Navel orange endophyte Diapothe sp., sesterterpenoids derived from navel orange endophyte and application of sesterterpenoids

Abstract

The invention belongs to the technical field of microorganisms and medical compounds, and particularly relates to navel orange endophyte Diapothe sp., sesterterpenoids derived from the navel orange endophyte and application of the sesterterpenoids. The navel orange endophyte Diamorpha sp.GC-1-128-79 provided by the invention is preserved in the China Center for Type Culture Collection, and the preservation number of the navel orange endophyte Diamorpha sp.GC-1-128-79 is CCTCC NO: M 20242152. The navel orange endophyte Diapothene sp.GC-1-128-79 provided by the invention can generate a new sesterterpenoid compound through fermentation, and the sesterterpenoid compound can effectively inhibit synthesis of glycosylated phosphatidylinositol, has extremely remarkable antibacterial activity on penicillium italicum, and can be used for preventing and treating citrus penicilliosis.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms and pharmaceutical compounds, and particularly relates to a navel orange endophyte Diaporthesp. and a diterpenoid compound derived from the navel orange endophyte and applications thereof. Background Art

[0002] Citrus is a common fruit in our daily life, mainly eaten fresh. However, it is easy to be infected by fungi during transportation, storage and sales, causing huge economic losses. Among them, citrus penicillium caused by Penicillium italicum is one of the common post-harvest diseases of citrus. The pathogenic fungus is a necrotrophic fungus that can produce hundreds of millions of conidia and spread through air and mechanical contact. Even under extreme conditions such as dryness and low temperature, the conidia can still survive. It has rapid transmission and strong infectivity, making it extremely difficult to prevent and control.

[0003] At present, the control of citrus penicillium is mainly prevented by chemical synthetic fungicides (imazalil, prochloraz, methyl thiophanate, etc.). However, with the long-term use of chemical synthetic fungicides, the problems of pathogenic bacteria resistance, environmental pollution, food safety, etc. are becoming increasingly serious, so new, safe and green drugs are urgently needed to replace chemical synthetic fungicides. Recently, natural antifungal substances such as plant extracts and plant essential oils are gradually being discovered and studied, and have good preventive and therapeutic effects on citrus penicillium in application, such as citrus essential oils, trans-2-octenal, etc. The secondary metabolites of microorganisms are extremely rich and have novel targets. They have always been an important and valuable resource for the development of innovative drugs, providing a solid guarantee for agricultural safety and medical health. Finding new drug-derived molecules from microorganisms has become a research hotspot for inhibiting Italian Penicillium and preventing and controlling citrus penicillium. Summary of the invention

[0004] The purpose of the present invention is to provide a navel orange endophyte Diaporthe sp. and a diterpenoid compound derived from the navel orange endophyte and application thereof, to enrich antibacterial substances significantly resistant to italian penicillium and prevent and treat citrus penicillium disease.

[0005] In order to achieve the above object, the present invention provides a navel orange endophyte Diaporthe sp.GC-1-128-79, which is preserved in China Center for Type Culture Collection with a preservation number of CCTCCNO: M20242152.

[0006] The present invention also provides a fermentation product of the navel orange endophyte Diaporthe sp.GC-1-128-79 described in the above technical solution, wherein the fermentation product contains a diterpenoid compound with a structural formula as shown in Formula I;

[0007]

[0008] The present invention also provides a diterpenoid compound, the structural formula of the diterpenoid compound is as shown in Formula I:

[0009]

[0010] The present invention also provides a method for preparing the diterpenoid compound described in the above technical solution, comprising the following steps:

[0011] The fermentation product of the endophytic bacteria Diaporthesp.GC-1-128-79 of navel orange described in the above technical scheme is extracted using an ethanol solution with a volume concentration of 90-95% to obtain a crude fermentation extract;

[0012] The fermentation crude extract is extracted with ethyl acetate, and the extract is concentrated to obtain an extract;

[0013] The extract is subjected to a first silica gel column chromatography, using a first mixed solution 1-8 including petroleum ether and ethyl acetate, and a second mixed solution 1-4 including dichloromethane and methanol as eluents, respectively, for gradient elution, and collecting the eluents; the eluents are subjected to TLC thin layer chromatography, using a petroleum ether and ethyl acetate volume ratio of 2:1 as a developing solvent, and the eluents with Rf=0.3-0.5 are combined and named as component Fr 12; the volume ratios of petroleum ether and ethyl acetate in the first mixed solutions 1-8 are 10:0, 9:1, 4:1, 7:3, 3:2, 1:1, 2:3 and 3:7, respectively; the volume ratios of dichloromethane and methanol in the second mixed solutions 1-4 are 19:1, 9:1, 4:1 and 7:3, respectively;

[0014] The component Fr 12 is subjected to a second silica gel column chromatography, and the third mixed solution 1-6 including petroleum ether and ethyl acetate is used as an eluent, and gradient elution is performed, and the eluents are collected; the eluents are subjected to TLC thin layer chromatography, and the eluents are developed with a volume ratio of petroleum ether to ethyl acetate of 7:3 as a developing solvent, and the eluents with Rf=0.2-0.4 are combined and named as component Fr 12.4; the volume ratios of petroleum ether and ethyl acetate in the third mixed solution 1-6 are 17:3, 4:1, 3:1, 7:3, 3:2 and 1:1 respectively;

[0015] The component Fr 12.4 is subjected to a third silica gel column chromatography, and a fourth mixed solution 1 to 3 including petroleum ether and ethyl acetate is used as an eluent, respectively, for gradient elution, and the eluent is collected; the eluent is subjected to TLC thin layer chromatography, and developed with petroleum ether and ethyl acetate in a volume ratio of 5:1 as a developing solvent, and the eluent with Rf=0.25 is combined to obtain the diperpene compound described in the above technical scheme; the volume ratios of petroleum ether and ethyl acetate in the fourth mixed solution 1 to 3 are 9:1, 17:3 and 4:1, respectively.

[0016] Preferably, the method for preparing the fermentation product of the navel orange endophyte Diaporthe sp.GC-1-128-79 comprises the following steps: fermenting the seed liquid of the navel orange endophyte Diaporthe sp.GC-1-128-79 using rice culture medium to obtain the fermentation product of the navel orange endophyte Diaporthe sp.GC-1-128-79;

[0017] The rice culture medium is prepared by mixing 90-110 g of rice with 100 mL of water for sterilization;

[0018] The fermentation culture temperature is 27-30°C and the fermentation culture time is 40-50 days.

[0019] Preferably, the volume ratio of the seed solution to the rice culture medium is (5-10):100.

[0020] The present invention also provides the use of the navel orange endophyte Diaporthe sp. GC-1-128-79 or fermentation product or diterpenoid compound described in the above technical solution in preventing and controlling citrus penicillium disease.

[0021] The present invention also provides the use of the navel orange endophyte Diaporthe sp.GC-1-128-79 or fermentation product or diterpenoid compound described in the above technical solution in resisting Penicillium italicum.

[0022] The present invention also provides a bacterial agent for resisting Penicillium italicum, wherein the active ingredients of the bacterial agent include one or more of the navel orange endophyte Diaporthe sp.GC-1-128-79 described in the above technical solution, the fermentation product described in the above technical solution, and the diterpenoid compound described in the above technical solution.

[0023] The present invention also provides a method for preventing and treating citrus penicillium disease, which comprises treating citrus with the bacterial agent described in the above technical solution.

[0024] Beneficial effects:

[0025] The present invention provides a navel orange endophyte Diaporthe sp.GC-1-128-79, which is deposited in the China Center for Type Culture Collection with a deposit number of CCTCC NO:M 20242152. The navel orange endophyte Diaporthe sp.GC-1-128-79 provided by the present invention can produce a new diterpenoid compound named Sesterdiaporate through fermentation, and its structural formula is shown in Formula I. The compound Sesterdiaporate can effectively inhibit the synthesis of glycosylated phosphatidylinositol (GPI), has extremely significant antibacterial activity against Penicillium italicum, and can be used to prevent and treat citrus penicillium disease. The results of the embodiment show that the half inhibitory concentration (EC 50) of the compound Sesterdiaporate on the spore germination of Penicillium italicum 50 ) was 0.37 μg / mL, and the EC 50 The value is 0.052μg / mL.

