Application of CsAOS1-2 gene in promoting synthesis of citrus monoterpene component

Abstract

The invention relates to the technical field of gene engineering, in particular to application of a CsAOS1-2 gene in promoting synthesis of citrus monoterpene components. The invention provides application of a CsAOS1-2 gene in regulation and control of synthesis of citrus monoterpene components. The amino acid sequence of protein coded by the CsAOS1-2 gene is shown as SEQ ID NO: 1. An over-expression vector containing the gene CsAOS1-2 is transformed into citrus fruits for transient expression, and results show that the expression quantity of the gene CsAOS1-2 in the citrus peel subjected to transient transformation is increased by about 6 times, the expression level of upstream key enzyme genes of a monoterpene synthesis pathway is obviously higher than that of a control group, and the linalool content in the peel is increased by nearly 2 times compared with that of the control group; the monoterpene content in transgenic citrus leaves is also remarkably increased. The CsAOS1-2 gene plays an important role in promoting the synthesis of the citrus monoterpene, and can be used for regulating and controlling the aroma traits of citrus fruits.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to the application of CsAOS1-2 gene in promoting the synthesis of citrus monoterpene components. Background Art

[0002] The aroma and flavor of citrus are the main characteristics of fruit quality, which mainly come from the volatile components in the fruit. The volatile substances in the fruit are mainly monoterpenes, sesquiterpenes and their derivatives. Among them, the monoterpene component linalool has the aroma of lily of the valley, woody green aroma and fruity aroma. It is often used in the synthesis of flavors and spices. It has a strong ability to cover up bad odors and is also one of the main aroma substances in many rose-scented fruits. At present, the exploration of aroma regulatory genes in citrus is still relatively lacking. With the development of modern molecular design breeding technology, fully exploring and utilizing functional genes has become an important development direction of modern breeding of citrus aroma quality. The exploration and utilization of citrus aroma regulatory genes has become an urgent need for the genetic improvement of citrus quality traits and the efficient breeding of high-quality citrus varieties. Summary of the invention

[0003] In order to solve the above problems, the present invention provides the use of CsAOS1-2 gene in promoting the synthesis of citrus monoterpene components. The present invention discovered the CsAOS1-2 gene that promotes the synthesis of monoterpene components in citrus. By increasing the expression level of the CsAOS1-2 gene, the synthesis of citrus monoterpene components can be promoted, which is of great significance to the improvement of citrus aroma.

[0004] In order to achieve the above object, the present invention provides the following technical solutions:

[0005] The present invention provides an application of the CsAOS1-2 gene in regulating the synthesis of citrus monoterpene components. The amino acid sequence of the protein encoded by the CsAOS1-2 gene is shown in SEQ ID NO: 1.

[0006] Preferably, the regulation includes: increasing the expression level of the CsAOS1-2 gene to promote the synthesis of citrus monoterpene components.

[0007] Preferably, the regulation is: increasing the expression level of the CsAOS1-2 gene to promote the expression of genes encoding key enzymes upstream of the monoterpene synthesis pathway, thereby promoting the synthesis of citrus monoterpene components.

[0008] Preferably, the upstream key enzymes of the monoterpene synthesis pathway include: one or more of deoxyxylulose-5-phosphate synthase, deoxyxylulose phosphate reductoisomerase and terpene synthase.

[0009] Preferably, the deoxyxylulose-5-phosphate synthase includes deoxyxylulose-5-phosphate synthase 1 and / or deoxyxylulose-5-phosphate synthase 2.

[0010] Preferably, the monoterpene component is linalool.

[0011] Preferably, the biological material for increasing the expression level of the CsAOS1-2 gene comprises: one or more of an expression cassette, an expression vector and a recombinant bacterium containing the coding sequence of the CsAOS1-2 gene.

[0012] The present invention provides a biological material for promoting the synthesis of citrus monoterpene components. The biological material comprises: one or more of an expression cassette, an expression vector and a recombinant bacterium containing a CsAOS1-2 gene coding sequence. The amino acid sequence of the protein encoded by the CsAOS1-2 gene is shown in SEQ ID NO: 1.

