Cell-free protein expression system, kit and method

Abstract

The invention discloses a cell-free protein expression system which comprises nucleic acid for coding target protein, a cell extract and a supplement system, and the supplement system comprises a nucleotide mixture, an amino acid mixture, a buffer solution, magnesium salt, potassium salt, L-glutamate and oxalate. Wherein the expression system contains an exogenous enzyme for converting L-glutamic acid into alpha-ketoglutaric acid. The invention also discloses a kit for cell-free protein expression and a method for expressing a target protein.

Description

Technical Field

[0001] The present invention relates to protein expression and synthesis. More specifically, the present invention relates to a cell-free protein expression system. The present invention also relates to a kit and method for cell-free protein expression. Background Art

[0002] Proteins are of great scientific and practical significance as potential therapeutic biological agents, drug targets and biocatalysts. Existing technologies have achieved the successful expression and production of many proteins, but many proteins of great significance are still difficult to express effectively for various reasons, such as cytotoxic proteins and insoluble proteins. With the development of science and technology, cell-free protein expression technology has become a powerful protein expression method due to its unique open system characteristics, which allows the control of reaction conditions, components of reactants, and direct monitoring of reaction expression. The cell-free protein synthesis (CFPS) system is an in vitro gene expression system that uses exogenous DNA or mRNA as a template, artificially adds the required raw materials and energy substances, and synthesizes proteins under the condition of cell extracts. It can break through cell restrictions and express various proteins conveniently and quickly. In detail, CFPS uses DNA as a template, and under the action of components such as RNA polymerase and transcription factors, the corresponding mRNA is transcribed; using mRNA as a template, the ribosomes, amino acid substrates, tRNA, energy substances, etc. in the system are used to translate and synthesize proteins. Cell-free protein expression does not require the maintenance of cell metabolism and is more efficient. Due to its unique open system characteristics, it allows the control of reaction conditions, the components of reactants, and direct monitoring of reaction expression, and has the potential to express various toxic proteins and difficult-to-express proteins.

[0003] However, traditional cell-free protein synthesis has problems such as low efficiency and high cost. In order to solve the problem of high cost of cell-free protein synthesis, in 2005, Kara A.Calhoun and James R.Swartz used glucose as an energy source to replace the expensive phosphoenolpyruvate for batch cell-free protein expression, which can reduce the cost by 75%. Although the use of glucose as an energy source for cell-free systems can significantly reduce the cost of cell-free reactions, during the glucose degradation process, the level of inorganic phosphate in the cell-free system will continue to increase, the pH value will decrease, and protein synthesis will be terminated. In order to solve the above problems, in 2011, Ho-Cheol Kim and Tae-Wan Kim proposed to use starch as an energy source for cell-free protein expression. The use of starch can avoid the decrease in pH value and prolong the time of cell-free reaction. The protein yield after 12h of reaction is as high as 1.7mg / mL. In addition, using starch as an energy source for cell-free reactions can also control the translation rate of proteins and produce more soluble forms of proteins. Although this method successfully reduces the cost of cell-free protein expression, its protein expression is still relatively low and cannot meet the needs of users. Summary of the invention

[0004] In view of the above problems, the present invention proposes an efficient and low-cost cell-free protein expression method. The inventors of the present application unexpectedly discovered that by adding a high level of enzyme that converts L-glutamate into α-ketoglutarate to the cell-free system, the tricarboxylic acid cycle and oxidative phosphorylation reaction can be accelerated, providing more energy for CPFS, thereby increasing the expression of protein and reducing the reaction cost.

[0005] In one aspect, the present invention provides a cell-free protein expression system, comprising a nucleic acid encoding a target protein, a cell extract, and a supplement system, wherein the supplement system comprises a nucleotide mixture, an amino acid mixture, a buffer, a magnesium salt, a potassium salt, L-glutamate, and an oxalate, wherein the expression system contains an exogenous enzyme that converts L-glutamate into α-ketoglutarate.