[0026] Biological deposit information

[0027] The navel orange endophyte GC-1-128-79, biologically classified as Diaporthe sp., was deposited in the China Center for Type Culture Collection on October 9, 2024; address: Wuhan University, Wuhan, China, and the deposit number is CCTCC NO:M 20242152. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0029] Figure 1 This is the HR-ESI-MS spectrum of the sesquiterpenoid compound Sesterdiaporate;

[0030] Figure 2 This is the infrared spectrum of the sesquiterpenoid compound Sesterdiaporate;

[0031] Figure 3 Sesterdiaporate 1 H NMR spectrum;

[0032] Figure 4 Sesterdiaporate 13 C NMR spectrum;

[0033] Figure 5This is the HSQC spectrum of the sesquiterpenoid compound Sesterdiaporate;

[0034] Figure 6 Sesterdiaporate 1 H- 1 H COSY spectrum;

[0035] Figure 7 This is the HMBC spectrum of the sesquiterpenoid compound Sesterdiaporate;

[0036] Figure 8 is the correlation between the sesterdiaporate and the detection; 1 H- 1 A is the HCOSY correlation, B is the HMBC correlation, C is the NOESY detection correlation, and D is the conformational analysis of 28-OH and 29-CH3;

[0037] Fig. 9 The circular dichroism (CD) spectra of the sesquiterpenoids Sesterdiaporate and 1R4R5R7R9R10S11S13R15R19R28R29S31R were calculated;

[0038] Fig.10 It is the chemical structure of the sesquiterpenoid compound Sesterdiaporate;

[0039] Fig.11 This is the UV spectrum of the sesquiterpenoid compound Sesterdiaporate;

[0040] Fig.12 The inhibitory effects of different concentrations of the sesquiterpenoid compound Sesterdiaporate on the spore germination and hyphae growth of Penicillium italicum; A is the inhibition rate of spore germination, B is the inhibition rate of hyphae growth, C is the actual picture of spore germination, and D is the actual picture of hyphae growth;

[0041] Fig.13 The results of fluorescence microscopy analysis of PI and FDA staining of Italian Penicillium mycelium after treatment with different concentrations of the sesquiterpenoid compound Sesterdiaporate for 1 hour;

[0042] Fig.14 The results of fluorescence microscopy analysis of PI and FDA staining of Italian Penicillium mycelium after treatment with different concentrations of the sesquiterpenoid compound Sesterdiaporate for 2 hours;

[0043] Fig.15The results of fluorescence microscopy analysis of PI and FDA staining of Italian Penicillium mycelium after treatment with different concentrations of the sesquiterpenoid compound Sesterdiaporate for 4 hours;

[0044] Fig.16 The results of fluorescence microscopy analysis of PI and FDA staining of Italian Penicillium mycelium after treatment with different concentrations of the sesquiterpenoid compound Sesterdiaporate for 8 hours;

[0045] Fig.17 The results of fluorescence microscopy analysis of PI and FDA staining of Italian Penicillium mycelium after treatment with different concentrations of the sesquiterpenoid compound Sesterdiaporate for 1 hour;

[0046] Figures 13 to 17 In the middle, FDA is marked in green, PI is marked in red, and the scale bar is 50 μm;

[0047] Fig.18 The results of scanning electron microscopy (SEM) and transmission electron microscopy (TME) of Italian Penicillium hyphae treated with different concentrations of the sesquiterpenoid compound Sesterdiaporate for 12 hours; A to D are SEM results, with a scale bar of 20 μm, and E to H are TME results, with scale bars of E and F of 2 μm, and scale bars of G and H of 1 μm;

[0048] Fig.19 The results of differentially expressed genes (DEGs) analysis after the hyphae of Italian Penicillium were treated with 0.1 μg / mL sesquiterpenoid compound Sesterdiaporate for 12 h; A is GO functional classification, B is the top 20 GO enrichment analysis, C is KEGG pathway functional classification, and D is the top 20 KEG G enrichment analysis;

[0049] Fig. 20 This is the glycerophospholipid metabolic pathway diagram after the hyphae of Italian Penicillium were treated with 0.1 μg / mL sesquiterpenoid compound Sesterdiaporate for 12 hours;

[0050] Fig.21 The expression levels of some genes in the glycerophospholipid metabolic pathway after the mycelium of Penicillium spp. was treated with different concentrations of sesterdiaporate for 12 h; the values ​​are mean ± standard deviation (n = 3), *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001;

[0051] Fig. 22The results of molecular docking of the sesquiterpenoid compound Sesterdiaporate with ethanolamine kinase and CDP-diacylglycerol-inositol 3-phosphatidyltransferase; A to E are ethanolamine kinase; D to F are CDP-diacylglycerol-inositol 3-phosphatidyltransferase;

[0052] Fig.23 The intracellular protein content of Penicillium spp. hyphae treated with different concentrations of sesterdiaporate for 12 h; the values ​​are mean ± standard deviation (n = 3), *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001;

[0053] Fig.24 Effects of exogenous addition of phosphoethanolamine and phosphatidylinositol on the inhibition of Penicillium italicum hyphae by the sesquiterpenoid compound Sesterdiaporate; values ​​are mean ± standard deviation (n = 3), *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001;

[0054] Fig.25 The inhibitory effect of different concentrations of the diterpenoid compound Sesterdiaporate on Penicillium italicum in navel orange fruit;

[0055] Fig.26 This is the phylogenetic tree of the fungus GC-1-128-79. DETAILED DESCRIPTION

[0056] The invention provides a navel orange endophyte Diaporthe sp.GC-1-128-79, which is preserved in China Center for Type Culture Collection with a preservation number of CCTCC NO:M 20242152.

[0057] The present invention isolates and screens a fungus from navel orange plants in southern Jiangxi, and the fungus is identified as an endophyte of navel orange Diaporthe sp. The secondary metabolites produced by fermentation of the endophyte of navel orange Diaporthe sp. GC-1-128-79 isolated by the present invention contain a diterpenoid compound with a structural formula as shown in Formula I, and a search of the Scifinder database shows that the compound is a new compound.

[0058]

[0059] In view of this, the present invention also provides a fermentation product of the navel orange endophyte Diaporthe sp.GC-1-128-79 described in the above technical solution, wherein the fermentation product contains a di-sesquiterpenoid compound having a structural formula as shown in Formula I. The present invention also provides a di-sesquiterpenoid compound having a structural formula as shown in Formula I.

[0060] The present invention also provides a method for preparing the diterpenoid compound described in the above technical solution, which is separated and obtained from the fermentation product of the navel orange endophyte Diaporthe sp.GC-1-128-79 described in the above technical solution.

[0061] As an embodiment, the present invention uses potato sucrose agar (PDA) medium to activate the navel orange endophyte Diaporthe sp.GC-1-128-79 described in the above technical scheme to obtain the activated navel orange endophyte Diaporthe sp.GC-1-128-79. As an embodiment, the activation time is 3 to 5 days, and the temperature is 28 to 30°C; as another embodiment, the activation time is 5 days, and the temperature is 30°C. As an embodiment, the composition of the potato sucrose agar (PDA) medium is potato, glucose, and agar. The present invention has no strict requirements on the specific steps of the activation, and the conventional methods in the art are adopted to ensure the growth of the navel orange endophyte Diaporthe sp.GC-1-128-79 and the production of hyphae.

[0062] As an embodiment, after obtaining the activated navel orange endophyte Diaporthe sp.GC-1-128-79, the present invention inoculates the hyphae of the activated navel orange endophyte Diaporthe sp.GC-1-128-79 into a potato glucose liquid culture medium, and cultures it at 25-30°C and 120-160rpm for 42-55h to obtain a seed solution. As an embodiment, the culture temperature is 25°C. As an embodiment, the culture speed is 140rpm. As an embodiment, the culture time is 48h.

[0063] As an embodiment, after obtaining the seed liquid, the present invention inoculates the seed liquid into a rice culture medium, and ferments it at 27-30°C for 40-50 days to obtain a fermentation product of the navel orange endophyte Diaporthe sp.GC-1-128-79. As an embodiment, the rice culture medium is prepared by mixing and sterilizing 90-110g of rice with 100-110mL of water; as an embodiment, the rice culture medium is prepared by mixing and sterilizing 100mL of water with 100g of rice. As an embodiment, the water is deionized water. As an embodiment, the fermentation temperature is 28°C. As an embodiment, the fermentation time is 45 days. As an embodiment, the volume ratio of the seed liquid to the rice culture medium is (5-10):100; as another embodiment, the volume ratio of the seed liquid to the rice culture medium is 5:100.

[0064] After obtaining the fermentation product of the navel orange endophyte Diaporthe sp.GC-1-128-79, the present invention separates the fermentation product of the navel orange endophyte Diaporthe sp.GC-1-128-79 to obtain the diterpenoid compound described in the above technical solution.

