Beta-glucosidase mutant enzyme MutBglPcC1 for saponin conversion as well as preparation method and application of beta-glucosidase mutant enzyme MutBglPcC1

Abstract

The invention discloses a beta-glucosidase mutant enzyme MutBglPcC1 for saponin conversion as well as a preparation method and application of the beta-glucosidase mutant enzyme MutBglPcC1, and relates to the technical field of gene engineering. The amino acid sequence of the mutant enzyme MutBglPcC1 is as shown in SEQ ID NO. 1, and the nucleotide sequence for coding the mutant enzyme is as shown in SEQ ID NO. 2. According to the present invention, the 485 site phenylalanine of wild beta-glucosidase BglPcC1 is mutated into alanine, such that the mutant enzyme MutBglPcC1 is obtained, the optimum temperature of the mutant enzyme MutBglPcC1 is 37 DEG C, and the optimum pH value of the mutant enzyme MutBglPcC1 is 5.0; compared with a wild enzyme BglPcC1, the mutant enzyme MutBglPcC1 has the advantages that the conversion capacity on ginsenosides Rc, Rd and Rg1 and notoginsenoside R1 is enhanced, various rare saponins such as MC, CK, APPD, Rg3, Rh1 and R2 are generated, and the mutant enzyme MutBglPcC1 can be applied to health care and medical industries.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a beta-glucosidase mutant enzyme MutBglPcC1 for saponin conversion, and a preparation method and application thereof. Background Art

[0002] Ginsenosides and notoginseng saponins are the main substances that exert pharmacological activities in many traditional Chinese medicines. Saponins can be divided into high-content saponins and rare saponins. Rb1, Rb2, Rc, Rd, Rg1, Re and R1 are high-content saponins in ginseng and notoginseng, and rare ginseng and notoginseng saponins include Rg3, Rh1, Rh2, Rh3, RT3, F1, F2, CK, APPD, APPT, R2, etc. After high-content saponins enter the body, they will be gradually desugared and converted into rare saponins in the intestine. These rare saponins have multiple pharmacological activities and stronger biological activities (YOSHIMASA Y et al. European Journal of Pharmacology, 1996, 312 (2): 149-151.).

[0003] The rare ginsenoside Rg3 has multi-target and multi-pathway pharmacological activities including anti-tumor, anti-inflammatory, antiviral and neuroprotective, and has almost no cytotoxicity, less toxicity and lower drug resistance than chemical drugs (Yang Yu et al. Chinese Journal of Clinical Pharmacology, 2019(05):497-500.). The first Chinese herbal monomer anticancer drug to achieve industrialized production of ginsenosides in my country, the anticancer drug "Shenyi Capsule" approved by the state for marketing, has Rg3 as its main ingredient. Ginsenoside Rh1 has potent properties such as anti-inflammatory, antioxidant, immunomodulatory effects and positive effects on the nervous system (Dao Ngoc Hien Tam et al. PlantaMed 2018; 84(03):139-152). With the in-depth study of ginsenoside Compound k (CK), it was found that it has good anti-tumor effects on various tumors such as lung cancer, liver cancer, and breast cancer. Ginsenoside CK can induce apoptosis and cell cycle arrest of tumor cells by regulating multiple signaling pathways such as AMPK / mTOR, PI3K / Akt, and regulate cell autophagy flux and inhibit tumor metastasis (Chen Yinchen et al. World Science and Technology-Modernization of Traditional Chinese Medicine, 2023, 25(7): 2586-2595.). APPD also has significant anti-tumor activity (Yang, L. et al. Cell Death Dis 10, 630 (2019).). The anti-tumor effects of these rare saponins have been studied in depth. The mechanism of action not only includes direct inhibition of tumor cell proliferation, invasion and metastasis, induction of tumor cell apoptosis and cycle arrest, and inhibition of tumor angiogenesis, but also can regulate the body's immune function and indirectly achieve anti-tumor effects. In addition, the combination of saponins and chemotherapy drugs can not only reverse tumor multidrug resistance, but also ultimately achieve the goal of increasing efficacy and reducing toxicity (Li Mingying et al. Chinese Herbal Medicine, 2024, 55(2): 688-696). At present, there is a view that the combination and synergistic application of multiple saponins is a potential treatment for diseases. It may be difficult for a single ginsenoside to achieve the best therapeutic effect because different ginsenosides may have different mechanisms of action and targets. In order to improve the therapeutic effect, the combined and synergistic application of multiple ginsenosides may be a more effective treatment strategy (Zhao Z. et al. Journal of Agricultural and Food Chemistry, 2024.).