[0013] The present invention provides the use of the biological material described in the above technical solution in promoting the synthesis of citrus monoterpene components and / or citrus breeding.

[0014] Preferably, the citrus breeding includes: cultivating transgenic citrus varieties with increased monoterpene components.

[0015] Beneficial effects:

[0016] The present invention provides an application of CsAOS1-2 gene in regulating the synthesis of citrus monoterpene components, and the amino acid sequence of the protein encoded by the CsAOS1-2 gene is shown in SEQ ID NO: 1. The present invention discovered the CsAOS1-2 gene that promotes the synthesis of monoterpene in citrus, and transformed the overexpression vector containing the CsAOS1-2 gene into citrus fruit for transient expression. As a result, it was found that the expression of CsAOS1-2 gene in the transiently transformed citrus peel was upregulated by about 6 times, and the expression level of key enzyme genes (CsDXS1, CsDXS2, CsDXR and CsTPS) in the upstream of the monoterpene synthesis pathway was significantly higher than that of the control, and the linalool content in the peel increased by nearly 2 times compared with the control group; the monoterpene content in the transgenic citrus leaves was also significantly upregulated. It shows that the CsAOS1-2 gene plays an important role in promoting the synthesis of citrus monoterpene (especially linalool) and can be used for the regulation of the aroma traits of citrus fruit. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0018] Figure 1 Agarose gel electrophoresis of the amplified product of the target gene CsAOS1-2;

[0019] Figure 2 The relative expression results of CsAOS1-2 genes in transiently transformed citrus peels;

[0020] Figure 3 The relative expression results of single-stick biosynthesis-related genes in transiently transformed citrus peels;

[0021] Figure 4 This is the result of GC-MS detection of linalool content in instantaneous conversion citrus peel;

[0022] Figure 5 This is the result of GC-MS detection of monoterpenoid content in citrus leaves;

[0023] Among them, * means P<0.05, ** means P<0.01. DETAILED DESCRIPTION

[0024] The present invention provides an application of the CsAOS1-2 gene in regulating the synthesis of citrus monoterpene components. The amino acid sequence of the protein encoded by the CsAOS1-2 gene is shown in SEQ ID NO: 1, which is as follows:

[0025] *

[0026] As an embodiment, the nucleotide sequence of the CsAOS1-2 gene is shown in SEQ ID NO: 2, which is as follows:

[0027]

[0028] As an embodiment, the regulation includes: increasing the expression of the CsAOS1-2 gene to promote the synthesis of citrus monoterpene components. As another embodiment, the regulation is: increasing the expression of the CsAOS1-2 gene to promote the expression of the key enzyme encoding gene upstream of the monoterpene synthesis pathway, thereby promoting the synthesis of citrus monoterpene components.

[0029] As an embodiment, the upstream key enzymes of the monoterpene synthesis pathway include: one or more of deoxyxylulose-5-phosphate synthase, deoxyxylulose phosphate reductoisomerase and terpene synthase. As an embodiment, the deoxyxylulose-5-phosphate synthase includes deoxyxylulose-5-phosphate synthase 1 and / or deoxyxylulose-5-phosphate synthase 2.

[0030] As an embodiment, the monoterpene component is linalool.

[0031] As an embodiment, the biological material for increasing the expression level of the CsAOS1-2 gene includes: one or more of an expression cassette, an expression vector and a recombinant bacterium containing a CsAOS1-2 gene coding sequence.

[0032] The present invention finds that by increasing the expression level of the CsAOS1-2 gene, the expression of genes related to the aroma substance synthesis pathway can be promoted, thereby promoting the synthesis of citrus monoterpene components, thereby achieving the purpose of improving the aroma quality of citrus fruit.