[0006] In some embodiments, the enzyme that converts L-glutamate into α-ketoglutarate is one or more of glutamate dehydrogenase (GDH), amino acid oxidase (LAAO) and glutamate oxidase (LGOX). In a preferred embodiment, the enzyme that converts L-glutamate into α-ketoglutarate is glutamate dehydrogenase (GDH) or glutamate oxidase (LGOX). In a more preferred embodiment, the enzyme that converts L-glutamate into α-ketoglutarate is glutamate dehydrogenase.

[0007] In some embodiments, the glutamate dehydrogenase is derived from Escherichia coli, and the gene sequence is SEQ ID NO: 1 or its equivalent.

[0008] In some embodiments, the concentration of the exogenous enzyme that converts L-glutamate into α-ketoglutarate is no less than about 75 U / mL.

[0009] In some embodiments, the exogenous enzyme that converts L-glutamate into α-ketoglutarate comes from: adding the enzyme; transforming the gene encoding the enzyme into the cell serving as the source of the cell extract; and / or knocking the gene encoding the enzyme into the cell serving as the source of the cell extract.

[0010] In some embodiments, the expression system further comprises thiamine.

[0011] In some embodiments, the concentration of thiamine is about 0.007 to about 0.7 mg / mL.

[0012] In another aspect, the present invention provides a kit for cell-free protein expression, comprising a cell extract and a supplement system, wherein the supplement system comprises a nucleotide mixture, an amino acid mixture, a buffer, a magnesium salt, a potassium salt, L-glutamate and oxalate, wherein the kit contains an exogenous enzyme for converting L-glutamate into α-ketoglutarate.

[0013] In another aspect, the present invention provides a method for expressing a target protein, comprising: in the above-mentioned cell-free protein expression system, under conditions suitable for expressing the target protein, mixing a nucleic acid encoding the target protein, a cell extract and a supplement system, thereby expressing the target protein.

[0014] Other aspects and advantages of the present invention will be described in detail in the specific embodiments, and those skilled in the art will be able to recognize other aspects and advantages that are not explicitly stated in the present disclosure from the following detailed description. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 It is a bar graph showing the protein expression levels of the cell extracts prepared in Example 1 and Comparative Example 1 of the present application.

[0016] Figure 2 This is the effect of different glutamate dehydrogenase concentrations on cell-free protein expression in Example 2 of the present application.

[0017] Figure 3 This is the effect of different thiamine concentrations on cell-free protein expression in Example 3 of the present application.

[0018] Figure 4 This is a schematic diagram of the construction of a strain that highly expresses glutamate dehydrogenase in Example 4 of the present application.

[0019] Figure 5 This is a schematic diagram of the construction of donor DNA in Example 4 of the present application.

[0020] Figure 6 This is a bar graph showing the protein expression levels of the cell extracts prepared in Examples 1 and 4 of the present application. DETAILED DESCRIPTION

[0021] definition

[0022] Throughout the specification and claims, unless the context indicates otherwise, the word "comprise" and variations such as "include" and "contain" will be understood to include the stated integers, steps or components but not to exclude any other integers, steps or components. When used herein, the term "comprise" may be replaced with the term "include" or "contain", or the term "have" is sometimes used herein instead.

[0023] As used in this specification and claims, the singular forms "a", "an", "the", and "said" include plural references unless the context clearly dictates otherwise. For example, the term "cell" includes a plurality of cells, including mixtures thereof.

[0024] All numerical symbols (e.g., pH, temperature, time, concentration, and molecular weight, including ranges) are approximate and vary positively (+) or negatively (-) in increments of 1%, 5%, or 10%. It should be understood that all numerical symbols are preceded by the term "about", although not always explicitly stated. It should also be understood that, although not always explicitly stated, the agents described herein are exemplary only and that equivalents thereof are known in the art.