[0004] Rare saponins have a wide range of effects, and more and more studies have shown their significant effectiveness in curing various diseases. However, rare saponins are very rare in plants and are difficult to obtain. For example, ginsenoside Rh1 is only 0.0015% in the original medicinal plant white ginseng and only 0.01% in Panax notoginseng. Compared with similar high-content saponins, rare saponins have the same sapogenin structure, but the number of sugar groups is different. Therefore, rare ginsenosides can be produced by deglycosylation of high-content saponins. β-Glucosidase (EC 3.2.1.21) is a class of enzymes that can remove non-reducing terminal glucose residues of substrates. It mainly acts on β-1,4 glycosidic bonds, and can also act on β-1,2 bonds, β-1,3 bonds and β-1,6 bonds (Ketudat Cairns JR et al. Cell Mol Life Sci. 2010 Oct; 67(20): 3389-405.). Most of the intestinal β-glucosidases that convert large amounts of ginsenosides come from the GH1 and GH3 families (Mingjun Li et al. Food Bioscience, Volume 58, 2024, 103829).

[0005] The GH3 family β-glucosidase BglPcC1 sequence mined from the human fecal metagenome can hydrolyze the glucose group of saponins and then transform them into other ginsenosides. β-glucosidase BglPcC1 can convert ginsenoside Rb1 into ginsenoside Rd and a trace amount of Rg3, convert ginsenoside Gyp17 into ginsenoside CK, and convert ginsenoside F2 into ginsenoside CK (Zhou Junpei et al. Salt-tolerant and alcohol-tolerant β-glucosidase and its application in transforming ginsenosides: Yunnan Province, CN116410959B[P].2024-05-14), and the types of rare saponins produced by the transformation are limited. Summary of the invention

[0006] The purpose of the present invention is to provide a β-glucosidase mutant enzyme MutBglPcC1 for saponin conversion. Compared with the wild enzyme BglPcC1, the mutant enzyme has enhanced the ability to convert high-content saponins into rare saponins, can prepare more types of rare saponins with different effects, and can be applied to health care and medical industries.

[0007] In order to achieve the above object, the present invention provides a β-glucosidase mutant enzyme MutBglPcC1 for saponin conversion, and the amino acid sequence of the mutant enzyme MutBglPcC1 is shown in SEQ ID NO. 1. The mutant enzyme can be applied to the conversion of ginseng and notoginseng saponins, including any one of the following;

[0008] 1) Convert ginsenoside Rd into ginsenoside Rg3, CK, and APPD;

[0009] 2) Convert ginsenoside Rc into ginsenoside CK and Mc;

[0010] 3) Ginsenoside Rg1 is converted into ginsenoside Rh1;

[0011] 4) Convert notoginsenoside R1 into notoginsenoside R2.

[0012] The present invention also provides a coding gene for the mutant enzyme MutBglPcC1, and the nucleotide sequence thereof is shown in SEQ ID NO.2.

[0013] The present invention also provides a recombinant plasmid comprising the above encoding gene, wherein the vector of the recombinant plasmid is preferably selected from pET series vectors, and more preferably selected from pET-28a(+).

[0014] The present invention also provides a recombinant bacterium comprising the above encoding gene, wherein the recombinant bacterium is selected from Escherichia coli, more preferably from Escherichia coli BL21 (DE3).

[0015] The present invention also provides a method for preparing the mutant enzyme MutBglPcC1, which is specifically obtained by culturing and purifying the above-mentioned recombinant expression bacteria.

[0016] The present invention has the following advantages:

[0017] The present invention obtains a new β-glucosidase mutant enzyme by performing base optimization and site mutation on wild β-glucosidase. Compared with the wild β-glucosidase, the enzyme has the ability to convert high-content saponins into rare saponins, can prepare more types of rare saponins with different effects, including the generation of Rh1, Rg3, CK, APPD, MC and other rare ginsenosides, has application value in the conversion and preparation of saponins, and the rare saponins obtained by conversion can be applied to the industries of medicine, health care products and the like, and has significant application prospects and economic benefits. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The SDS-PAGE analysis results of the wild enzyme BglPcC1 and the mutant enzyme MutBglPcC1 provided by the present invention.

