gene encoding protein SDV1 in controlling the length of plant stem nodes.

[0022] Another aspect of the present application relates to a recombinant DNA recombinant vector, cell or strain comprising the gene SDV1 for regulating plant height.

[0023] According to a preferred embodiment, the strain is Agrobacterium or Escherichia coli.

[0024] Another aspect of the present application relates to a method for improving lodging resistance of rice, comprising the following steps:

[0025] Down-regulate the expression of SDV1 gene in rice,

[0026] Or down-regulate the expression of the protein encoded by the SDV1 gene in rice,

[0027] Or reduce the activity of the protein encoded by the SDV1 gene in rice.

[0028] According to a preferred embodiment, the present application also relates to a method for regulating the plant height of a plant with an sd1 genetic background, the method comprising downregulating the expression of the SDV1 gene in the plant, or downregulating the expression of the protein encoded by the SDV1 gene in the plant, or reducing the activity of the protein encoded by the SDV1 gene in the plant. Preferably, the plant can be a grass crop such as rice, wheat or corn.

[0029] According to a preferred embodiment, the method for down-regulating the expression level of the SDV1 gene in rice, down-regulating the expression level of the protein encoded by the SDV1 gene in rice, or reducing the activity of the protein encoded by the SDV1 gene in rice comprises:

[0030] Delete bases AG at positions 307-308 (or 56-57 in the coding region) of the SDV1 gene;

[0031] Delete bases CAAGA from positions 307-311 (or 56-60 in the coding region) of the SDV1 gene;

[0032] Inserting base A at position 307 (or 56 in the coding region) of the SDV1 gene; or

[0033] The recombinant vector for knocking out the SDV1 gene was set up with the sequence indicated by the sgRNA target site.

[0034] The SDV1 gene contains two exons. Figure 2As shown in D, the protein domain corresponding to the first exon includes a leucine rich repeat domain (leucine rich repeats, LRRs) and a kinase domain. The sequence of the first exon is shown in SEQ ID NO.4. The knockout target (target sequence is TCGTCTTGCTGCGCTGGTCG) and the mutation site of the mutant given in the examples of the present application are all located on the first exon. The experimental results show that destroying the functional domain of the first exon can cause the loss of SDV1 gene function.

[0035] Based on this, another aspect of the present application relates to a method for improving rice plant type, comprising the following steps: modifying the first exon of the SDV1 gene to reduce the expression level or activity of the protein encoded by the SDV1 gene. Preferably, modifying the first exon of the SDV1 gene may be to destroy the structure of the leucine-rich repeat domain in the protein encoded by the SDV1 gene. Modifying the first exon of the SDV1 gene may be to destroy the structure of the kinase domain in the protein encoded by the SDV1 gene. More preferably, modifying the first exon of the SDV1 gene comprises:

[0036] Delete bases AG at positions 307-308 (or 56-57 in the coding region) of the SDV1 gene;

[0037] The CAAGA bases at positions 307-311 (or 56-60 in the coding region) of the SDV1 gene were deleted;

[0038] Insert base A at position 307 (or 56 in the coding region) of the SDV1 gene;

[0039] A mutation in position 754 of the protein encoded by the SDV1 gene; or

[0040] The protein encoded by the SDV1 gene has a mutation at position 868.

[0041] Preferably, the mutation at position 754 of the protein encoded by the SDV1 gene may be a mutation from lysine (Lys) to glutamic acid (Glu). The mutation at position 868 of the protein encoded by the SDV1 gene may be a mutation from histidine (His) to arginine (Arg).

[0042] According to a preferred embodiment, the method for down-regulating the expression level of the SDV1 gene in rice, down-regulating the expression level of the protein encoded by the SDV1 gene in rice, or reducing the activity of the protein encoded by the SDV1 gene in rice comprises:

[0043] The SDV1 gene or an expression construct / vector containing the SDV1 gene is introduced into plants.

[0044] Preferably, the method for introducing the recombinant vector into plants can be Agrobacterium-mediated method, gene gun method, electroporation method, pollen tube introduction method, liposome fusion method and any other method that can introduce plasmids into plant cells or tissues.