[0025] In the present invention, "about" means that the value is within the acceptable error range of the specific value determined by a person of ordinary skill in the art, and the value depends in part on how it is measured or determined (i.e., the limits of the measurement system). For example, in each practice in the art, "about" can mean within 1 or more than 1 standard deviation. Alternatively, "about" or "substantially including" can mean a range of up to 20%. In addition, for biological systems or processes, the term can mean up to an order of magnitude or up to 5 times the value. Unless otherwise stated, when a specific value appears in the application and claims, the meaning of "about" or "substantially including" should be assumed to be within the acceptable error range of the specific value.

[0026] As will be understood by one skilled in the art, all ranges disclosed herein also encompass any and all possible subranges and combinations of subranges thereof, for any and all purposes. In addition, as will be understood by one skilled in the art, a range includes each individual member.

[0027] As used herein, "and / or" refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of a combination when interpreted in the alternative form ("or").

[0028] Cell-free protein expression system

[0029] In one aspect, the present invention provides a cell-free protein expression system, comprising a nucleic acid encoding a target protein, a cell extract, and a supplement system, wherein the supplement system comprises a nucleotide mixture, an amino acid mixture, a buffer, a magnesium salt, a potassium salt, L-glutamate, and an oxalate, wherein the expression system contains an exogenous enzyme that converts L-glutamate into α-ketoglutarate.

[0030] In the above expression system, the energy substance is glutamate, which provides energy by participating in oxidative phosphorylation. In particular, by adding a high level of enzyme that converts L-glutamate into α-ketoglutarate to the cell-free system, the tricarboxylic acid cycle and oxidative phosphorylation reactions are accelerated, providing more energy for CPFS, thereby increasing the expression of the protein.

[0031] As used herein, "exogenous" proteins (e.g., enzymes) are proteins that are not naturally expressed by cells, but are artificially added or expressed by cells through techniques such as gene transfection. If a protein gene is directly placed into a cell (even if the cell already contains the gene), the protein expressed from the exogenous gene fragment is still an exogenous protein.

[0032] For the cell-free protein expression system of the present invention, the "exogenous" enzyme that converts L-glutamate into α-ketoglutarate can come from: adding the relevant enzyme, such as adding the enzyme separately to the expression system; transforming the gene encoding the relevant enzyme into the cell serving as the source of the cell extract, such as inserting the coding sequence of the relevant enzyme (such as SEQ ID NO: 1) into a free plasmid in the cell; and / or knocking the gene encoding the relevant enzyme into the cell serving as the source of the cell extract, thereby integrating into the cell genome, such as using a donor DNA with a sequence of SEQ ID NO: 2.

[0033] In some embodiments, the enzyme that converts L-glutamate into α-ketoglutarate is one or more of glutamate dehydrogenase (GDH), amino acid oxidase (LAAO) and glutamate oxidase (LGOX). In a preferred embodiment, the enzyme that converts L-glutamate into α-ketoglutarate is glutamate dehydrogenase (GDH) or glutamate oxidase (LGOX). In a more preferred embodiment, the enzyme that converts L-glutamate into α-ketoglutarate is glutamate dehydrogenase.

[0034] In some embodiments, the glutamate dehydrogenase is derived from Escherichia coli, and the gene sequence is SEQ ID NO:1.