[0019] Figure 2 The present invention provides the relative activities of the wild enzyme BglPcC1 and the mutant enzyme MutBglPcC1 at different pH values.

[0020] Figure 3 The present invention provides the relative activities of the wild enzyme BglPcC1 and the mutant enzyme MutBglPcC1 at different temperatures.

[0021] Figure 4These are the HPLC analysis results of the hydrolysis of ginsenoside Rb1 by the wild enzyme BglPcC1 and the mutant enzyme MutBglPcC1.

[0022] Figure 5 These are the HPLC analysis results of the hydrolysis of ginsenoside Rd by the wild enzyme BglPcC1 and the mutant enzyme MutBglPcC1.

[0023] Figure 6 These are the HPLC analysis results of the hydrolysis of ginsenoside F2 by the wild enzyme BglPcC1 and the mutant enzyme MutBglPcC1.

[0024] Figure 7 These are the HPLC analysis results of the hydrolysis of notoginseng saponin R1 by wild enzyme BglPcC1 and mutant enzyme MutBglPcC1.

[0025] Figure 8 These are the HPLC analysis results of the hydrolysis of ginsenoside Rg1 by the wild enzyme BglPcC1 and the mutant enzyme MutBglPcC1.

[0026] Fig. 9 These are the HPLC analysis results of the hydrolysis of ginsenoside Rc by the wild enzyme BglPcC1 and the mutant enzyme MutBglPcC1. DETAILED DESCRIPTION

[0027] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0028] Some experimental materials and reagents used in this invention:

[0029] 1) Strains and vectors: Strains and vectors: Escherichia coli BL21 (DE3) was purchased from Yisheng Biotechnology Co., Ltd., and the pET-28a (+) expression vector was from Jiangsu Suzhou Hongxun Biotechnology Co., Ltd.

[0030] 2) Enzymes and other biochemical reagents: Plasmid extraction kit was purchased from Omega, kanamycin sulfate (Kan) was purchased from Solario, QuickMutation TM gene site-directed mutagenesis kit was purchased from Beyotime Biotechnology, DNAMarker was purchased from Takara Biotechnology, nucleic acid dye was purchased from Takara, IPTG was purchased from Solebow Technology Co., Ltd., p-nitrophenyl-β-D-pyranoglucopyranoside (pNPG), and functional substrates ginsenoside Rb1, ginsenoside Rd, ginsenoside F2, ginsenoside CK, ginsenoside Rg1, ginsenoside Rh1, ginsenoside Rc, notoginsenoside R1, etc. were all purchased from Shanghai Yuanye Biotechnology Co., Ltd., and the rest were domestic reagents (all of which can be purchased from ordinary biochemical reagent companies).

[0031] 3) Culture medium: LB culture medium: Peptone 10g, Yeast extract 5g. NaCl 10 g, add distilled water to 1000mL, pH natural (about 7). Solid culture medium plus 2.0% (w / v) agar.

[0032] Note: The molecular biology experimental methods not specifically described in the following examples are all carried out with reference to the specific methods listed in the book Molecular Cloning Experiment Guide (3rd Edition) by J. Sambrook, or according to the kits and product instructions.

[0033] Experimental Example 1 Construction and transformation of wild enzyme BglPcC1 expression vector

[0034] 1) The wild enzyme BglPcC1 was mined and screened from the human fecal metagenome (Zhou Junpei, Zhang Rui, Huang Zunxi, Zhu Hongrong, Tang Xianghua, Wu Qian, Cheng Yunxiu, Gao Yanxiu, Salt-tolerant and alcohol-tolerant β-glucosidase and its application in the transformation of ginsenosides, patent number: ZL202310198967.4), whose amino acid sequence is shown in SEQ ID NO.3, and its encoding gene bglPcC1 is shown in SEQ ID NO.4.