[0045] Another aspect of the present application relates to a method for increasing the yield or biomass of a plant, the method comprising the following steps:

[0046] Up-regulate the expression of SDV1 gene in rice,

[0047] or up-regulating the expression of the protein encoded by the SDV1 gene in rice,

[0048] Or increase the activity of the protein encoded by the SDV1 gene in rice.

[0049] According to a preferred embodiment, the method of upregulating the expression level of the SDV1 gene in rice, upregulating the expression level of the protein encoded by the SDV1 gene in rice, or increasing the activity of the protein encoded by the SDV1 gene in rice comprises gene knockout, RNA interference, or natural variant screening.

[0050] Another aspect of the present application relates to a recombinant vector for regulating plant height. The recombinant vector comprises a transcribable DNA sequence encoding an mRNA molecule. Preferably, the mRNA molecule comprises a sequence complementary to at least 15 consecutive nucleotides of the SDV1 gene encoding a monocotyledonous plant. Preferably, the mRNA molecule comprises a sequence complementary to at least 15 consecutive nucleotides of the second exon of the SDV1 gene encoding a monocotyledonous plant. The recombinant vector also comprises a promoter that is expressible in a plant and is operably linked to the transcribable DNA sequence.

[0051] The present invention also provides the recombinant vector of the SDV1 gene comprising the aforementioned regulating rice plant type.Preferably, the basic vector of the recombinant vector comprises a prokaryotic expression vector and / or a eukaryotic expression vector.More preferably, the recombinant vector comprises a binary agrobacterium vector or a vector that can be used for plant gene gun bombardment, such as pCAMBIA3301, pCAMBIA2300, pCAMBIA2301, pCAMBIA1300, pCAMBIA1301, pWM101, pGreen0029, pBI121, pBin19, pCAMBIA1301-UbiN, etc. or other derived plant expression vectors.More preferably, the recombinant vector can use an enhancer, including a translation enhancer or a transcription enhancer, and these enhancer regions can be an ATG start codon (in the reading frame of the coding sequence) or an adjacent region start codon (in the reading frame of the coding sequence), etc.Preferably, enhancers are known in the art, including SV40 enhancer regions, 35S enhancer elements, etc.

[0052] The SDV1 gene with a mutation site that has the effect of inhibiting plant height involved in the present application can be isolated from natural materials or obtained by artificial sequence synthesis. The above-mentioned "isolated" refers to materials such as nucleic acids or proteins, which are basically or essentially free of components that usually accompany or interact with the material in the natural environment, or if the material is in its natural environment, the material has been changed into a composition and / or placed in a cell at a location other than the natural location of the material through deliberate human intervention.

[0053] The recombinant vector can use a gene encoding an enzyme or luminescent compound that is expressed in plants and produces a color change, an antibiotic resistance marker, or a chemical resistance marker gene to screen positive plants.

[0054] Another aspect of the present application relates to the use of the SDV1 gene in controlling plant height and lodging resistance.

[0055] Another aspect of the present application relates to a method for reducing rice plant height. The method comprises one or more of the following:

[0056] Reduce the amount of protein expressed by the SDV1 gene in recipient rice;

[0057] Reducing or blocking the activity of the protein expressed by the SDV1 gene in the recipient rice;

[0058] Reduce or block the correct expression of the SDV1 gene in the recipient rice,

[0059] A rice plant with reduced plant height is obtained, wherein

[0060] Another aspect of the present application relates to a method for improving rice lodging resistance. The method comprises the following steps: gene editing the SDV1 gene in a recipient rice to obtain a gene-edited rice; compared with the recipient rice, the plant height of the gene-edited rice is improved;

[0061] The proteins expressed by the SDV1 gene are as follows A1), A2) or A3):

[0062] A1) Protein expressed by SDV1 gene;

[0063] A2) a protein derived from rice that is more than 90% identical to the protein described in A1) and has the same function;

[0064] A3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of A1) or A2).

[0065] Another aspect of the present application relates to a method for increasing the thickness of the stem wall of the base internode of rice. The method comprises one or more of the following:

[0066] Reduce the amount of protein expressed by the SDV1 gene in recipient rice;

[0067] Reducing or blocking the activity of the protein expressed by the SDV1 gene in the recipient rice;

[0068] Reduce or block the correct expression of the SDV1 gene in the recipient rice,

[0069] A rice having an increased thickness of the stem wall of the internodes at the base of the rice is obtained, wherein:

[0070] The proteins expressed by the SDV1 gene are as follows A1), A2) or A3):

[0071] A1) Protein expressed by SDV1 gene;

[0072] A2) a protein derived from rice and having more than 90% identity with the protein described in A1) and having the same function;

[0073] A3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of A1) or A2).