[0035] In some embodiments, the concentration of the exogenous enzyme that converts L-glutamate into alpha-ketoglutarate is from about 15 U / mL to about 150 U / mL, including any range therebetween, such as from about 15 U / mL to about 30 U / mL, from about 15 U / mL to about 75 U / mL, from about 15 U / mL to about 120 U / mL, from about 15 U / mL to about 135 U / mL, from about 30 U / mL to about 75 U / mL, from about 30 U / mL to about 120 U / mL, from about 30 U / mL to about 135 U / mL, from about 30 U / mL to about 150 U / mL, from about 75 U / mL to about 120 U / mL, from about 75 U / mL to about 135 U / mL, from about 75 U / mL to about 150 U / mL, from about 120 U / mL to about 135 U / mL, from about 120 U / mL to about 150 U / mL, or from about 135 U / mL to about 150 U / mL. In some embodiments, the concentration of the exogenous enzyme that converts L-glutamate into alpha-ketoglutarate is not less than about 15 U / mL, not less than about 30 U / mL, not less than about 75 U / mL, not less than about 120 U / mL, not less than about 135 U / mL, or not less than about 150 U / mL. In some embodiments, the concentration of the exogenous enzyme that converts L-glutamate into alpha-ketoglutarate is not less than about 75 U / mL.

[0036] In some embodiments, the expression system further contains thiamine. α-ketoglutarate dehydrogenase uses thiamine as a coenzyme, and the addition of thiamine can promote α-ketoglutarate to enter the tricarboxylic acid cycle metabolic flow. When thiamine is insufficient, the metabolic flow of α-ketoglutarate entering the tricarboxylic acid cycle is weakened and flows to glutamate.

[0037] In some embodiments, the concentration of thiamine is about 0.007-about 0.7 mg / mL, including any range therebetween, such as about 0.007-about 0.035 mg / mL, about 0.007-about 0.07 mg / mL, about 0.035-about 0.07 mg / mL, about 0.035-about 0.7 mg / mL, or about 0.07-about 0.7 mg / mL. In some embodiments, the concentration of thiamine is about 0.035 mg / mL.

[0038] In some embodiments, the nucleic acid encoding the target protein is provided in the form of a plasmid or a linear DNA fragment.

[0039] In some embodiments, the cell extract is a prokaryotic cell extract, a eukaryotic cell extract, or a combination thereof. The cell can be a bacterium, a fungus, a plant cell, an insect cell, or an animal cell. In some embodiments, the cell extract is an Escherichia coli cell extract.

[0040] In some embodiments, the nucleotide mixture includes nucleoside triphosphates NTP and / or nucleotides NMP. In some embodiments, the nucleoside triphosphates NTP include any of the following combinations: combination A: adenosine triphosphate ATP, guanosine triphosphate GTP, uridine triphosphate UTP and cytidine triphosphate CTP; combination B: adenosine triphosphate ATP and guanosine triphosphate GTP. In some embodiments, the nucleotide NMP includes any of the following combinations: combination C: adenine nucleotide AMP, guanine nucleotide GMP, uridine nucleotide UMP and cytine nucleotide CMP; combination D: adenine nucleotide AMP and guanine nucleotide GMP.

[0041] In some embodiments, the amino acid mixture is a mixture of one or more of the twenty amino acids: glycine, alanine, valine, leucine, isoleucine, phenylalanine, proline, tryptophan, serine, tyrosine, cysteine, methionine, asparagine, glutamine, threonine, aspartic acid, glutamic acid, lysine, arginine and histidine.

[0042] In some embodiments, the buffer is a phosphate buffer. In some embodiments, the magnesium salt is magnesium glutamate and / or magnesium acetate. In some embodiments, the potassium salt is potassium glutamate and / or potassium acetate. In some embodiments, the L-glutamate is potassium glutamate and / or magnesium glutamate and / or sodium glutamate. In some embodiments, the oxalate is potassium oxalate and / or sodium oxalate.

[0043] In some embodiments, the molar concentration of the buffer is 2 to 100 mM. In some embodiments, the molar concentration of the magnesium ions contained in the magnesium salt is 0.5 to 20 mM. In some embodiments, the molar concentration of the potassium ions contained in the potassium salt is 20 to 350 mM. In some embodiments, the molar concentration of the glutamate contained in the L-glutamate is 20 to 350 mM. In some embodiments, the molar concentration of the oxalate is 0.5 to 10 mM. In some embodiments, the molar concentration of each amino acid in the amino acid mixture is 1 to 3 mM. In some embodiments, the molar concentration of each nucleotide in the nucleotide mixture is 0.5 to 1.5 mM.