[0035] 2) Remove the sequence encoding the signal peptide (the first 21 amino acid sequences of SEQ ID NO.3) in the coding gene bglPcC1 and add the start codon ATG at the starting end. Suzhou Hongxun Biotechnology Co., Ltd. was commissioned to optimize the codons, GC content and other genes of the sequence encoding the mature peptide of bglPcC1 to obtain the sequence bglPcC1-opt, as shown in SEQ ID NO.5. The (G+C)% content of bglPcC1-opt increased from 46% to 53%. Suzhou Hongxun Biotechnology Co., Ltd. was commissioned to obtain bglPcC1-opt through gene synthesis. At the same time, in order to avoid the vector sequence on the vector pET-28a(+) affecting the activity of β-glucosidase BglPcC1 as much as possible, pET-28a(+) was appropriately modified. The modification of the vector pET-28a(+) was completed by Jiangsu Suzhou Hongxun Biotechnology Co., Ltd., and the NcoI site in pET-28a(+) was transformed into a HindIII site by mutation.

[0036] 3) Restriction enzyme sites HindIII (5'AAGCTT 3') and XhoⅠ (5'CTCGAG 3') were introduced into the 5' and 3' ends of bglPcC1-opt by PCR, respectively, to obtain the sequence nxbglPcC1-opt, whose nucleotide sequence is shown in SEQ ID NO.6. The above product and the modified expression vector pET-28a(+) were digested with restriction enzymes, and the digestion products of nxbglPcC1-opt and the modified pET-28a(+) were connected by ligase. After identification, the recombinant plasmid nxbglPcC1-opt-pET-28a(+) containing nxbglPcC1-opt was obtained.

[0037] 4) The recombinant plasmid nxbglPcC1-opt-pET-28a(+) was transformed into Escherichia coli BL21(DE3) by heat shock to obtain the recombinant bacteria BL21(DE3) / bglPcC1 containing bglPcC1.

[0038] Experimental Example 2 Construction and transformation of mutant enzyme MutBglPcC1 expression vector

[0039] 1) The recombinant strain containing the recombinant plasmid nxbglPcC1-opt-pET-28a(+) obtained in Experimental Example 1 was inoculated into LB medium (containing 50 μg / mL kanamycin) at a concentration of 0.1%, cultured overnight at 37°C, and the plasmid was extracted using a kit.

[0040] 2) Using the recombinant plasmid nxbglPcC1-opt-pET-28a(+) as a template, two mutant primers (F1 and R1) were designed using SnapGene software (www.snapgene.com) DMAMAN and CE Design (V1.04) software. The specific sequences are shown below. After the design was completed, the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd. The mutant primers can mutate the phenylalanine at position 485 of the wild β-glucosidase BglPcC1 to alanine.

[0041] As shown below (5'→3'):

[0042] F1 (SEQ ID NO.7):

[0043] ATCTTGCGATCCAGAGCCTCGCCGCTGCTTTT

[0044] R1 (SEQ ID NO.8):

[0045] GCTCTGGATCGCAAGATTAGCGATAGCTTTAA.

[0046] 3) Using the recombinant plasmid nxbglPcC1-opt-pET-28a(+) as a template and F1 and R1 as primers, the QuickMutationTM gene site-directed mutagenesis kit was used for mutation. The PCR reaction parameters were: 95°C pre-denaturation for 30 min; then 95°C denaturation for 30 sec, 60°C annealing for 30 sec, 68°C extension for 8 min, 20 cycles; 4°C incubation for 30 min. PCR amplification obtained a linearized recombinant plasmid mutbglPcC1-pET-28a(+) containing the coding gene mutbglPcC1 with a nucleotide sequence as shown in SEQ ID NO.2. The coding gene encodes a mutant enzyme MutBglPcC1, whose amino acid sequence is shown in SEQ ID NO.1. mutbglPcC1 and mutbglPcC1-pET-28a(+) can also be obtained by gene synthesis. The PCR product was digested with Dpn1 enzyme at 37°C for 3h.

[0047] 4) The digestion product was transformed into Escherichia coli BL21(DE3) by heat shock to obtain the recombinant strain BL21(DE3) / mutbglPcC1 containing the MutBglPcC1 encoding gene mutbglPcC1.