[0065] As an embodiment, the present invention uses an ethanol solution with a volume concentration of 90-95% to extract the fermentation product of the navel orange endophyte Diaporthe sp.GC-1-128-79 to obtain a fermentation crude extract; as another embodiment, the present invention uses an ethanol solution with a volume concentration of 95% to extract the fermentation product of the navel orange endophyte Diaporthe sp.GC-1-128-79 to obtain a fermentation crude extract. As an embodiment, the number of extractions is 2-4; as another embodiment, the number of extractions is 3. As an embodiment, the temperature of the extraction is 30-35°C; as another embodiment, the temperature of the extraction is 30°C. As an embodiment, the time for each extraction is 30-40 minutes; as another embodiment, the time for each extraction is 30 minutes. As an embodiment, the volume ratio of each extraction is 2-3:1-2; as another embodiment, the volume ratio of each extraction is 2:1. As an embodiment, the extraction is ultrasonic extraction, and the ultrasonic power is 24kHz.

[0066] As an embodiment, after obtaining the crude fermentation extract, the present invention uses ethyl acetate to extract the crude fermentation extract, and the extract is concentrated to obtain an extract. As an embodiment, the number of extractions is 3 to 5; as another embodiment, the number of extractions is 3. As an embodiment, the temperature of the extraction is 27 to 30°C; as another embodiment, the temperature of the extraction is 28°C. As an embodiment, the time for each extraction is 30 to 60 minutes; as another embodiment, the time for each extraction is 30 minutes. As an embodiment, the volume ratio of each extraction is 1 to 2: 1 to 2; as another embodiment, the volume ratio of each extraction is 1: 1. As an embodiment, the concentration method is to use a rotary evaporator to spin dry the liquid of the extract.

[0067] As an embodiment, after obtaining the extract, the present invention subjects the extract to a first silica gel column chromatography, uses a first mixed solution 1-8 including petroleum ether and ethyl acetate, and a second mixed solution 1-4 including dichloromethane and methanol as eluents, respectively, for gradient elution, and collects the eluent; the eluents are subjected to TLC thin layer chromatography, and developed with a volume ratio of petroleum ether to ethyl acetate of 2:1 as a developing solvent, and the eluents with Rf=0.3-0.5 are combined and named as component Fr 12; the volume ratio of petroleum ether to ethyl acetate in the first mixed solution 1-8 is 10:0, 9:1, 4:1, 7:3, 3:2, 1:1, 2:3 and 3:7, respectively; the volume ratio of dichloromethane to methanol in the second mixed solution 1-4 is 19:1, 9:1, 4:1 and 7:3, respectively. As an embodiment, the present invention sequentially comprises a first mixed solution 1-8 of petroleum ether and ethyl acetate, and a second mixed solution 1-4 including dichloromethane and methanol as eluents, respectively, for gradient elution. As an embodiment, the eluent dosage of each eluent of the present invention is 2 to 4L; as another embodiment, the eluent dosage of each eluent of the present invention is 3L. As an embodiment, the flow rate of the gradient elution is 4.5 to 5.5mL / min; as another embodiment, the flow rate of the gradient elution is 5mL / min. As an embodiment, the flow rate of the gradient elution is 4.5 to 5.5mL / min; as an embodiment, the temperature of the gradient elution is 22 to 28°C; as another embodiment, the temperature of the gradient elution is 25°C. As an embodiment, the particle size of the silica gel used in the first silica gel column chromatography is 300 to 400 meshes and the mass is 1.0kg. As an embodiment, the length of the column used in the first silica gel column chromatography is 60cm and the diameter is 8cm. As an embodiment, the mass ratio of the extract to the silica gel is 100g:10kg.

[0068] As an embodiment, after obtaining the component Fr 12, the present invention subjects the component Fr 12 to a second silica gel column chromatography, uses the third mixed solution 1 to 6 including petroleum ether and ethyl acetate as eluents, performs gradient elution, and collects the eluents; the eluents are subjected to TLC thin layer chromatography, and the eluents are developed with a volume ratio of petroleum ether to ethyl acetate of 7:3 as a developing solvent, and the eluents with Rf=0.2 to 0.4 are combined and named as component Fr 12.4; the volume ratios of petroleum ether to ethyl acetate in the third mixed solution 1 to 6 are 17:3, 4:1, 3:1, 7:3, 3:2 and 1:1, respectively. As an embodiment, the present invention sequentially uses the third mixed solution 1 to 6 including petroleum ether and ethyl acetate as eluents, respectively, and performs gradient elution. As an embodiment, the eluent dosage of each eluent of the present invention is 2 to 4 L; as another embodiment, the eluent dosage of each eluent of the present invention is 3 L. As an embodiment, the flow rate of the gradient elution is 4.5-5.5 mL / min; as another embodiment, the flow rate of the gradient elution is 5 mL / min. As an embodiment, the flow rate of the gradient elution is 5.0 mL / min; as an embodiment, the temperature of the gradient elution is 22-28°C; as another embodiment, the temperature of the gradient elution is 25°C. As an embodiment, the particle size of the silica gel used in the second silica gel column chromatography is 300-400 mesh and the mass is 80 g. As an embodiment, the length of the column used in the second silica gel column chromatography is 20 cm and the diameter is 3.2 cm. As an embodiment, the mass ratio of the component Fr 12 to the silica gel is 1.2 g: 80 g.

[0069] As an embodiment, after obtaining the component Fr 12.4, the present invention subjects the component Fr 12.4 to a third silica gel column chromatography, uses the fourth mixed solution 1 to 3 including petroleum ether and ethyl acetate as eluents, gradient elution, and collects the eluents; the eluents are subjected to TLC thin layer chromatography, using petroleum ether and ethyl acetate in a volume ratio of 5:1 as a developing solvent, and the eluents with Rf=0.25 are combined to obtain the diterpenoid compound described in the above technical scheme; the volume ratios of petroleum ether and ethyl acetate in the fourth mixed solution 1 to 3 are 9:1, 17:3 and 4:1, respectively. As an embodiment, the present invention sequentially uses the fourth mixed solution 1 to 3 including petroleum ether and ethyl acetate as eluents, gradient elution. As an embodiment, the eluent dosage of each eluent of the present invention is 2 to 4L; as another embodiment, the eluent dosage of each eluent of the present invention is 3L. As an embodiment, the flow rate of the gradient elution is 4.5-5.5 mL / min; as another embodiment, the flow rate of the gradient elution is 5 mL / min. As an embodiment, the temperature of the gradient elution is 22-28°C; as another embodiment, the temperature of the gradient elution is 25°C. As an embodiment, the particle size of the silica gel used in the third silica gel column chromatography is 300-400 mesh and the mass is 30g. As an embodiment, the length of the column used in the third silica gel column chromatography is 20 cm and the diameter is 2.6 cm. As an embodiment, the mass ratio of the component Fr 12 to the silica gel is 204 mg: 30 g.

[0070] The present invention analyzes the structure of the isolated compound, and clarifies its planar structure and the relative stereochemical properties of each ring. The Scifinder database search shows that the compound is a new compound, which belongs to a sesquiterpenoid compound, and is named Sesterdiaporate. The sesquiterpenoid compound Sesterdiaporate can effectively inhibit the synthesis of glycosylated phosphatidylinositol, has extremely significant antibacterial activity against Penicillium italicum, and can be used to prevent and treat citrus penicillium disease.

[0071] In view of the advantages of the navel orange endophyte Diaporthe sp.GC-1-128-79 provided by the present invention, the use of the navel orange endophyte Diaporthe sp.GC-1-128-79 or the diterpenoid compound in the above technical solution in preventing and controlling citrus penicillium disease, and in resisting Italian Penicillium, also fall within the protection scope of the present invention. As an embodiment, the resistance to Italian Penicillium includes inhibiting the germination of Italian Penicillium spores and / or hyphae growth. The results of the examples of the present invention show that the half inhibition concentration (EC 50) of the diterpenoid compound on the germination of Italian Penicillium spores is 50) was 0.37 μg / mL, and the EC 50 The value is 0.052μg / mL.

[0072] The present invention also provides a bacterial agent for resisting Penicillium italicum, wherein the active ingredients of the bacterial agent include the navel orange endophytic bacteria Diaporthe sp.GC-1-128-79 described in the above technical scheme, the fermentation product of the navel orange endophytic bacteria Diaporthe sp.GC-1-128-79 described in the above technical scheme, and one or more of the diterpenoid compounds described in the above technical scheme.

[0073] As an embodiment, the concentration of the bacterial agent is 1×EC 50 ~10×EC 50 As another embodiment, the concentration of the bacterial agent is 5×EC 50 As an embodiment, the concentration of the bacterial agent is measured by the concentration of the sesterdiaporate compound in the bacterial agent.

[0074] The present invention also provides a method for preventing and controlling citrus penicillium disease, wherein the citrus is treated with the bacterial agent described in the above technical solution. As an embodiment, the application amount of the bacterial agent is 35-45 μL / citrus; as an embodiment, the application amount of the bacterial agent is 40 μL / citrus.