[0074] The technical problem to be solved by the present invention is to provide a new rice semi-dwarf gene SDV1 and its encoded protein. After knocking out or inactivating the gene through CRISPR / Cas9 editing technology and other methods, the plant height of rice and other crops can be moderately reduced and the lodging resistance can be significantly increased to maintain the yield stability of the crop. Therefore, the gene has clear application potential in the field of breeding.

[0075] Through EMS mutagenesis combined with precise phenotypic identification, this application created mutants (sdv1-1 and sdv1-2) that slightly dwarfed plant height under the background of sd1; using genetics combined with molecular biology techniques, cloned the "fine-tuning gene" SDV1 that can slightly dwarf plant height under the background of sd1; through genetic techniques such as gene editing, it was confirmed that inactivating this gene (sdv1-3 and sdv1-4) can reduce plant height and significantly increase lodging resistance.

[0076] This application screened for a mutant that fine-tuned the height of rice plants and successfully cloned the gene. After knocking out the gene in the japonica rice ZH11 material using CRISPR / Cas9 technology, the height of the rice plants was significantly reduced and the lodging resistance was significantly enhanced, but the yield was not significantly affected.

[0077] Another aspect of the present application relates to a gene SDV1 or protein SDV1 that regulates rice plant height.

[0078] Another aspect of the present application relates to various forms of inactivated, downregulated mutant strains sdr or sdv of the gene SDV1 or protein SDV1 (including possible forms such as knockout, RNAi, natural variants, etc.).

[0079] On the other hand, the present application relates to an inactivated mutant sdv1 of the gene SDV1 or protein SDV1 in various backgrounds such as indica and japonica rice.

[0080] Another aspect of the present application relates to the use of gene SDV1 or protein SDV1 or materials related to the regulation of gene SDV1 or protein SDV1 in regulating rice plant height and lodging resistance.

[0081] Another aspect of the present application relates to any of the above-mentioned plasmids, strains or plants containing various variants of the gene SDV1 or protein SDV1 and their use in regulating plant height or lodging resistance.

[0082] In the present application, plants with a targeted regulatory gene SDV1 can be obtained by gene editing to modify the plants, thereby achieving the purpose of interfering with the plant phenotype by regulating the plant protein SDV1, or regenerated hybrid plants can be obtained by plant somatic cell hybridization to regulate the plant protein SDV1.

[0083] Another aspect of the present application relates to an SDV1 gene variant. Preferably, the SDV1 gene variant comprises at least one mutation in the SDV1 gene.

[0084] Another aspect of the present application relates to the use of the SDV1 gene in improving lodging resistance of plants. Preferably, plants containing SDV1 gene variants are obtained by hybridization with plants under other genetic backgrounds. Preferably, rice plants obtained by hybridization with SDV1 gene variants into plants under other genetic backgrounds can improve lodging resistance of rice.

[0085] Another aspect of the present application relates to a non-viable or non-renewable plant product, which comprises a DNA recombinant vector, a cell or a strain having the gene SDV1 for regulating plant height.

[0086] Another aspect of the present application relates to a non-viable or non-renewable plant product, which comprises: a DNA recombinant vector, cell or strain having the gene SDV1 for regulating plant height; and a non-viable or non-renewable rice plant part.

[0087] Beneficial effects of this technical solution:

[0088] The present application discovered a gene for fine-tuning plant height without affecting yield, which provides a new gene resource for high and stable rice yields and the cultivation of varieties that are adaptable to mechanized and simplified operations, and also provides gene sequences for cloning related genes for other crops using the homologous gene method.

[0089] At the same time, the genes cloned in this application provide a basis for further regulating the plant height of dwarf rice and provide more genetic resources for the resistance of rice during field cultivation.