[0048] Experimental Example 3 Preparation of wild enzyme BglPcC1 and mutant enzyme MutBglPcC1

[0049] 1) The recombinant bacteria containing the wild enzyme BglPcC1 and mutant enzyme MutBglPcC1 encoding genes were inoculated into 5 mL of liquid Kan-LB (LB containing kanamycin resistance) medium at an inoculum size of 1‰ (v / v), and cultured overnight at 37°C and 180 rpm to activate the strains.

[0050] 2) The activated bacterial solution in 1) was inoculated into fresh LB (containing 50 μg / mL kanamycin) culture medium at a 1% inoculum volume, and cultured in a shaking incubator at 37°C and 180 rpm / min for about 2-3 h (OD 600 After reaching 0.6-1.0), IPTG with a final concentration of 0.7 mM was added for induction, and shaking culture was continued in a shaker at 20°C and 160 rpm / min for about 20 h to induce the production of recombinant protein.

[0051] 3) Centrifuge at 4°C and 6000rpm / min for 10min to collect the cells. Suspend the cells with an appropriate amount of pH=7.0 McIlvaine buffer and then disrupt the cells by ultrasonic wave in a low-temperature water bath. Centrifuge the above intracellular concentrated crude enzyme solution at 12000rpm / min for 10min to obtain the supernatant. Repeat this process three times. Use Nickel-NTAAgarose and 0-500mM imidazole for affinity and purification of the target protein respectively. The SDS-PAGE results of the purified protein are as follows Figure 1 As shown, Figure 1 a in the figure is the electrophoresis result of wild enzyme. Figure 1 The electrophoresis results of the mutant enzyme are shown in Figure b, where M is a protein marker, lane 1 in Figure a is a cell lysis sample without induction, lane 2 is a cell lysis sample after IPTG induction, and lane 3 is the purified wild enzyme BglPcC1; lane 1 in Figure b is the purified mutant enzyme MutBglPcC1. The results show that both the wild enzyme BglPcC1 and the mutant enzyme MutBglPcC1 have been purified, and the product is a single band.

[0052] 4) The purified wild enzyme BglPcC1 and mutant enzyme MutBglPcC1 obtained in 3) were placed in dialysis bags respectively, and dialyzed with a dialysis solution (pH=7.0 McIlvaine buffer) 100 times the volume of the sample. The dialysis was performed at 4°C, and the dialysis solution was replaced every 2 hours for 2 times.

[0053] Experimental Example 4 Determination of the Enzyme Activity of Wild Enzyme BglPcC1 and Mutant Enzyme MutBglPcC1

[0054] 1) Activity analysis of purified wild-type BglPcC1 and mutant MutBglPcC1

[0055] The activity determination method adopts the PNP method, and p-nitrophenyl-β-D-pyranoglucoside (pNPG) is used as the substrate to determine the activity of the purified wild enzyme BglPcC1 and the mutant enzyme MutBglPcC1. The substrate (pNPG) is dissolved in a buffer solution to a final concentration of 5mM; the reaction system contains 10μL of enzyme solution (the concentration of the enzyme solution is 0.1mg / mL) and 290μL of substrate buffer solution; the substrate is preheated at the reaction temperature for 5min, and then the enzyme solution is added to react for 10min, and then 300μL of 1M Na2CO3 is added to terminate the reaction, and the OD value is measured at a wavelength of 410nm after cooling to room temperature; 1 enzyme activity unit (U) is defined as the amount of enzyme required to decompose the substrate to produce 1μmol pNP per minute under given conditions.

[0056] 2) Determination of the optimal pH of purified wild-type enzyme BglPcC1 and mutant enzyme MutBglPcC1

[0057] The enzyme purified in Experimental Example 3 was placed in a pH=3.0-9.0 McIlvaine buffer, and the enzymatic reaction was carried out at 37° C. to measure the enzyme activities of the purified wild enzyme BglPcC1 and the mutant enzyme MutBglPcC1.

[0058] The relative activity results of wild enzyme BglPcC1 and mutant enzyme MutBglPcC1 at different pH values ​​are as follows Figure 2 As shown, Figure 2 a in the figure is the result of the wild enzyme, and b is the result of the mutant enzyme. The results show that the optimum pH of the wild enzyme BglPcC1 is 5.0, and the enzyme activity is maintained at more than 60% in the range of pH = 4.0-6.0; the optimum pH of the mutant enzyme MutBglPcC1 is 5, and the enzyme activity is maintained at more than 70% in the range of pH = 4.5-5.5, and the enzyme activity is low at other pH values.