[0075] To further illustrate the present invention, a navel orange endophyte Diaporthe sp. and diterpenoid compounds derived from navel orange endophytes and applications provided by the present invention are described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0076] The Penicillium italicum (No. GNU241512) used in the examples of the present invention comes from the Processing and Storage Laboratory of the National Navel Orange Engineering Technology Research Center.

[0077] Example 1

[0078] Obtaining Endophyte of Navel Orange (Diaporthe sp.) GC-1-128-79

[0079] The inventor team isolated and screened a fungus from the navel orange plant in southern Jiangxi, named GC-1-128-79. After culturing on PDA medium at 25°C for 3 days, the colony diameter was 43-45 mm, the center of the colony was round and velvety, and the grayish-white hyphae grew all around. After 6 days of cultivation, the colony diameter reached 87 mm. The hyphae were white-gray, velvety in texture, the surface of the colony was uneven, and the hyphae were curled; the center of the colony was grayish white at first, and then grew to brown, the hyphae were branched, the wall was smooth, and the hyphae were entangled to form a hyphae ring. After the strain was activated and cultured, the activated fungal hyphae were scraped and DNA was extracted according to the steps of the kit for molecular identification. PCR amplification was carried out with a 20μL system, including 1μL template DNA, 0.5μL upstream primer (ITS1), 0.5μL downstream primer (ITS4), 10μL mixed enzyme (taq max) and 8μL ddH2O, which were placed in a PCR instrument for amplification. The PCR cycle program was set as follows: preheating at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, and final extension at 72°C for 5 min for 35 cycles. The PCR products were subjected to 1% agarose gel electrophoresis. After the samples were tested, the PCR products were sent to Shanghai Biotechnology Co., Ltd. for DNA sequencing. MEGA7.0 was used for sequence analysis and alignment, and a phylogenetic tree was constructed.

[0080] The nucleotide sequence of the rDNA ITS gene of the fungus GC-1-128-79 was obtained: 5'-CAGCGGGTATTCCTACCTGATCCGAGGTCAAATTTTCAAGAGTTGGGGGTTTAACGGCAGGGCACCGCCA GGGCCTTCCAAAGCGAGGGTTTAACTACTACGCTCGGGGTCCTGGCGAGCTCGCCACTAGATTTGAGGGCCTGCCCTTTTACAGGCAGTGCCCCAACACCAAGCCAGGCTTGAGGGTTGAAATGACGCTCGAACAGGCATGCCCTCCGGAATACCAGAGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCT TCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTGATTCATTTGTTTTTTTTTTCTCAGAGTTTCAGTGTAAAAACAAGAGTTAACTTGGCCGCCGGCGCGCCTGCTCCTCTTGAGACAAGAGGGACCCCTGGGGGCCAGCGTACGCCGAGGCAACAGTAAGGTATAAGTTCACAAAGGGTTTCTGGGTGCGCCTGGGGCGCGTTCCAGCAATGATCCCTCCGC-3'(SEQ ID NO: 1); The sequence was subjected to similarity search and comparative analysis through the BLAST database to construct a phylogenetic tree. After comparison, the sequence was found to have a similarity of 99.5% with the Diaporthe sp. (OP070481) fungal sequence ( Fig.26 ); therefore, the fungus was determined to be the navel orange endophyte Diaporthe sp. The navel orange endophyte Diaporthe sp. GC-1-128-79 was deposited in the China Center for Type Culture Collection on October 9, 2024, with the deposit number CCTCC NO: M 20242152.

[0081] Example 2

[0082] Isolation and Identification of Diterpenoids

[0083] 1. Fermentation culture of Diaporthe sp. GC-1-128-79

[0084] (1) The navel orange endophyte GC-1-128-79 obtained in Example 1 was activated in potato sucrose medium (PDA) for 5 days, and an appropriate amount of mycelium was taken into PDB medium and incubated at 140 rpm and 25° C. for 48 hours to prepare a seed solution.

[0085] (2) 10 mL of seed solution was inoculated into a fermentation bottle containing 100 mL of rice culture medium (composed of 100 g of rice and 100 mL of deionized water) and fermented at 28°C for 45 days. A total of 85 bottles were fermented.

[0086] (3) After the fermentation in step (2) is completed, the fermentation product is extracted using 95% v / v ethanol at 24 kHz to obtain a crude fermentation extract, and then the crude fermentation extract is extracted with ethyl acetate, the liquid solution is collected, and the liquid is dried by a rotary evaporator to leave a paste-like solid to obtain an ethyl acetate extract.

[0087] 2. Isolation of diterpenoids

[0088] The compounds in the ethyl acetate extract obtained in step 1 are separated by silica gel chromatography (CC), and the specific steps are as follows:

[0089] 2.1. The ethyl acetate extract (100 g) was chromatographed on silica gel (300-400 mesh, 1.0 kg), with a column length of 60 cm and a diameter of 8 cm. The first elution was performed with a gradient of petroleum ether (PE)-ethyl acetate (EtOAc) of 100:0, 9:1, 4:1, 7:3, 3:2, 1:1, 2:3 and 3:7 (v / v); and the second elution was performed with a gradient of dichloromethane (DCM): methanol (MeOH) of 19:1, 9:1, 4:1 and 7:3 (v / v). During the elution process, each gradient eluent was eluted with 3 L, the elution flow rate was 5 mL / min, and the temperature was 25°C. The eluate after each gradient elution was collected in a test tube, 100 ml was collected in each test tube, and a total of 250 test tube samples were collected to obtain a first eluate; the first eluate was subjected to TLC thin layer chromatography, and the test tube samples with Rf=0.3-0.5 were collected and combined and developed with petroleum ether and ethyl acetate (2:1, volume ratio) as developing solvents to obtain 16 fractions, which were labeled Fr1-Fr16 in sequence.

[0090] 2.2. Fr 12 (1.2 g) was subjected to silica gel (300-400 mesh, 80 g) chromatography. The column was 20 cm long and 3.2 cm in diameter. It was eluted with petroleum ether (PE)-ethyl acetate (EtOAc) gradients of 17:3, 4:1, 3:1, 7:3, 3:2 and 1:1 (v / v). During the elution process, 0.5 L of each gradient eluent was eluted, the elution flow rate was 5 mL / min, and the temperature was 25°C. The eluted eluent was collected in a test tube, 50 ml of each test tube was collected, and a total of 120 test tube samples were collected to obtain a second eluent; the second eluent was subjected to TLC thin layer chromatography, and the test tube samples with Rf = 0.2-0.4 were collected and combined using petroleum ether and ethyl acetate (7:3, volume ratio) as the developing solvent to obtain 6 fractions, which were labeled as Fr12.1-Fr12.6.

[0091] 2.3. Fr12.4 (204 mg) was chromatographed on silica gel (300-400 mesh, 30 g), with a column length of 20 cm and a diameter of 2.6 cm. The mixture was eluted with a gradient of 9:1, 17:3 and 4:1 (v / v) of petroleum ether (PE)-ethyl acetate (EtOAc), with each gradient eluent eluting 0.2 L, an elution flow rate of 5 mL / min, and a temperature of 25°C. The eluent obtained by elution was collected in a test tube, with 20 ml collected in each test tube, and a total of 75 test tube samples were collected to obtain a third eluent; the three eluents were subjected to TLC thin layer chromatography, and the component test tube samples with Rf=0.25 were collected and combined with petroleum ether and ethyl acetate (5:1, volume ratio) as the developing solvent to obtain compound 1, a total of 45 mg.

[0092] 2.4. Structural analysis of compound 1

[0093] (1) Compound 1 is an amorphous powder with a specific rotation of [α] 25 D = -46.15 (c = 0.26, CH3OH). According to HR-ESI-MS results ( Figure 1 ), the chemical formula of compound 1 was determined to be C 34 H 54 O7, HR-ESI-MS showed a quasi-molecular ion peak of m / z 597.3800 ([M+Na]+, theoretical value 597.3762), indicating that the degree of unsaturation of compound 1 is 8. Infrared spectrum ( Figure 2 ) shows the presence of hydroxyl functional groups in the molecule (3468cm -1 ) and carbonyl functional groups (1729cm -1 )

[0094] (2) 5 mg of compound 1 was dissolved in 0.5 mL of deuterated methanol and the molecular weight of compound 1 was measured by Bruker 400M NMR spectrometer.1 H NMR, 13 CNMR, HSQC, 1 H- 1 H COSY and HMBC were used for analysis and identification. The results are as follows Figures 3 to 7 , Figure 8 Middle A, Figure 8 B and Table 1.