[0090] This application verifies the effect of SDV1 on plant growth in different backgrounds of japonica rice and indica rice. The results show that in different backgrounds, SDV1 does not affect rice yield and can dwarf rice and increase rice lodging resistance. This result also further reduces the difficulty of promoting and applying SDV1 gene mutant plants (or rice with invalid SDV1 genes). BRIEF DESCRIPTION OF THE DRAWINGS

[0091] Figure 1 Phenotypic identification of d30 mutant; A. Comparison of plant height between wild type and d30 mutant at seedling stage; B. Comparison of plant height between wild type and d30 mutant at mature stage; C. Comparison of internode length between wild type and d30 mutant; D. Comparison of panicle between wild type and d30 mutant; E. Comparison of single plant yield between wild type and d30 mutant;

[0092] Figure 2 is the cloning of the mutation site of SDV1 gene; A. Distribution of SNPs on chromosomes in the d30 mutant pool; B. Distribution of SNPs on chromosomes in the d30-2 mutant pool; C. Schematic diagram of SDV1 protein structure and mutation site; D. Schematic diagram of SDV1 gene structure;

[0093] Figure 3 This is the knockout plant type of SDV1 in japonica rice ZH11 material; A. Comparison of the whole plant and plant height statistics of ZH11 and SDV1 knockout mutants at maturity; B-D. Comparison of the internode lengths, internode thickness and plant height statistics of ZH11 and SDV1 knockout mutants; E. Plant height statistics of ZH11 and SDV1;

[0094] Figure 4 The following are the phenotypic statistics of the complementary positive strains in the SDV1 knockout mutants; A. SDV1 sequence verification results of the knockout mutants and complementary positive strains; B, C. Phenotypic images of the knockout mutants and complementary positive strains; D. Agronomic trait data statistics of the knockout mutants and complementary positive strains;

[0095] Figure 5The results are as follows: Yield and lodging resistance evaluation of SDV1 knockout mutants; A. Comparison of grain length between ZH11 and SDV1 knockout mutants; B. Comparison of grain width between ZH11 and SDV1 knockout mutants; C. Statistics of grain length, grain width and 1000-grain weight between ZH11 and SDV1 knockout mutants; D. Comparison of ear between ZH11 and SDV1 knockout mutants; E. Statistics of ear length, primary stalk and secondary stalk between ZH11 and SDV1 knockout mutants; F. Statistics of grain length, primary stalk and secondary stalk between ZH11 and SDV1 knockout mutants Statistics of seed filling rate, number of filled grains per ear and number of tillers; G~H. Comparison and statistics of single plant yield of ZH11 and SDV1 knockout mutants; I. Lodging of ZH11 and SDV1 knockout mutant lines in the field; Representative plants in Figure JI; K. Comparison of stem wall thickness at the base of internodes of ZH11 and SDV1 mutants; L. Statistics of per mu yield of ZH11 and SDV1 under different fertility and planting conditions in the field; M. Comparison of stem wall thickness at the base of internodes of ZH11 and SDV1 mutants. DETAILED DESCRIPTION

[0096] The following is a detailed description with reference to the accompanying drawings.

[0097] For those skilled in the art, the specific meanings of the terms in the present invention can be understood in specific circumstances. The experimental procedures described in the following examples are conventional procedures unless otherwise specified. The reagents used in the following examples, etc., can be obtained through commercial channels unless otherwise specified.

[0098] It should be noted that "plant products" can be any product made from plants, plant parts, plant cells, or plant chromosomes or any parts or components thereof. "Wild-type" plants are, for example, non-transgenic and non-genome-edited plants, plant seeds, plant parts and / or plant cells. At the same time, the "plants" described in the present invention can be explants, plant parts, seedlings, plantlets, or complete plants at any stage of regeneration or development. The "transgenic plants" or "gene-edited modified plants" described in the present invention may refer to plants whose genomes have been altered by integrating or inserting recombinant DNA molecules, recombinant vectors or sequences.

[0099] The transgenic plants, plant cells, seeds and plant parts of the present invention can be homozygous or heterozygous for a transgenic event or insertion of a transcribable DNA sequence for suppressing the SDV1 gene into the genome of at least one of its plant cells, or a targeted genome editing event, and the plants, plant cells, seeds and plant parts of the embodiments of the present invention can contain any number of copies of one or more transgenic edits, insertions and / or edits.