[0033] Based on the above advantages, the present invention provides a biological material for promoting the synthesis of citrus monoterpene components, wherein the biological material comprises: one or more of an expression cassette, an expression vector and a recombinant bacterium containing a CsAOS1-2 gene coding sequence, and the amino acid sequence of the protein encoded by the CsAOS1-2 gene is shown in SEQ ID NO: 1.

[0034] As an embodiment, the promoter of the expression cassette may be the CaMV 35S promoter, and the nucleotide sequence of the CaMV35S promoter is shown in SEQ ID NO:5.

[0035] As an embodiment, the original strain of the recombinant bacteria may be Agrobacterium tumefaciens; as another embodiment, the Agrobacterium tumefaciens may be Agrobacterium tumefaciens EHA105.

[0036] The biomaterial provided by the present invention is transformed into citrus, which can increase the expression level of the citrus CsAOS1-2 gene and promote the expression of the key enzyme encoding gene upstream of the monoterpene synthesis pathway, thereby promoting the synthesis of citrus monoterpene components.

[0037] Based on the above advantages, the present invention provides the use of the biomaterial described in the above technical solution in promoting the synthesis of citrus monoterpene components and / or citrus breeding.

[0038] As an embodiment, the citrus breeding may be: cultivating transgenic citrus varieties with increased monoterpene components.

[0039] To further illustrate the present invention, the application of the CsAOS1-2 gene provided by the present invention in promoting the synthesis of citrus monoterpene components is described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0040] Example 1 Construction of CsAOS1-2 gene overexpression vector

[0041] (1) Obtaining the target gene: Based on the transcriptome of the 'Changye Xiangcheng' fruit peel essential oil-deficient mutant, a gene sequence was screened and compared with the sequence of the model plant Arabidopsis thaliana. The gene was determined to be an allene oxide synthase gene and was named CsAOS1-2 based on its homology with Arabidopsis thaliana.

[0042] (2) Primer design: Specific primers CsAOS1-2-CDS-F and CsAOS1-2-CDS-R were designed to amplify the full length of the CDS of the CsAOS1-2 gene. The amplification primers were synthesized by Beijing Qingke Biotechnology Co., Ltd. The nucleotide sequences of the primers are as follows:

[0043] CsAOS1-2-CDS-F (SEQ ID NO:3): 5'-ggactagtATGGCATCCACTTCTCTA-3';

[0044] CsAOS1-2-CDS-R (SEQ ID NO:4): 5'-cggaattcTCAAAAGCTTGCTCTCTT-3'.

[0045] (3) Target gene amplification: Total RNA was extracted from citrus and then reverse transcribed into cDNA. Finally, high-fidelity PCR was used to amplify the CDS of the CsAOS1-2 gene to obtain the target fragment.

[0046] The PCR amplification system was as follows: 10×PCR mix 2.5 μL, upstream primer (5 μmol / L) 1 μL, downstream primer (5 μmol / L) 1 μL, cDNA 60 ng, ddH 2 0 to 25 μL.

[0047] The PCR amplification program was as follows: 94°C, 5 min; 94°C, 30 s, 56°C, 30 s, 72°C, 1.5 min, 35 cycles; and extension at 72°C for 10 min.

[0048] The electrophoresis results of CsAOS1-2 gene CDS are shown in Figure 1 The complete open reading frame sequence of the CsAOS1-2 gene is 1599 bp in length (shown in SEQ ID NO: 2) and encodes 532 amino acids (shown in SEQ ID NO: 1).

[0049] (4) After the target fragment obtained in step (3) was digested with SpeⅠ and EcoRI, it was ligated to the pLGNe vector recovered by SpeⅠ and EcoRI to obtain the overexpression vector pLGNe-35S-CsAOS1-2; the pLGNe vector is disclosed in the literature [Long, Q., Du, M., Long, J., Xie, Y., Zhang, J., Xu, L. et al. (2021) Transcription factor WRKY22 regulates canker susceptibility in sweet orange (Citrus sinensis Osbeck) by enhancing cell enlargement and CsLOB1 expression. Horticulture Research, 8, 15.], carrying the CaMV 35S promoter, the CaMV 35S promoter is a cauliflower mosaic virus promoter, the nucleotide sequence of which is shown in SEQ ID NO: 5, and is specifically as follows:

[0050] 5'-GTCCTCTCAAATGAAATGAACTTCCCTTATATAGAGGAAGGGTCTTG CGAAGGATAGTGGGATTGTGCGTCATCCCTTACGTCAGTGGAGATATCACATCAATCCACTTGCTTTGAAGACGTGGTTGGAACGTCTTCTTTTTCCACGATGCTCCTCGTGGGTGGGGGTCCATCTTTGGGACCACTGTCGGCAGAGGCA TCTTCAACGATGGCCTTTCCTTTATCGCAATGATGGCATTTGTAGGAGCCACCTTCCTTTTCCACTATCTTCACAATAAAGTGACAGATAGCTGGGCAATGGAATCCGAGGAGGTTTCCGGATATTACCCTTTGTTGAAAAGTCTCA-3'.

[0051] Example 2

[0052] The overexpression vector pLGNe-35S-CsAOS1-2 constructed in Example 1 was transformed into Agrobacterium tumefaciens EHA105 by electroporation, and then the transformed Agrobacterium tumefaciens was used to mediate transient transformation of citrus fruits. Meanwhile, Agrobacterium tumefaciens transformed with an empty vector (pLGNe vector) was set as a control group (CK); the method of transient transformation is as follows:

[0053] (1) The transformed Agrobacterium tumefaciens was picked up and added to LK medium, acetosyringone (AS) was added to the medium at a final concentration of 200 μmol / L, and cultured overnight at 28° C. and 220 rpm in the dark; the LK medium was LB medium containing 100 mg / L kanamycin.

[0054] (2) The bacterial solution after overnight culture in step (1) was centrifuged at 5000 rpm for 5 min and resuspended in AIM medium to an OD of 600 =0.6, 28°C, 220 rpm, dark culture for 1 hour to obtain Agrobacterium suspension. The preparation process of the AIM medium is as follows: weigh 4.46 g Murashige & Tucker basic medium (Phytotechnology), 4 g sucrose, ddH 2 0 to 1L, adjust to pH = 5.3, sterilize at high temperature, and store at 4°C; before use, add 5mL of 1mol / L MES and 0.015mol / L MgCl per 250mL. 2 2.5mL, 0.5mol / L AS 2.5mL.

[0055] (3) Clean the long-leaf orange fruit and create wounds with a 0.5 mm microneedle.

[0056] (4) Use a syringe to inject the Agrobacterium suspension obtained in step (2) into the peel on both sides of the equatorial part, rinse the excess Agrobacterium with sterile water, and culture at room temperature to keep the moisture.

[0057] After 5 days of moisturizing culture at room temperature, RNA was extracted from the peel near the injection point for quantitative PCR (qRT-PCR) to detect the expression of CsAOS1-2 genes and single-post synthesis-related genes (CsDXS1, CsDXS2, CsDXR and CsTPS). The internal reference gene of the qRT-PCR was Actin, and the primer sequences used were shown in Table 1.

[0058] Table 1 Primers used in qRT-PCR detection

[0059]

[0060] Note: CsDXS1 is the gene encoding deoxyxylulose-5-phosphate synthase 1, CsDXS2 is the gene encoding deoxyxylulose-5-phosphate synthase 2, CsDXR is the gene encoding deoxyxylulose phosphate reductoisomerase; CsTPS is the gene encoding terpene synthase.

[0061] The reaction conditions of the qRT-PCR were: 95°C for 30 s; 95°C for 5 s, 60°C for 34 s, 39 cycles; 95°C for 15 s, 60°C for 60 s, 95°C for 15 s. -△△Ct The relative expression of the target gene in the transgenic plants was calculated by the method. The test results are shown in Figure 2 and Figure 3 .