[0059] 3) Thermal activity determination of purified wild-type enzyme BglPcC1 and mutant enzyme MutBglPcC1

[0060] The enzymatic reaction was carried out in a buffer solution at pH 5.0 at 0-60° C. pNPX was used as a substrate, the reaction lasted for 10 min, and the enzyme activities of the purified wild enzyme BglPcC1 and the mutant enzyme MutBglPcC1 were determined.

[0061] The relative activities of wild enzyme BglPcC1 and mutant enzyme MutBglPcC1 at different temperatures were obtained as follows Figure 3 The results showed that the optimum temperature of BglPcC1 was 45°C, and 60% of the enzyme activity could be maintained at 40°C. The optimum temperature of the mutant enzyme MutBglPcC1 was 37°C, and 80% of the enzyme activity could be maintained at 35-40°C.

[0062] Experimental Example 5 Determination of the conversion effect of wild enzyme BglPcC1 and mutant enzyme MutBglPcC1 on hydrolysis of ginseng and notoginseng saponins

[0063] 1) Saponin reaction system:

[0064] Ginsenoside Rb1, ginsenoside Rg1, ginsenoside Rc, and Panax notoginseng saponin R1 were dissolved in a pH = 5.0 citric acid-sodium hydrogen phosphate buffer to a concentration of 2 mg / mL for use as substrates, and ginsenoside Rd and ginsenoside F2 were dissolved in 20% ethanol (diluted with pH = 5.0 citric acid-sodium hydrogen phosphate buffer) to a concentration of 2 mg / mL for use as substrates. Experimental group: wild enzyme BglPcC1, mutant enzyme MutBglPcC1, and various Panax notoginseng and ginsenosides were added to the reaction tubes respectively, so that the final concentration of the enzyme solution was 0.1 mg / mL, and the final concentration of ginsenosides was 1 mg / mL. Control group: The final concentration of ginsenoside Rb1, ginsenoside Rc, ginsenoside Rg1, notoginsenoside R1, ginsenoside Rd, and ginsenoside F2 was 1 mg / mL, and citric acid-disodium hydrogen phosphate buffer with pH = 5.0 was added instead of the enzyme solution, and the cells were incubated in a shaking incubator at 30°C and 160 rpm.

[0065] 2) Sample extraction

[0066] The enzymatic hydrolysis reaction was terminated with saturated n-butanol aqueous solution at different time periods (0 to 24 h), ultrasonicated for 15 min, allowed to stand for 30 min, and the supernatant n-butanol layer was taken. This process was repeated 3 times, the n-butanol in the sample was removed by rotary evaporation, and the sample was re-dissolved with 2 mL of methanol.

[0067] 3) High performance liquid chromatography (HPLC) detection

[0068] The instrument is Shimadzu liquid chromatograph-mass spectrometer LCMS-2020; chromatographic column RSZG-C18 Plus, 5μm, 4.6×250mm; detection wavelength 203nm, injection volume 10μL, column temperature 35℃, flow rate 1.0mL / min.

[0069] Add about 1 mL of the experimental sample reconstituted with methanol to the sample bottle. The sample detector is a light-emitting diode array detector, the column is Yuexu PG-C18 (4.6mm*5.0um*250mm), the column oven temperature is 40°C, the flow rate is 1mL / min, the mobile phase is A: acetonitrile; B: water, gradient elution, the detection wavelength is 203nm, the elution time is 100min, and 10μL is injected each time.