[0100] In the present invention, genetic techniques such as gene editing can be performed by screening and selection methods known to technicians in the field of molecular biology. Examples of screening and selection methods include, but are not limited to, Southern analysis, PCR amplification for detecting polynucleotides, Northern blotting, RNase protection, primer extension, RT-PCR amplification for detecting RNA transcripts, Sanger sequencing, next-generation sequencing technology, enzymatic assays for detecting enzymes or ribozyme activity of polypeptides and polynucleotides, and protein gel electrophoresis, Western blotting, immunoprecipitation, and enzyme-linked immunosorbent assays for detecting polypeptides. Other techniques such as in situ hybridization, enzyme staining, and immunostaining can also be used to detect the presence or expression of polypeptides and / or polynucleotides.

[0101] For a long time, due to the difficulty of phenotypic research, genetic research on rice plant height has mostly focused on dwarf mutants with drastic changes in plant height. Although many genes have been cloned, generally speaking, the plant height of such mutants varies too much, seriously affecting yield, and is difficult to use in actual breeding.

[0102] The specific experimental methods designed in this application are as follows:

[0103] 1. Creation of mutant materials

[0104] A large number of mutants were obtained by EMS mutagenesis of indica rice variety 9311 (wild type, WT), and a semi-dwarf mutant material d30 was screened from the mutant library. All rice materials were planted in the experimental base of Sichuan Agricultural University in Wenjiang District, Chengdu City, Sichuan Province and the southern breeding base in Lingshui Li Autonomous County, Hainan Province, and were managed routinely.

[0105] EMS chemical mutagenesis method: The indica rice 9311 seeds were immersed in ethyl methanesulfonate at a concentration of 0.05-0.5M for about half an hour, and then the seeds were germinated, raised as seedlings, and transplanted to the field. After multiple generations of self-pollination, the mutant sdv1 was finally screened.

[0106] 2. Analysis of semi-dwarf phenotype of mutants

[0107] The plant height of the mutant at the seedling stage was slightly shorter than that of the wild type ( Figure 1 A), its plant height at maturity is about 20 cm lower than that of the wild type, showing semi-dwarf ( Figure 1 B). The length of each internode of the mutant was measured at maturity, and the results showed that the internodes of the mutant were significantly shorter than those of the wild type ( Figure 1 C). After filling and maturity, the grain shape and grain weight of the d30 mutant did not change significantly, but the ear was significantly smaller than that of the wild type, and its single ear weight was also significantly lower than that of the wild type ( Figure 1 D), resulting in a decrease in the yield per plant ( Figure 1 E). Figure 1As shown in the bar graph B, the plant height of the wild type at maturity is 110 cm, and the plant height of the mutant at maturity is 80 cm.

[0108] 3. Positional cloning of candidate genes

[0109] The wild type and the d30 mutant were crossed, and the performance of the F1 generation plants was comparable to that of the wild type. The phenotypic identification of the F2 generation population revealed that the ratio of the number of plants with normal plant height to the number of plants with semi-dwarfing was close to 3:1 (143:57; χ 2 =0.6252<3.84). These results indicate that d30 is a recessive semi-dwarf mutant.

[0110] Using MutMap technology, the present application sequenced 50 semi-dwarf phenotype plants in the F2 population and compared them with the wild type. Through linkage analysis of SNP index distribution, it was found that there was a SNP site (A>G) at the 2606th position of gene LOC_Os11g12620 on chromosome 11 (Oryza sativa) that was completely linked to the semi-dwarf phenotype ( Figure 2 A). The full-length sequence of the gene is shown in SEQ ID NO.2 in Table 1. The CDS sequence of the gene is shown in SEQ ID NO.3 in Table 1. The amino acid sequence encoded by the gene is shown in SEQ ID NO.1. The results of bioinformatics analysis showed that the protein encoded by the gene belongs to the leucine-rich repeats receptor-like kinases (LRR-RLKs) subfamily, and the N-terminus of the protein contains multiple LRRs, the C-terminus is a kinase domain, and there is a transmembrane domain (TM) between the LRR and the kinase domain ( Figure 2 C). The sequence of the first exon of the gene is shown as SEQ ID NO. 4 in Table 1. The first exon of the gene contains LRRs, a transmembrane domain and a kinase domain.