[0095] Table 1 Compound 1 1 H NMR and 13 C NMR data

[0096]

[0097]

[0098] according to Figures 3 to 5 As can be seen from Table 1, 1 H NMR spectroscopy showed the presence of eight methyl groups in compound 1, including H The two single signals at 0.97(s) and 1.63(s) are H The five double signals at 1.45 (d, J = 6.0), 0.92 (d, J = 6.0), 0.87 (d, J = 6.0), 0.86 (d, J = 7.0), 0.98 (d, J = 7.0), and δ H A triplet signal at 0.85 (t, J=7.5). 13 Comprehensive studies of C NMR and HSQC spectra showed that compound 1 was composed of 34 carbon atoms, including 8 methyl carbon signals, 7 methylene carbon signals, 13 methine carbon signals, and 6 quaternary carbon signals. H 5.04 (t, J = 9.0), 4.70 (s) and 5.13 (s) 1 H NMR signals, as well as δ C 150.6, 143.2, 117.0 and 111.2 13 The C NMR signal also proves that compound 1 contains two olefin bonds. In addition, according to the molecular formula and 13 C NMR spectroscopy confirmed the presence of two carbonyl carbons (δ C 173.2, 174.6) and five oxygenated carbons (δ C 77.7, 74.7, 76.6, 81.1, 75.0). In addition, the HSQC spectrum shows that among the five oxygen-containing carbons, one is a quaternary carbon (δ C 76.6), and the remaining four are methine carbons (δC 77.7, 74.7, 81.1, 75.0), which are respectivelyH 4.37, 4.22, 5.34, and 4.04 are related.

[0099] according to Figures 6-7 , Figure 8 Middle A and Figure 8 As can be seen in B, 1 H- 1 The H COSY spectrum showed the presence of two continuous fragments in compound 1. In addition, the HMBC spectrum showed the correlation of H-1 / C-3, H-19 / C-4, H-4 / C-5 and H-4 / C-3, indicating the presence of a ring in compound 1. The correlation of H-19 / C-5, H-19 / C-6, H-15 / C-6, H-21 / C-5, H-26 / C-17 and H-18 / C-16 in HMBC supported the existence of ring B and its connection with ring A. 1 H- 1 The six-membered ring C and the five-membered ring D and their connection through C-9 and C-13 were determined by H COSY correlation and HMBC correlation of H-15 / C-8, H-9 / C-14, H-10 / C-13, H-9 / C-11, H-25 / C-14, H-25 / C-13, and H-23 / C-10. 1 H- 1 H COSY correlation confirmed the presence of side chains from C-27 to C-35. In addition, the cross peaks of H-29 / C-27, H-35 / C-29, H-34 / C-30 and H-33 / C-31 in the HMBC spectrum further confirmed this conclusion. Moreover, the key HMBC correlation of H-11 / C-27 clarified the connection relationship between ring D and the side chain through the ester group.

[0100] (3) Based on the detection of step (1) and step (2), the planar structure of compound 1 was completely elucidated. The Scifinder database search showed that the compound was a new compound.

[0101] (4) The relative stereochemistry of the rings of compound 1 was determined by NOESY spectra. NOE correlations of H-20 / H-4, H-20 / H-19, and OH-5 / H-4 indicated that these protons were located on the same side of ring A ( Figure 8 The relative configurations of ring C and ring D were determined based on the correlations of H-7 / H-9, H-15 / H-25, H-11 / H-25 and H-11 / H-2 in the NOESY spectrum. Regarding the side chains, the coupling constants (J = 3.0 Hz) of H-28 and H-29 were used to determine the relative configurations of ring C and ring D. Figure 8D), indicating that the relative conformation of hydroxyl group (OH-28) and Me-29 is "gauche". The absolute configuration of OH-28 was then determined by Mosher ester analysis. However, despite trying a series of reaction conditions, the desired Mosher ester was not obtained. Therefore, the inventors performed quantum chemical calculations on the circular dichroism (CD) spectrum of the compound to determine the stereochemical structure of compound 1. The structure showed that the circular dichroism (CD) spectrum of compound 1 was highly consistent with the calculated spectrum of the isomer 1R4R5R7R9R10S11S13R15R19R28R29S31R ( Fig. 9 ). This finding provides strong support for determining the absolute stereochemical configuration of compound 1. Despite the presence of side chains, the structural skeleton of compound 1 is still composed of 25 carbons, so it is classified as a diterpenoid derivative and is named sesterdiaporate. The chemical structure is as follows Fig.10 shown.

[0102] (5) The UV spectrum analysis of sesterdiaporate, a terpenoid compound, showed that UV(CH3OH):λ max (logε):202(3.90),230(3.14)nm( Fig.11 ).

[0103] Example 3

[0104] Study on the effect of sesterdiaporate (hereafter referred to as SES) on Penicillium spp.

[0105] 1. Experiment on spore germination and mycelial growth of Penicillium italicum

[0106] (1) Penicillium italicum was inoculated into potato dextrose agar (PDA) medium and grown at 25°C for 4-5 days. Spores were collected and dispersed into potato dextrose (PDB) medium to prepare a spore suspension with a spore concentration of 10 6 CFU / mL.

[0107] (2) 2 mL of the spore suspension in step (1) and 10 μL of a solution containing different concentrations of compound SES (using DMSO as solvent) were mixed in a 5 mL centrifuge tube to make the drug concentrations of compound SES 0, 0.0625, 0.125, 0.25, 0.5, 1 and 2 μg / mL, respectively, and incubated at 140 rpm and 25°C for 12 h; after the incubation, 1 mL of the spore suspension was centrifuged at 12000 rpm for 3 min, the supernatant was removed, and the mixture was washed three times with an equal volume of PBS (0.01 M, pH 7.0). 20 μL of the spore suspension was aspirated onto a concave glass slide, and the germination of the spores was observed under an optical microscope (Leica MD3000, Germany). When the germ tube was greater than or equal to the spore diameter, the spores were considered to have germinated. The inhibition rate of the drug on spore germination was calculated using the following formula:

[0108]

[0109] Among them, N T is the total number of spores, 200 spores, N G is the number of spores that have germinated in the treatment group. OriginPro2021 was used to fit the inhibition rate curve of the drug on spore germination and calculate the half inhibitory concentration (EC 50 ). Each drug concentration was repeated three times, and 200 spores were observed in each repeat. Fig.12 As shown in A and C.

[0110] (3) 100 μL of the spore suspension from step (1) was evenly spread on a PDA plate (90 mm in diameter) and incubated in the dark at 25°C for 3 d. Then, the bacterial cake was cut with a hole puncher (7 mm in diameter) and inoculated in the center of a PDA plate (90 mm in diameter) containing different concentrations (0, 0.0625, 0.125, 0.25, 0.5, 1 and 2 μg / mL) of SES. The plates were cultured under the same conditions until the mycelium of the blank control group almost covered the entire PDA plate. Then, the diameter of the colony was measured with a vernier caliper, and the inhibition rate of the drug on the mycelium was calculated using the following formula:

[0111]

[0112] Where D C is the average colony diameter of the control group (mm), D T is the average colony diameter (mm) of the treatment group. Each treatment was repeated 5 times, and OriginPro 2021 was used to fit the inhibition rate curve of the drug on mycelium and calculate the EC 50 The results are as follows Fig.12 As shown in B and D.

[0113] according to Fig.12It can be seen that the compound SES isolated in Example 2 has a very significant inhibitory effect on the spore germination and hyphae growth of Penicillium italica, and this inhibitory effect depends on the dose of SES. The inhibitory effect of compound SES on hyphae growth of Penicillium italica is better than that on spore germination. 50 The value was 0.37 μg / mL (R 2 =0.9924), while for mycelial growth EC 50 The value was only 0.052 μg / mL (R 2 =0.994). In addition, SES treatment caused the spore volume to expand, and this trend was positively correlated with the SES concentration. At a concentration of 2 μg / mL, the diameter of the spores was 2 to 3 times that of the blank control.

[0114] 2. Propidium iodide (PI) and fluorescein diacetate (FDA) staining experiments

[0115] (1) Penicillium italicum was inoculated into potato dextrose agar (PDA) medium and grown at 25°C for 4-5 days. Spores were collected and dispersed into potato dextrose (PDB) medium to prepare a spore suspension with a spore concentration of 10 6 CFU / mL.