[0044] Reagent test kit

[0045] The cell-free protein expression system of the present invention can be provided in the form of a kit. Each component in the cell-free protein expression system can be included in one or more kits, thereby forming the cell-free protein expression system through one or more kits. Therefore, a kit containing one or more components in the cell-free protein expression system also falls within the scope of protection of the present invention.

[0046] Accordingly, in one aspect, the present invention provides a kit for cell-free protein expression, comprising a nucleic acid encoding a target protein, a cell extract and a supplement system, wherein the supplement system comprises a nucleotide mixture, an amino acid mixture, a buffer, a magnesium salt, a potassium salt, L-glutamate and an oxalate, wherein the kit contains an exogenous enzyme for converting L-glutamate into α-ketoglutarate.

[0047] In another aspect, the present invention provides a kit for cell-free protein expression, comprising a cell extract and a supplement system, wherein the supplement system comprises a nucleotide mixture, an amino acid mixture, a buffer, a magnesium salt, a potassium salt, L-glutamate and oxalate, wherein the kit contains an exogenous enzyme for converting L-glutamate into α-ketoglutarate.

[0048] In yet another aspect, the present invention provides a kit for cell-free protein expression, comprising a cell extract, wherein the cell extract contains an exogenous enzyme that converts L-glutamate into α-ketoglutarate.

[0049] In yet another aspect, the present invention provides a kit for cell-free protein expression, comprising a supplementation system, wherein the supplementation system comprises a nucleotide mixture, an amino acid mixture, a buffer, a magnesium salt, a potassium salt, L-glutamate and oxalate, wherein the supplementation system contains an exogenous enzyme for converting L-glutamate into α-ketoglutarate.

[0050] Cell-free protein expression methods

[0051] On the other hand, the present invention provides a method for expressing a target protein, comprising: in the cell-free protein expression system of any of the above aspects, under conditions suitable for expressing the target protein, mixing a nucleic acid encoding the target protein, a cell extract and a supplement system, thereby expressing the target protein.

[0052] Sequence Listing

[0053]

[0054]

[0055]

[0056] Example

[0057] Example 1: Lysate of exogenous glutamate dehydrogenase overexpressed in bacterial strains can significantly increase the expression yield of GFP protein

[0058] 1. Preparation of Lysate of Exogenous Glutamate Dehydrogenase Overexpression in Bacterial Strains

[0059] (1) Construction of glutamate dehydrogenase expression vector

[0060] Glutamate dehydrogenase is widely present in various animals, plants and microorganisms. In this embodiment, glutamate dehydrogenase gdhA is derived from Escherichia coli, Gene ID: 946802, and the gene sequence is shown in SEQ ID NO: 1. The gene was constructed into the expression vector pET-28a(+) to obtain pET-28a(+)-gdhA, and then it was transferred into the host E. coli BL21(DE3).

[0061] (2) Preparation of lysate from bacterial strains overexpressing exogenous glutamate dehydrogenase

[0062] a. Resuscitate Escherichia coli stored at -80°C, streak on 2YT+P plates, and culture at 37°C for at least 15 hours until a single colony is formed, wherein the 2YT+P plates are composed of: 16 g / L tryptone, 10 g / L yeast extract, 5 g / L sodium chloride, 40 mM dipotassium hydrogen phosphate, 22 mM potassium dihydrogen phosphate, and 1.5% agar.