[0070] The HPLC analysis results of Panax notoginseng and ginsenoside standards and enzymatic hydrolysis saponin conversion results were obtained as follows: Figure 4-9 shown. Figure 4The HPLC analysis results of wild enzyme BglPcC1 and mutant enzyme MutBglPcC1 hydrolyzing ginsenoside Rb1; Figure 4 a and c in the figure are the analysis results of different batches of ginsenoside Rb1 standard (recorded as Rb1-control). Figure 4 b in the figure is the HPLC analysis result of the wild enzyme BglPcC1 hydrolyzing ginsenoside Rb1 for 24h (denoted as Rb1-BglPcC1). Figure 4 The d in the figure is the HPLC analysis result of the mutant enzyme MutBglPcC1 hydrolyzing ginsenoside Rb1 for 24 h (denoted as Rb1-MutBglPcC1). Figure 5 The HPLC analysis results of the wild enzyme BglPcC1 and the mutant enzyme MutBglPcC1 hydrolyzing ginsenoside Rd; Figure 5 a and c in the figure are the analysis results of different batches of Rd-control for ginsenoside Rd standard (referred to as Rd-control). Figure 5 b in the figure is the HPLC analysis result of the wild enzyme BglPcC1 hydrolyzing ginsenoside Rd for 24h (denoted as Rd-BglPcC1). Figure 5 The d in the figure is the HPLC analysis result of the mutant enzyme MutBglPcC1 hydrolyzing ginsenoside Rd24h (denoted as Rd-MutBglPcC1). Figure 6 The HPLC analysis results of the wild enzyme BglPcC1 and the mutant enzyme MutBglPcC1 hydrolyzing ginsenoside F2; Figure 6 a and c in the figure are the analysis results of different batches of ginsenoside F2 standard (denoted as F 2 - control), Figure 6 b in the figure is the HPLC analysis result of the wild enzyme BglPcC1 hydrolyzing ginsenoside F2 for 24 h (denoted as F2-BglPcC1). Figure 6 The d in the figure is the HPLC analysis result of hydrolyzing ginsenoside F2 for 24 h by the mutant enzyme MutBglPcC1 (denoted as F2-MutBglPcC1). Figure 7 The HPLC analysis results of the wild enzyme BglPcC1 and the mutant enzyme MutBglPcC1 hydrolyzing notoginseng saponin R1; wherein, Figure 7 a and c in the figure are the analysis results of different batches of notoginseng saponin R1 standard (referred to as R1-control). Figure 7 b in the figure is the HPLC analysis result of wild enzyme BglPcC1 hydrolyzing notoginsenoside R1 for 24 h (denoted as R1-BglPcC1). Figure 7 The d in the figure is the HPLC analysis result of hydrolyzing notoginsenoside R124 h by the mutant enzyme MutBglPcC1 (denoted as R1-MutBglPcC1). Figure 8The HPLC analysis results of the wild enzyme BglPcC1 and the mutant enzyme MutBglPcC1 hydrolyzing ginsenoside Rg1; Figure 8 a and c in the figure are the analysis results of different batches of ginsenoside Rg1 standard (recorded as Rg1-control). Figure 8 b in the figure is the HPLC analysis result of the wild enzyme BglPcC1 hydrolyzing ginsenoside Rg1 for 24 h (denoted as Rg1-BglPcC1). Figure 8 The d in the figure is the HPLC analysis result of the mutant enzyme MutBglPcC1 hydrolyzing ginsenoside Rg1 for 24h (denoted as Rg1-MutBglPcC1). Fig. 9 The HPLC analysis results of the wild enzyme BglPcC1 and the mutant enzyme MutBglPcC1 hydrolyzing ginsenoside Rc; Fig. 9 a and c in the figure are the analysis results of different batches of ginsenoside Rc standard (referred to as Rc-control). Fig. 9 b in the figure is the HPLC analysis result of the wild enzyme BglPcC1 hydrolyzing ginsenoside Rc for 24h (denoted as Rc-BglPcC1). Fig. 9 The d in the figure is the HPLC analysis result of the mutant enzyme MutBglPcC1 hydrolyzing ginsenoside Rc for 24 hours (denoted as Rc-MutBglPcC1).

[0071] The results showed that: when ginsenoside Rb1 was used as substrate, the wild enzyme BglPcC1 converted ginsenoside Rb1 to ginsenoside Rd and negligible Rg3, with a conversion rate of 100%; the mutant enzyme MutBglPcC1 converted ginsenoside Rb1 to ginsenoside Rd and ginsenoside Rg3, with a molar ratio of 6.1:1, and the conversion rate of the mutant enzyme MutBglPcC1 to ginsenoside Rb1 was 100%, see Figure 4 .

[0072] The wild enzyme BglPcC1 converted ginsenoside Rd to produce a negligible amount of Rg3, with a conversion rate of 0.128%. The mutant enzyme MutBglPcC1 converted ginsenoside Rd to produce Rg3, CK and APPD, with a molar ratio of 10.8:1.7:1. The conversion rate of MutBglPcC1 to ginsenoside Rd was 30.98%, see Figure 5 .