[0116] (2) The effect of compound SES on mycelial viability and cell membrane permeability can be evaluated by PI and FDA staining. Add 1 mL of spore suspension to 100 mL of PDB medium. Then culture at 140 rpm and 25°C for 24 h to ensure that Penicillium produces an appropriate amount of mycelium. Add an appropriate amount of compound SES to the mycelial culture to make its concentration 0, 0.25, 1 and 2 μg / mL, respectively, and the treatment time is 1, 2, 4, 8 and 12 h, respectively, with an equal volume of DMSO as the blank control group. Afterwards, take 1 mL of mycelial culture and centrifuge it at 12000 rpm for 3 min. Remove the supernatant and wash three times with an equal volume of PBS (0.01 M, pH 7.0). 1 mL of mixed staining solution was added to the mycelium, wherein the concentration of PI in the mixed staining solution was 10 μg / mL and the concentration of FDA was 40 μg / mL; staining was performed at 25°C for 20 min, then centrifuged, the staining solution was removed, and washed three times with an equal volume of PBS (0.01 M, pH 7.0). The mycelium was observed by fluorescence microscopy (Leica MD3000, Germany), and the results showed that compound SES not only caused spore swelling, but also induced swelling of cells at the mycelial growth point, and this swelling trend, mycelial vitality and cell membrane permeability were positively correlated with the concentration of compound SES and treatment time. In the high concentration group (2 μg / mL), the cells in the mycelial growth zone showed obvious swelling after being treated with compound SES for 1 h, and the green fluorescence signal did not weaken, indicating that the vitality and cell membrane permeability of the swelling cells did not change, indicating that compound SES can freely enter the cells and cause cell swelling, and this phenomenon is only found in the mycelial growth area ( Fig.13 As the action time was extended to 2h, the cells in the hyphae growth zone of the medium concentration group (1μg / mL) showed obvious swelling, the hyphae activity of the high concentration group was slightly reduced, and the cell membrane permeability did not change ( Fig.14 ). When the treatment time of compound SES was between 4 and 12 hours, the cells in the hyphae growth zone of all treatment groups showed significant swelling, and the volume of the swollen cells was positively correlated with the action time. In addition, the green fluorescence signal gradually weakened with the action time, and the red fluorescence signal gradually increased, indicating that the vitality of the hyphae decreased with the extension of the action time, and the permeability of the cell membrane gradually increased ( Fig.15 , Fig.16 and Fig.17 ). This indicates that the expansion of cells in the hyphae growth zone is an important mechanism for the compound SES to reduce hyphae vitality and increase cell membrane permeability.

[0117] 3. Scanning electron microscopy (SEM) and transmission electron microscopy (TEM) observations

[0118] (1) The culture and drug treatment methods of Penicillium italicum mycelium were the same as those in step 2. After step 2, the mycelium was collected after 12 hours of treatment with compound SES, and 1 mL of pre-cooled 4 wt.% glutaraldehyde was added and fixed at 4°C for 90 minutes. The glutaraldehyde was then removed and washed three times with an equal amount of PBS (0.01 M, pH 7.0). The mycelium was then dehydrated with different concentrations of ethanol for 10 minutes, and the concentrations of ethanol dehydration were 30 v / v%, 50 v / v%, 70 v / v%, 95 v / v% and 100 v / v%, respectively. Finally, it was fixed with 1 mL of hexamethyldiethylamine (HDMS) for 10 minutes, the HDMS was removed, and it was dried at room temperature for 24 hours. The dried mycelium was glued to a standard SEM table, then sputter-coated with palladium gold, and examined under a SEM instrument. The results showed that SEM analysis showed that the mycelium of the blank control group was smooth, and there was no deformation or expansion in the mycelium growth area ( Fig.18 Middle A); 12h after SES treatment ( Fig.18 In B, C and D), the hyphae showed concavity and shrinkage, and the cells in the hyphae growth zone swelled significantly. Among them, the swelling of the hyphae growth zone cells in the high concentration group (2 μg / mL) was the most significant, and some swollen cells ruptured directly.

[0119] (2) After treatment with compound SES (1 μg / mL) in step 2 for 12 h, the mycelia were collected and fixed at 4°C for 12 h with 1 mL of pre-cooled 4 wt.% glutaraldehyde. The samples were sent to Hangzhou Yanqu Information Technology Co., Ltd. for TEM observation. The results showed that the cells in the blank control group were spindle-shaped, and the number of organelles such as endoplasmic reticulum, Golgi apparatus, and mitochondria in the cells was large. The cellular morphology was clear and evenly distributed throughout the cells ( Fig.18 E and F). After 12 hours of treatment with 1 μg / mL compound SES, one end of the cell was significantly swollen, and an abnormal cavity appeared in the cell, accounting for about 1 / 2 of the entire cell volume; at the same time, it was observed that the number of organelles such as the endoplasmic reticulum and Golgi apparatus decreased, and they were squeezed to one side of the cell by the huge cavity, and the organelle morphology was abnormal ( Fig.18 G and H).

[0120] 4. Transcriptome Sequencing Analysis of Penicillium italicum Hyphae

[0121] (1) The culture and drug treatment methods of Penicillium italicum mycelium were the same as those in step 2, except that the concentration of compound SES was 0.1 μg / mL, DMSO was used instead of DMSO in the control group, and the treatment time was 12 h. After the treatment, the mycelium was collected and washed three times with PBS (0.01 M, pH 7.0) to remove the residual culture medium, and then the mycelium samples were frozen with liquid nitrogen.

[0122] (2) We commissioned BGI Co., Ltd. (Guangzhou) to perform total RNA extraction and RNA-seq analysis; total RNA was extracted using TRIzol reagent (Invitrogen, USA), and the purity was measured using a nanophotometer (IMPLEN, CA, USA). After enrichment and impurity removal, total RNA was reverse transcribed into cDNA, and after specific amplification of cDNA, a DNA library was established and then sequenced on the DNBSEQ platform (BGI, Guangdong). Three replicates were made for both the treatment group and the blank group. The raw reads obtained by sequencing were removed from impurity reads (low quality, adapter contamination, and reads with unknown base N content) to obtain clean reads, which were mapped to the genome data of Penicillium italicum (https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCA_001008395.1 / ), and compared and analyzed using HISAT2 v2.1.0 software, and gene expression levels were calculated using Bowtie2v2.2.5 software, and then DESeq2 method was used to detect DEG (differentially expressed gene). The detection criteria for DEG were |log2(Fold Change)|>1 and P value <0.05. DEGs were searched and annotated in GO (Gene Ontology: https: / / geneontology.org) and KEGG (Kyoto Encyclopedia of Genes and Genomes: https: / / www.kegg.jp), and the annotation results were subjected to enrichment analysis in R software.

[0123] The results of transcriptome sequencing analysis showed that after the mycelium of Penicillium italicum was treated with 0.1 μg / mL compound SES for 12 h, a total of 1241 DEGs (Differential Expression Genes) were identified, including 606 up-regulated genes and 635 down-regulated genes. The DEGs were functionally annotated with Gene Ontology (GO) and divided into 15 molecular functions, 2 cellular components, and 11 biological processes. DEGs were mainly concentrated in docking (442 DEGs) and catalytic activity (512 DEGs) in terms of molecular functions, in cell components, in cell anatomical entities (606 DEGs), and in biological processes, in cellular processes (381 DEGs) and metabolic processes (337 DEGs) ( Fig.19 The DEGs were subjected to GO enrichment analysis, and the top 20 GO enrichments were mainly enriched in ribosome biogenesis and RNA metabolism processes ( Fig.19 (B) shows that SES has a significant effect on RNA transcription and protein translation.

[0124] DEGs were annotated in KEGG, and their involvement in KEGG metabolic pathways was divided into five branches, namely, two cellular processes, two environmental information processing, four genetic information processing, 12 metabolic processes and one organic system. Among them, a total of 858 DEGs were involved in metabolic processes, accounting for 69.14% of the total DEGs, indicating that SES had a significant effect on the metabolic pathways of Penicillium italicum, including carbohydrate metabolism, amino acid metabolism, lipid metabolism, etc. ( Fig.19 (C) DEGs were subjected to KEGG enrichment analysis, and the top 20 KEGG enrichments were as follows Fig.19 Middle D, showing that DEGs were significantly enriched in ribosome biogenesis (34 DEGs) and glycerophospholipid metabolism (33 DEGs).

[0125] 76.47% of DEGs in the ribosome biosynthesis pathway were upregulated, and the metabolism of alanine, aspartate, and glutamate and the biosynthesis of valine, leucine, and isoleucine were also significantly affected, indicating that the protein synthesis pathway may be seriously affected after the compound SES acted on the hyphae of Penicillium italicum. The effect of compound SES on the glycerophospholipid metabolism pathway mainly occurred in the acylation of 3-phosphoacylglycerol ketone and 3-phosphoacylglycerol, such as Fig. 20 As shown in the figure, the gene expression of lysophospholipid acyltransferase was significantly downregulated, which may affect the catalytic synthesis of acylation of 3-phospho-1,2-diacylglycerol, while the gene expression of glycerol-3-phosphate acyltransferase (GPAT) was upregulated, which may convert more 3-phosphoglycerol into 3-phospho-1,2-diacylglycerol. Since the catalytic synthesis of 3-phospho-1,2-diacylglycerol is affected, it will have a certain impact on subsequent metabolic processes, such as glycosylated phosphatidylinositol anchor protein biosynthesis (GPI-anchorbiosynthesis).