[0063] b. Pick the monoclonal clone and inoculate it in a sterile culture tube containing 2YT + P liquid medium, and culture it at a constant temperature of 37 ° C at a speed of 220 rpm for 8 hours to obtain bacterial cell A; inoculate the bacterial cell A at a ratio of 1:50 in 50 ml of 2YT + P liquid medium, and culture it at a constant temperature of 37 ° C at a speed of 220 rpm for 8 hours to obtain bacterial cell B;

[0064] c. The bacterial cell B is inoculated into 600 ml of 2YT+P liquid culture medium at a ratio of 1:100, and the culture is carried out at a constant temperature of 37°C and a rotation speed of 220 rpm until the optical density OD600 value is 0.6-1.0, and then induced by adding isopropyl-β-D-thiogalactopyranoside IPTG at a final concentration of 0.5 mM, and the culture is continued for 10 hours at a constant temperature of 25°C and a rotation speed of 200 rpm until the optical density OD600 value is 4.0-8.0; wherein the 2YT+P liquid culture medium is composed of: 16 g / L tryptone, 10 g / L yeast extract, 5 g / L sodium chloride, 40 mM dipotassium hydrogen phosphate, and 22 mM potassium dihydrogen phosphate to obtain a cell culture.

[0065] d. The cell culture was transferred to a centrifuge tube, centrifuged at 5000 g for 5 minutes at a constant temperature of 4°C, and the supernatant was discarded to obtain bacterial cell C; the washing was repeated once, i.e., the bacterial cell C was completely dispersed with a pre-cooled second buffer until no visible block precipitation was observed, and the cell was centrifuged at 5000 g for 5 minutes at a constant temperature of 4°C, and the supernatant was discarded to obtain bacterial cell D; the second buffer was composed of 14 mM magnesium glutamate, 60 mM potassium glutamate, 50 mM tris(hydroxymethyl)aminomethane, 2 mM dithiothreitol, and acetic acid was adjusted to pH 8.2.

[0066] e. Weigh the bacterial cells D, add 1.5 ml of the third buffer to 1 gram of bacterial cells D, fully resuspend, and crush the bacterial cells D under high pressure at 4°C to obtain a lysis solution 1; the third buffer solution is composed of: 14mM magnesium glutamate, 150mM potassium glutamate, 2mM dithiothreitol, and Tris is adjusted to pH 8.2; the obtained lysis solution 1 is centrifuged at a constant temperature of 4°C and a speed of 12000g for 10 minutes, the supernatant is taken and incubated at 37°C for 30 minutes, and then centrifuged at a speed of 12000g for 10 minutes, and the supernatant is taken as the lysis solution L1 overexpressing exogenous glutamate dehydrogenase.

[0067] 2. Cell-free protein expression using lysate L1 overexpressing exogenous glutamate dehydrogenase

[0068] The components of the cell-free expression system are as follows: 10mM phosphate buffer, 1.2mM AMP, 0.85mM UMP, 0.85mM CMP, 0.85mM GMP, 100mM potassium glutamate, 8mM magnesium glutamate, 2.7mM potassium oxalate, amino acid mixture (20 kinds, 2mM each), and 25% by volume of the above-mentioned lysate L1; 20ng / uL of green fluorescent protein plasmid P-F1 was added to the above-mentioned system, and each component was added to a PCR tube, mixed evenly, placed in a ThermoMixer constant temperature mixer, shaken at 30°C and 1000rpm for 16 hours, taken out, diluted 10 times with 1*PBS, and measured the expression amount of fluorescent protein using an enzyme marker under the conditions of excitation light 485nm, emission light 535nm, and exposure time 0.1s.

[0069] like Figure 1 As shown in the figure, the lysate containing exogenous glutamate dehydrogenase overexpression in the strain significantly increased the yield of GFP. The reason is that the overexpressed glutamate dehydrogenase accelerates the process of glutamate generating α-ketoglutarate and NADH, accelerates the tricarboxylic acid cycle and oxidative phosphorylation reaction, provides more energy for CPFS, and then increases the expression yield of GFP.