[0111] The d30-1 mutation resulted in a potential ATP binding site change on the protein kinase domain, indicating that the d30 mutation resulted in impaired kinase activity of the protein ( Figure 2 C). At the same time, the present application screened out a semi-dwarf mutant (d30-2; Figure 2 B). Gene positioning cloning showed that the d30-2 mutation caused an amino acid substitution in the potential kinase activity center of the protein. The results showed that the d30-2 mutation affected the normal kinase activity of the protein ( Figure 2C). It is inferred that this gene is the causal gene of the d30 mutant. According to the sequence detection results, the mutation site of d30-1 is the 2513th base (AG) of the full length of the gene; the mutation site of d30-2 is the 2856th base (AG) of the full length of the gene. The mutation sites are all located in the kinase domain. Through the confirmation of the above mutation sites and their phenotypes, it can be confirmed that the destruction of the function of the kinase domain can effectively silence the expression of the SDV1 gene or the function of the SDV1 protein.

[0112] 4. Creation of knockout material of SDV1 gene

[0113] In order to further confirm the function of SDV1 in regulating rice plant height, this application used CRISPR / Cas9 gene editing technology to knock out SDV1 in the heavy panicle japonica rice variety Zhonghua 11 (ZH11). The target site was identified by PCR, and the results showed that the phenotype of the transgenic positive lines all showed a semi-dwarf phenotype (the lines were all in a stable state, Figure 3 A), the length of each internode of the main stem is significantly shorter than that of the wild type ( Figure 3 B. Figure 3 C). Interestingly, the present application found that the thickness of the stem wall of the basal internodes of the knockout strains was significantly thicker than that of the wild type ( Figure 3 D). The present application hybridized the knockout plants of different genotypes obtained with the parent ZH11, and analyzed the phenotype and genotype of the F1 and F2 offspring. The results showed that the heterozygous (Ht) plants showed a plant height similar to that of the parent ZH11, while the homozygous knockout offspring plants showed obvious semi-dwarfing. After years of investigation and verification, the dwarfing phenotype was co-segregated with the gene knockout. Figure 3 As shown in E, the wild type has a plant height of 105 cm; the knockout strain with gene inactivation caused by large-effect editing (insertion of base A, deletion of base AG, deletion of base CAAGA) at the target is about 90 cm tall. The above results show that the semi-dwarf phenotype is indeed caused by the inactivation of SDV1 function. The position of the target corresponds to the sequence on the LRRs protein domain. Through the confirmation of the above three knockout sites and their phenotypes, it can be confirmed that destroying the function of the LRRs protein domain can effectively silence the expression of the SDV1 gene or the function of the SDV1 protein.

[0114] 5. Complementary functions of sdv1

[0115] To further clarify the function of SDV1, the full-length SDV1 genome + promoter (3.3 kb before ATG) was transferred into the knockout mutant ko-1 to obtain genetic complementation plants. The results showed that the plant height of the complementation positive plants returned to normal ( Figure 4 A, B), the ear size is almost the same as that of the wild type and mutant ( Figure 4C), and the agronomic traits such as tillering number, primary branches, secondary branches, and fruiting rate were not significantly different from those of the wild type ( Figure 4 D). The above results consistently indicate that SDV1 is indeed an important gene regulating rice plant height.

[0116] 6. Evaluation of yield and lodging resistance of SDV1 knockout mutants

[0117] To further evaluate the effect of SDV1 mutation on yield in different backgrounds, the main yield traits of ZH11 knockout strains were investigated. Consistent with d30, there was no significant change in grain shape and grain weight of the knockout strains compared with the control ( Figure 5 A~ Figure 5 C). Furthermore, the present application found that in the ZH11 genetic background, the functional inactivation of SDV1 did not lead to smaller rice panicles ( Figure 5 D. Figure 5 E), its main yield components such as fruit setting rate, number of grains per ear and number of tillers were comparable to those of the control ( Figure 5 F). Figure 5 As shown in H, the yield per plant of ZH11 was 30 g, while the yield per plant after knockout was 32 g, and its yield per plant was not significantly different from that of ZH11 ( Figure 5 G. Figure 5 H). The above results indicate that different alleles of SDV1 or different genetic backgrounds have different effects on yield, and mutation of this gene is not necessarily accompanied by a decrease in yield.