[0126] 5.qRT-PCR Analysis

[0127] (1) The culture and drug treatment methods of Penicillium italicum mycelium were the same as those in step 2, except that the concentrations of compound SES were 0, 0.1, and 1 μg / mL, and the control group was replaced with DMSO. The treatment time was 12 h. After the treatment, the mycelium was collected and washed three times with PBS (0.01 M, pH 7.0), the residual culture medium was removed, and the mycelium samples were frozen with liquid nitrogen.

[0128] (2) Use immediately Total RNA was extracted from mycelium using Total RNA Kit I (Omega Bio-tek, Inc, Norcross, GA, USA). Before reverse transcription, the RNA concentration was determined by NanoDrop One C micro-spectrophotometer (Thermo Fisher Scientific, USA) and the RNA quality was analyzed by agarose gel electrophoresis. One-st centrifugation gDNA removal and cDNA synthesis supermix kit (TransGen Biotech, Beijing) was used to complete the gene expression level detection. Green qPCRsupermix kit (TransGen Biotech, Beijing) and Light The PCR was performed using a 96 real-time fluorescence quantitative PCR instrument (Roche Diagnostics GmbH, Germany). Specific primers for 12 genes including amiE were synthesized using Premier 6 software, and Actin was used as an internal reference gene. The experiment was repeated three times for each drug concentration; the specific primer sequence information is shown in Table 2.

[0129] Table 2 Specific primer sequence information

[0130]

[0131] according to Fig.21 It can be seen that the expression of amidase (amiE), ethanolamine kinase (EKI), CDP-diacylglycerol-inositol 3-phosphatidyltransferase (CDIPT) and GPI amidase U (PIGU) was downregulated, and the expression of glycerol-3-phosphate acyltransferase (GPAT), acetyltransferase 10 (NAT10), RIO kinase 1 (RIOK1), phosphatidyl diphosphatase 2 (DPP2) and phosphatidyl diphosphatase 3 (DPP3) was upregulated, and these genes were consistent with the transcriptome sequencing results. Under the action of high concentration (1μg / mL) of compound SES, NAT10 expression was downregulated, and the expression of RIOK1, DPP2 and DPP3 decreased compared with the low concentration group (0.1μg / mL). EKI and CDIPT are key enzymes in the biosynthesis pathway of glycosylated phosphatidylinositol-anchored proteins. Down-regulation of EKI and CDIPT expression may affect the phosphorylation of ethanolamine (EtA) and the catalytic synthesis of phosphatidylinositol (PMI). However, the phosphorylation of EtA and the synthesis of PMI are extremely critical for the biosynthesis of glycosylated phosphatidylinositol-anchored proteins, indicating that the compound SES has a more significant effect on this pathway.

[0132] 6. Molecular Docking

[0133] Combined with transcriptome and qRT-PCR analysis, compound SES has a significant effect on the EKI (Ethanolamine kinase) and CDIPT (CDP-diacylglycerol-inositol 3-phosphatidyltransferase) genes in the GPI anchor biosynthesis pathway. These two enzymes may be the active sites of compound SES, so molecular docking was used for analysis. First, the sequences of the two genes were translated into amino acid sequences using DNAMAN 9.0.2 software, and then the protein model was constructed using SWISS-MODEL (https: / / swissmodel.expasy.org / interactive), and the compound SES model was constructed using Chem3D 22.0.0 software. The pre-processing of the protein model and the compound SES model, such as hydrogenation and charge calculation, was performed in AutodockTools 1.5.7 software, and the molecular docking was completed using AutodockVina 1.2.3 software. Among them, the "Exhaustiveness" parameter was set between 10 and 16 according to the volume of the "Gridbox", and the other parameters were the system default values. The molecular docking results were analyzed using AutodockTools 1.5.7 software, and the best model was visualized using PyMol 2.6 and LigPlot v2.2.8 software.

[0134] Molecular docking results ( Fig. 22 , purple represents amino acid residues connected by hydrogen bonds, yellow or green dotted lines represent hydrogen bond interactions, and red crescent symbols represent hydrophobic interaction amino acid residues, and red dotted lines represent hydrophobic interactions) showed that compound SES can stably bind to EKI and CDIPT, with collective energies of -7.07 and -8.426 kcal / mol, respectively, indicating that these two enzymes may be the action sites of compound SES, resulting in significant downregulation of their gene expression levels. The docking results of compound SES and EKI showed that compound SES formed a hydrogen bond with two amino acid residues (Thr-313 and Asn-223) of EKI, with bond lengths of 2.0 and 1.3 kcal / mol, respectively. ( Fig. 22 In B), 7 amino acid residues (such as Thr-200) form a hydrophobic interaction, and Thr-313 and Asn-223 have a hydrophobic interaction in addition to hydrogen bonding ( Fig. 22 The docking results of compound SES and CDIPT showed that the three amino acid residues (Ala-215, Glu-174 and Arg-171) formed three hydrogen bonds with SES, with bond lengths of 2.5, 2.1 and ( Fig. 22 In E), there is a hydrophobic interaction; in addition, 12 amino acid residues only have a hydrophobic interaction ( Fig. 22 In the two molecular docking results, the hydroxyl groups connected to C-4 and C-28 of compound SES formed hydrogen bonds with amino acid residues, indicating that these two hydroxyl groups played an important role in the antibacterial activity.

[0135] 7. Experiment on the influence of intracellular protein content of Penicillium italicum hyphae

[0136] (1) Penicillium italicum was inoculated into potato dextrose agar (PDA) medium and grown at 25°C for 4-5 days. Spores were collected and dispersed into potato dextrose (PDB) medium to prepare a spore suspension with a spore concentration of 10 6 CFU / mL.

[0137] (2) 1 mL of the spore suspension in step (1) was added to 100 mL of PDB medium, and incubated at 25°C and 140 rpm for 24 h to allow an appropriate amount of mycelium to grow in the medium. Then 50 μL of SES solution of different concentrations (DMSO as solvent) was added to make the concentrations 0, 0.0625, 0.125, 0.25, 0.5, 1 and 2 μg / mL, respectively, and then incubated under the same conditions for 12 h.

[0138] (3) After the incubation, the mycelium of Penicillium italicum was obtained by filtering through gauze (8 layers), and the mycelium was washed several times with PBS (0.01M, pH 7.0) to remove the excess culture medium. After that, the mycelium was placed in -80°C freezer for 24 hours, and then vacuum dried for 24 hours in a freeze dryer (GOLD-SIM, USA). 0.01g of freeze-dried mycelium and 1mL of PBS (0.01M, pH7.0) were ground and homogenized on ice, and the homogenate was collected and centrifuged at 12000rpm for 5 minutes to collect the supernatant. The protein content in the supernatant was determined by the Coomassie Brilliant Blue G-250 method. 250μL of Coomassie Brilliant Blue G-250 solution (0.01%, w / v) was taken in a 96-well plate, 10μL of supernatant was added, incubated at 30°C for 5 minutes, and then the absorbance at 595nm was measured using an ELISA reader (Infinite M200 Pro, Tecan, Switzerland). Then, bovine serum albumin (0-2 mg / mL) was used to draw a standard curve (y=0.6448x+0.0348, R 2 =0.9948), and the protein content in freeze-dried mycelium was calculated by the following formula:

[0139]

[0140] Among them, C P represents the protein concentration (mg / mL) in the supernatant after calculation by the standard curve, V E represents the volume (mL) of intracellular protein extract (PBS, 0.05 M, pH 7.4), M D It indicates the mass of freeze-dried mycelium (g), and 3 replicates were made for each concentration.

[0141] The calculation results of protein content in freeze-dried mycelium showed that after the compound SES was treated with the mycelium of Penicillium italicum for 12 hours, the content of intracellular protein in the mycelium was significantly reduced, which was dependent on the concentration of the compound SES. When the concentration of the compound SES was 2 μg / mL, the intracellular protein content in the mycelium was significantly reduced by 27.46% compared with the blank control ( Fig.23 ).

[0142] 8. Effects of exogenous additives on the inhibition of hyphal growth of Penicillium italicum

[0143] Through transcriptome, qRT-PCR and molecular docking analysis, the action sites of compound SES may be EKI and CDIPT. Therefore, the effect of exogenous addition of exogenous ethanolamine (EtA), phosphoethanolamine (PEA) and phosphatidylinositol (PMI) on the antibacterial effect of compound SES was evaluated. The specific steps are as follows:

[0144] (1) Penicillium italicum was inoculated into potato dextrose agar (PDA) medium and grown at 25°C for 4-5 days. Spores were collected and dispersed into potato dextrose (PDB) medium to prepare a spore suspension with a spore concentration of 10 6 CFU / mL.