[0073] The wild enzyme BglPcC1 converted ginsenoside F2 to ginsenoside CK with a conversion rate of 100%. The mutant enzyme MutBglPcC1 converted ginsenoside F2 to ginsenoside CK and APPD with a molar ratio of 18.8:1. The conversion rate of the mutant enzyme MutBglPcC1 to ginsenoside F2 was 100%, see Figure 6 .

[0074] The wild enzyme BglPcC1 converted notoginsenoside R1 to generate a negligible amount of notoginsenoside R2, with a conversion rate of 7.6%; the mutant enzyme MutBglPcC1 converted notoginsenoside R1 to notoginsenoside R2, and the conversion rate of MutBglPcC1 to notoginsenoside R1 was 24%, see Figure 7 .

[0075] The wild enzyme BglPcC1 converts ginsenoside Rg1 to produce a negligible amount of ginsenoside Rh1, with a conversion rate of 2.5%; the mutant enzyme MutBglPcC1 converts ginsenoside Rg1 to Rh1, and the conversion rate of MutBglPcC1 to ginsenoside Rg1 is 35.3%, see Figure 8 .

[0076] Wild enzyme BglPcC1 cannot transform ginsenoside Rc; mutant enzyme MutBglPcC1 transforms ginsenoside Rc to generate ginsenosides Mc and CK, with a molar ratio of 89.8:1. The conversion rate of mutant enzyme MutBglPcC1 to ginsenoside Rc is 47.58%, see Fig. 9 .

[0077] In summary, the present invention uses genetic engineering technology to site-directedly mutate the amino acid site Phe485 of the wild enzyme BglPcC1 to obtain the mutant enzyme MutBglPcC1. Compared with the wild enzyme, the mutant enzyme MutBglPcC1 enhances the ability to convert high-content saponins into rare saponins, and can prepare more types of rare saponins with different effects. Specifically, MutBglPcC1 enhances the conversion ability of ginsenosides Rd, Rg1, Rc and notoginseng saponin R1, generating a variety of rare ginsenosides such as Rh1, Rg3, CK, APPD, and MC. The mutant enzyme MutBglPcC1 of the β-glucosidase BglPcC1 provided by the present invention has significant application prospects and economic benefits in the pharmaceutical, health care products and other industries.

[0078] Although the content of the present invention has been described in detail through the above preferred embodiments, it should be appreciated that the above description should not be considered as a limitation of the present invention. After reading the above content, it will be apparent to those skilled in the art that various modifications and substitutions of the present invention will occur. Therefore, the protection scope of the present invention should be limited by the appended claims.

Claims

1. A β-glucosidase mutant enzyme MutBglPcC1 for saponin conversion, characterized in that The amino acid sequence of the mutant enzyme MutBglPcC1 is shown in SEQ ID NO.

1.

2. The gene encoding the mutant enzyme MutBglPcC1 according to claim 1, characterized in that The nucleotide sequence of the coding gene is shown in SEQ ID NO.

2.

3. A recombinant plasmid comprising the coding gene as claimed in claim 2.

4. The recombinant plasmid according to claim 3, characterized in that The vector of the recombinant plasmid is selected from pET-28a(+).

5. A recombinant expression bacterium comprising the coding gene as claimed in claim 2.

6. The recombinant expression bacteria according to claim 5, characterized in that: The recombinant expression bacteria are selected from BL21 (DE3).

7. Use of the mutant enzyme MutBglPcC1 as claimed in claim 1 in saponin conversion.

8. The use according to claim 7, characterized in that: The application includes any of the following: 1) Convert ginsenoside Rd into ginsenoside Rg3, CK, and APPD; 2) Convert ginsenoside Rc into ginsenoside CK and Mc; 3) Ginsenoside Rg1 is converted into ginsenoside Rh1; 4) Convert notoginsenoside R1 into notoginsenoside R2.

9. The method for preparing the mutant enzyme MutBglPcC1 according to claim 1, characterized in that: The method is obtained by culturing and purifying the recombinant expression bacteria according to claim 5 or 6.

Images