[0070] Comparative Example 1

[0071] The preparation method of the lysate and the cell-free protein reaction are as described in Example 1, except that the strain used to prepare the lysate is replaced with a common E. coli BL21 (DE3) without exogenous glutamate dehydrogenase. Each component is added to a PCR tube, mixed evenly, placed in a ThermoMixer constant temperature mixer, and shaken at 30°C and 1000 rpm for 16 hours before measuring the expression of the fluorescent protein.

[0072] Example 2: Effect of different glutamate dehydrogenase concentrations on cell-free protein expression

[0073] In the protein synthesis system of Comparative Example 1, glutamate dehydrogenase was added at final concentrations of 0, 15, 30, 75, 120, 135 and 150 U / mL, respectively, and the reaction was carried out at 25°C for 16 hours. The results are as follows: Figure 2 As shown. Figure 2 It can be seen that when the glutamate dehydrogenase is not less than 75 U / mL, its fluorescence intensity is not less than 1000000.

[0074] Example 3: Effects of different thiamine concentrations on cell-free protein expression

[0075] The other steps were the same as those in Example 1. In the protein synthesis system of Example 1, 0, 0.007, 0.035, 0.07 and 0.7 mg / mL of thiamine were added respectively and reacted at 25° C. for 16 hours. The results were as follows: Figure 3 As shown. Figure 3 It can be seen that the best effect is achieved when the thiamine concentration is 0.035 mg / mL, and its fluorescence intensity is no less than 1,000,000 in the range of 0.007-0.7 mg / mL.

[0076] Example 4: Strains that highly express glutamate dehydrogenase support high-level protein expression

[0077] 1. Construction of strains with high expression of glutamate dehydrogenase

[0078] CRISPR-Cas technology was used to integrate gdhA into the SdaB gene site behind the promoter on the chromosome. See the schematic diagram for details. Figure 4 The specific steps are as follows:

[0079] (1) Obtaining the sgRNA expression frame

[0080] Submit the SdaB gene sequence on the sgRNA design website for analysis, search for PAM and protospacer (target), and score each potential target. Select six targets with high specificity and high scores for subsequent experiments. The target sequences are shown in Table 1. The sgRNA was connected to pTargetF by Gibson Assembly, and then the connection product was transformed into DH-5α cells. After overnight culture, single clones were selected for sequencing. After the pTargetF-sgRNA vector was successfully sequenced, the next experiment was carried out.

[0081] Table 1

[0082] name sequence protospacer 1 GTTACGGGCAATCAGATCGT protospacer 2 GCTTAAAGACGTGACCCGCG protospacer 3 CGCGTGGTGGTTGACGTGTA protospacer 4 TCACATCCTGAATAAAACCA protospacer 5 TATGCGCATTACCGCGCTGG protospacer 6 TGGCCAGCAGAATAGCGCAC .

[0083] (2) Construction of donor DNA

[0084] First, we need to construct a sequence with homology to the SdaB gene at both ends and the promoter element and gdhA gene coding region in the middle, such as Figure 5 As shown. Using overlap extension PCR technology, two rounds of PCR were performed to obtain the donor DNA of SdaB. In the first round of PCR, the E. coli BL21 (DE3) genome was used as a template to PCR amplify the left homologous arm L fragment of the SdaB gene, which was about 500 bp in length.

[0085] Using the glutamate dehydrogenase expression vector pET-28a(+)-gdhA constructed in Example 1 as a template, PCR amplification was performed to obtain the gdhA gene expression cassette ::P-gdhA, with a length of about 1600 bp; using the E. coli BL21 (DE3) genome as a template, PCR amplification was performed to obtain the right homologous arm R fragment of the SdaB gene, with a length of about 500 bp; in the second round of PCR, L, ::P-gdhA, and R were used as templates, and overlap extension PCR was performed to obtain a donor DNA with a length of about 2800 bp, and the sequence was SEQ ID NO: 2.