[0118] During the production practice, the applicant found that ZH11 had lodging when planted in the Chengdu Plain due to its heavy ear weight. Therefore, the lodging resistance of the SDV1 knockout mutant was observed. The results showed that in the natural field environment of Wenjiang, Chengdu, the wild type ZH11 suffered severe lodging in the summer of 2020-2023 (with 2-3 strong winds and rainstorms during the maturity period), while the SDV1 knockout mutant planted with the same specifications during the same period did not show any lodging ( Figure 5 I. Figure 5 J. Figure 5 L), and the thickness of the internode stem wall at the base of the knockout line was significantly higher than that of the wild type ( Figure 5 K. Figure 5 M), indicating that its lodging resistance is significantly enhanced. Considering that its yield is not significantly different from that of ZH11, this application believes that sdv1 has great application value in dwarfing and lodging resistance.

[0119] The sequences are shown in Table 1.

[0120] Table 1

[0121]

[0122]

[0123]

[0124]

[0125]

[0126]

[0127]

[0128] It should be noted that the above-mentioned specific embodiments are exemplary, and those skilled in the art can come up with various solutions inspired by the disclosure of the present invention, and these solutions also belong to the disclosure scope of the present invention and fall within the protection scope of the present invention. Those skilled in the art should understand that the present invention specification and its drawings are illustrative and do not constitute a limitation of the claims. The scope of protection of the present invention is defined by the claims and their equivalents. The present invention specification contains multiple inventive concepts, such as "preferably" and "according to a preferred embodiment", both of which indicate that the corresponding paragraph discloses an independent concept, and the applicant reserves the right to file a divisional application based on each inventive concept. Throughout the text, the features guided by "preferably" are only an optional method and should not be understood as being required. Therefore, the applicant reserves the right to abandon or delete the relevant preferred features at any time.

Claims

1. A protein SDV1 for regulating plant height, characterized in that: The protein SDV1 sequence is the amino acid sequence shown in SEQ ID NO.

1.

2. The protein SDV1 for regulating plant height according to claim 1, characterized in that The nucleotide sequence encoding the protein SDV1 is shown as SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.

4.

3. Use of protein SDV1 or its encoding gene SDV1 in controlling the thickness of the stem wall of the internodes at the base of a plant, characterized in that: The protein SDV1 sequence is the amino acid sequence shown in SEQ ID NO.

1.

4. Use of protein SDV1 or its encoding gene SDV1 in controlling plant stem node length, characterized in that: The protein SDV1 sequence is the amino acid sequence shown in SEQ ID NO.

1.

5. A DNA recombinant vector, cell or strain comprising the gene SDV1 for regulating plant height according to claim 2.

6. A non-viable or non-renewable plant product, characterized in that It comprises the recombinant DNA vector, cell or strain according to claim 5.

7. A non-viable or non-renewable plant product, characterized in that It contains: The recombinant DNA vector, cell or strain according to claim 5; Non-viable or non-renewable parts of the rice plant.

8. A method for improving rice lodging resistance, comprising the following steps: Down-regulate the expression of SDV1 gene in rice, Or down-regulate the expression of the protein encoded by the SDV1 gene in rice, Or reduce the activity of the protein encoded by the SDV1 gene in rice.

9. The method according to claim 8, characterized in that The method for down-regulating the expression level of the SDV1 gene in rice, down-regulating the expression level of the protein encoded by the SDV1 gene in rice, or reducing the activity of the protein encoded by the SDV1 gene in rice comprises: Mutations are produced in the SDV1 gene or promoter region by gene knockout, RNA interference, physical and chemical mutagenesis, and natural mutation, resulting in down-regulation of SDV1 expression, decreased abundance of SDV1 protein, or decreased activity of SDV1 protein.

10. The method according to claim 8, characterized in that The method for down-regulating the expression level of the SDV1 gene in rice, down-regulating the expression level of the protein encoded by the SDV1 gene in rice, or reducing the activity of the protein encoded by the SDV1 gene in rice comprises: The SDV1 gene or an expression construct / vector containing a SDV1 gene fragment is transferred into plants to construct a down-regulated or inactivated mutant of SDV1; Physical and chemical mutagenesis is carried out on plants such as rice, and mutants of the SDV1 gene are screened in a targeted manner.

Images