[0145] (2) The PDA culture medium was randomly divided into four treatment groups. The first treatment group only added different concentrations of exogenous additives (EtA, PEA or PMI), the concentrations were 10, 50 and 100 μg / mL respectively; the second treatment group only added different concentrations of exogenous additives (EtA, PEA or PMI) and compound SES, the concentrations of exogenous additives were 10, 50 and 100 μg / mL respectively, and the concentration of compound SES was 0.125 μg / mL; the third treatment group (blank control group, CK) only added DMSO; the fourth treatment group (positive control group, SES) only added 0.125 μg / mL compound SES;

[0146] 100 μL of the spore suspension in step (1) was evenly spread on a PDA plate (90 mm in diameter) and incubated in the dark at 25°C for 3 days. Then, a bacterial cake was cut with a hole puncher (7 mm in diameter) and inoculated in the center of the PDA plates (90 mm in diameter) of different treatment groups. The plates were cultured under the same conditions until the mycelium of the blank control group almost covered the entire PDA plate. The mycelium inhibition rate was then calculated according to step 1. Each treatment was repeated three times. The results are shown in Table 1. Fig.24 .according to Fig.24 It can be seen that PEA and PMI significantly reduce the antibacterial effect of compound SES, and EtA does not affect the inhibitory effect of compound SES on the hyphal growth of Penicillium italicum. When the exogenous compound PEA and compound PMI are 100 μg / mL, the inhibition rate of compound SES on the hyphal growth of Penicillium italicum is reduced by 5.24% and 25.51%, respectively, indicating that exogenous PMI more effectively inhibits the inhibitory effect of compound SES on the hyphal growth of Penicillium italicum.

[0147] 9. In vivo antibacterial experiment

[0148] The puncture inoculation method was used to test the inhibitory effect of compound SES on Penicillium italicum in vivo. The specific steps were as follows: First, fresh navel oranges of moderate size and free of pests and diseases were selected, and the fruits were soaked in 75v / v% ethanol for 1 min, and then placed in a ventilated place to dry the surface of the fruit. Secondly, a sterilized inoculation needle (2mm in diameter) was used to puncture the fruit near the equator to form a small hole with a depth of 5mm, and 40μL of compound SES solution was injected into the small hole of the fruit. The solution concentrations were 1EC and 1EC, respectively. 50 , 5EC 50 and 10EC 50 (EC 50 =0.37μg / mL). Meanwhile, equal volumes of prochloraz (3.7μg / mL) and DMSO were used as positive control and blank control (CK), respectively. Finally, 20μL of the spore suspension obtained in step 1 was inoculated into the fruit holes, and the inoculated fruits were placed in a foam box for 7 days. The culture temperature was 25±2℃, and the humidity was kept above 85%. Six fruits were inoculated in each treatment, and the lesion diameter of the fruit was measured every day. The results are shown in Table 1. Fig.25 shown.

[0149] according to Fig.25 It can be seen that the navel orange fruits in the blank control group showed obvious water-soaked lesions 3 days after inoculation with Italian Penicillium spores. The lesion peel surface showed typical symptoms of penicillium 6 days after inoculation. The lesion diameter was 67.16 mm 7 days after inoculation. The SES treatment group did not show obvious symptoms of penicillium 7 days after inoculation. The lesion diameter was significantly smaller than that of the blank control group. 50 , 5EC 50and 10EC 50 The lesion inhibition rates of prochloraz were 19.17%, 24.98% and 49.4% respectively. The symptoms of the positive control group (prochloraz) were similar to those of the blank control, both of which showed typical symptoms of penicillium, and the lesion inhibition rate was only 14.18% (p<0.05). The lesion inhibition effect of prochloraz was far lower than that of 10EC at the same concentration. 50 Treatment group (3.7 μg / mL). This shows that compound SES treatment can effectively reduce the diameter of lesions caused by Penicillium italicum inside navel orange fruits, and the lesion inhibition effect is significantly better than prochloraz.

[0150] According to the above content, it can be seen that the sesquiterpenoid compounds derived from the endophytic bacteria of navel orange provided by the present invention can effectively inhibit the synthesis of glycosylated phosphatidylinositol, have extremely significant antibacterial activity against Penicillium italicum, and can be used to prevent and treat citrus penicillium disease.

[0151] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A navel orange endophyte Diaporthe sp. GC-1-128-79, deposited in China Center for Type Culture Collection, with the deposit number of CCTCC NO: M20242152.

2. The fermentation product of the navel orange endophyte Diaporthe sp.GC-1-128-79 according to claim 1, wherein the fermentation product contains a diterpenoid compound with a structural formula as shown in Formula I; 3. A diterpenoid compound, characterized in that: The structural formula of the diterpenoid compound is shown in Formula I:

4. The method for preparing the diterpenoid compound according to claim 3, characterized in that: The steps include: Extracting the fermentation product of the navel orange endophyte Diaporthe sp.GC-1-128-79 according to claim 1 with an ethanol solution having a volume concentration of 90 to 95% to obtain a crude fermentation extract; The fermentation crude extract is extracted with ethyl acetate, and the extract is concentrated to obtain an extract; The extract is subjected to a first silica gel column chromatography, using a first mixed solution 1-8 including petroleum ether and ethyl acetate, and a second mixed solution 1-4 including dichloromethane and methanol as eluents, respectively, for gradient elution, and collecting the eluents; the eluents are subjected to TLC thin layer chromatography, using petroleum ether and ethyl acetate in a volume ratio of 2:1 as a developing solvent, and the eluents with Rf=0.3-0.5 are combined and named as component Fr 12; the volume ratios of petroleum ether and ethyl acetate in the first mixed solutions 1-8 are 10:0, 9:1, 4:1, 7:3, 3:2, 1:1, 2:3 and 3:7, respectively; the volume ratios of dichloromethane and methanol in the second mixed solutions 1-4 are 19:1, 9:1, 4:1 and 7:3, respectively; The component Fr 12 is subjected to a second silica gel column chromatography, and the third mixed solution 1-6 including petroleum ether and ethyl acetate is used as an eluent, and gradient elution is performed, and the eluents are collected; the eluents are subjected to TLC thin layer chromatography, and the eluents are developed with a volume ratio of petroleum ether to ethyl acetate of 7:3 as a developing solvent, and the eluents with Rf=0.2-0.4 are combined and named as component Fr 12.4; the volume ratios of petroleum ether and ethyl acetate in the third mixed solution 1-6 are 17:3, 4:1, 3:1, 7:3, 3:2 and 1:1 respectively; The component Fr 12.4 is subjected to a third silica gel column chromatography, and a fourth mixed solution 1 to 3 including petroleum ether and ethyl acetate is used as an eluent, respectively, for gradient elution, and the eluent is collected; the eluent is subjected to TLC thin layer chromatography, and developed with petroleum ether and ethyl acetate in a volume ratio of 5:1 as a developing solvent, and the eluent with Rf=0.25 is combined to obtain the diterpenoid compound according to claim 2; the volume ratios of petroleum ether and ethyl acetate in the fourth mixed solution 1 to 3 are 9:1, 17:3 and 4:1, respectively.

5. The preparation method according to claim 4, characterized in that: The method for preparing the fermentation product of the navel orange endophyte Diaporthe sp.GC-1-128-79 comprises the following steps: fermenting and culturing the seed liquid of the navel orange endophyte Diaporthe sp.GC-1-128-79 using a rice culture medium to obtain the fermentation product of the navel orange endophyte Diaporthe sp.GC-1-128-79; The rice culture medium is prepared by mixing 90-110 g of rice with 100 mL of water for sterilization; The fermentation temperature is 27-30°C and the fermentation time is 40-50 days.

6. The preparation method according to claim 5, characterized in that: The volume ratio of the seed liquid to the rice culture medium is (5-10):

100.

7. Use of the navel orange endophyte Diaporthe sp. GC-1-128-79 according to claim 1, the fermentation product according to claim 2, the diterpenoid compound according to claim 3, or the diterpenoid compound prepared by the preparation method according to any one of claims 4 to 6 in preventing and controlling citrus penicillium disease.

8. Use of the navel orange endophyte Diaporthe sp. GC-1-128-79 according to claim 1, the fermentation product according to claim 2, the diterpenoid compound according to claim 3, or the diterpenoid compound prepared by the preparation method according to any one of claims 4 to 6 in resistance to Penicillium italicum.

9. A bacterial agent against Penicillium italicum, characterized in that: The active ingredients of the bacterial agent include one or more of the navel orange endophyte Diaporthesp.GC-1-128-79 described in claim 1, the fermentation product described in claim 2, or a diterpenoid compound; the diterpenoid compound is the diterpenoid compound described in claim 3 and / or a diterpenoid compound prepared by the preparation method described in any one of claims 4 to 6.

10. A method for preventing and controlling citrus penicillium disease, characterized in that: The citrus fruits are treated with the bacterial agent described in claim 9.

Images