[0086] (3) Genome editing of the gdhA gene expression cassette

[0087] The pCas plasmid was transformed into E. coli BL21 (DE3) competent cell G1, and then cultured at 30°C to prepare competent cell G2. The donor DNA and pTargetF-sgRNA were then transformed into the competent cell G2, spread on an LB plate containing arabinose inducer, cultured at 30°C for 16 hours, and the grown single clones were verified by PCR.

[0088] (4) Elimination of pCas and pTargetF plasmids

[0089] After the gdhA gene expression frame was successfully introduced, IPTG was added to induce the transcription of sgRNA targeting the pTargetF plasmid replicon, guiding the Cas protein to cut the replicon, resulting in the inability of pTargetF to replicate and gradually lose. For the pCas plasmid, its replicon is temperature sensitive. After the strain is cultured at 37°C, its replicon cannot replicate due to high temperature, resulting in the loss of the pCas plasmid. The strain E. coli BL21 (DE3) (:: P-gdhA) that has been cleared of the plasmid was saved and named E2.

[0090] 2. Cell-free protein expression using lysate of strain E2 that highly expresses glutamate dehydrogenase

[0091] The preparation method of the lysate and the cell-free protein reaction refer to Example 1, except that the strain used to prepare the lysate was replaced with E2. Each component was added to a PCR tube, mixed evenly, placed in a ThermoMixer constant temperature mixer, and shaken at 30°C and 1000 rpm for 16 hours before measuring the expression of the fluorescent protein. Figure 6 As shown, the expression level of the fluorescent protein is similar to that in Example 1.

[0092] It should be understood that, although the present invention has been specifically disclosed by preferred embodiments and optional features, those skilled in the art may make modifications, improvements and variations to the present invention disclosed herein, and these modifications, improvements and variations are considered to be within the scope of the present invention. The materials, methods and examples provided herein are representative and exemplary of preferred embodiments, and are not intended to be limiting of the scope of the present invention.

Claims

1. A cell-free protein expression system, comprising a nucleic acid encoding a target protein, a cell extract and a supplement system, wherein the supplement system comprises a nucleotide mixture, an amino acid mixture, a buffer, a magnesium salt, a potassium salt, L-glutamate and an oxalate, wherein the expression system contains an exogenous enzyme that converts L-glutamate into α-ketoglutarate. 2 . The system according to claim 1 , wherein the enzyme that converts L-glutamate into α-ketoglutarate is one or more of glutamate dehydrogenase, amino acid oxidase and glutamate oxidase.

3. The system according to claim 1, wherein the enzyme that converts L-glutamate into α-ketoglutarate is glutamate dehydrogenase.

4. The system according to claim 3, wherein the glutamate dehydrogenase is derived from Escherichia coli, and the gene sequence is SEQ ID NO:

1. 5 . The system according to claim 1 , wherein the concentration of the exogenous enzyme converting L-glutamate into α-ketoglutarate is not less than 75 U / mL.

6. The system according to any one of claims 1 to 4, wherein the exogenous enzyme that converts L-glutamate into α-ketoglutarate comes from: adding the enzyme; transforming the gene encoding the enzyme into the cell serving as the source of the cell extract; and / or knocking the gene encoding the enzyme into the cell serving as the source of the cell extract.

7. The system of claim 1, wherein the expression system further comprises thiamine.

8. The system of claim 7, wherein the concentration of thiamine is 0.007-0.7 mg / mL.

9. A kit for cell-free protein expression, comprising a cell extract and a supplement system, wherein the supplement system comprises a nucleotide mixture, an amino acid mixture, a buffer, a magnesium salt, a potassium salt, L-glutamate and an oxalate, wherein the kit contains an exogenous enzyme that converts L-glutamate into α-ketoglutarate.

10. A method for expressing a target protein, comprising: In the system according to any one of claims 1 to 8, a nucleic acid encoding a target protein, a cell extract and a supplement system are mixed under conditions suitable for expressing the target protein, thereby expressing the target protein.

Images