[0062] The results showed that the expression levels of CsAOS1-2 genes and single-dye synthesis-related genes CsDXS1, CsDXS2, CsDXR and CsTPS in the citrus peel of the transgenic lines (A1 and A2) were significantly increased compared with those in the control group CK.

[0063] After 5 days of moisturizing culture at room temperature, GC-MS was used to detect the volatile substances in the transiently transformed citrus peels, as follows:

[0064] The peel was ground into fine powder with liquid nitrogen, and 0.5 g was transferred to a 2 ml microcentrifuge tube. 1 ml of n-hexane was added to the sample, and trans-2,4-nonadienal (Sigma) was added as an internal standard at a final concentration of 200 ppm. Ultrasonic extraction was performed at 4°C for 40 min. After the extraction, centrifugation was performed at 12,000 rpm for 1 min. 0.2 ml of the organic layer was taken and added to the GC-MS in full scan mode.

[0065] Citrus volatiles analysis conditions: HP-5MS column (50m×0.22mm×0.025μm). Helium carrier gas flow rate was 0.7ml / min. The following GC temperature program was used: hold at 50°C for 3min, then increase to 200°C at a rate of 5°C / min, then increase to 250°C at a rate of 10°C / min, and finally hold at 250°C for 2min. The temperatures of the injector and detector were 250°C and 180°C, respectively.

[0066] GC-MS analysis showed that the linalool content in the citrus peel of the transgenic lines (A1 and A2) (A1 and A2 were 256.74 μg / g and 249.46 μg / g, respectively) was significantly higher than that of the control group CK (92.6 μg / g), increasing by nearly 2 times ( Figure 4 ).

[0067] Example 3

[0068] The overexpression vector pLGNe-35S-CsAOS1-2 constructed in Example 1 was transformed into Agrobacterium tumefaciens EHA105 by electroporation, and then citrus explants (epicotyls) were transformed by Agrobacterium tumefaciens. The explants after genetic transformation were identified by GUS staining, PCR, and qRT-PCR analysis of the expression level of CsAOS1-2 to obtain transgenic plants (OE1 and OE2). At the same time, Agrobacterium tumefaciens that was only transformed with an empty vector (pLGNe vector) was set as a wild-type control group (WT).

[0069] GC-MS analysis showed that the content of monoterpenoids in citrus leaves overexpressing CsAOS1-2 (i.e., the total amount of monoterpenes, 3.40 mg / g for OE1 and 3.02 mg / g for OE2, respectively) was significantly higher than that in the wild type (1.84 mg / g). Figure 5 ).

[0070] In summary, the expression of CsAOS1-2 genes in transiently transformed citrus peels was upregulated by about 6 times, the expression levels of key enzyme genes (CsDXS1, CsDXS2, CsDXR and CsTPS) in the upstream of the monoterpene synthesis pathway were significantly higher than those in the control, and the linalool content in the peels was upregulated by nearly 2 times compared with the control group; and the content of monoterpenoids in the leaves of plants overexpressing CsAOS1-2 genes was also significantly increased compared with the wild type. By regulating the expression of CsAOS1-2 genes, the expression of genes related to the aroma substance synthesis pathway can be promoted, thereby achieving the purpose of improving the aroma quality of citrus fruits.

[0071] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Application of the CsAOS1-2 gene in regulating the synthesis of citrus monoterpene components, the amino acid sequence of the protein encoded by the CsAOS1-2 gene is shown in SEQ ID NO:

1.

2. The use according to claim 1, characterized in that: The regulation includes: increasing the expression level of the CsAOS1-2 gene to promote the synthesis of citrus monoterpene components.

3. The use according to claim 1, characterized in that: The regulation is: increasing the expression level of the CsAOS1-2 gene to promote the expression of key enzyme encoding genes upstream of the monoterpene synthesis pathway, and promoting the synthesis of citrus monoterpene components.

4. The use according to claim 3, characterized in that: The key enzymes upstream of the monoterpene synthesis pathway include: one or more of deoxyxylulose-5-phosphate synthase, deoxyxylulose phosphate reductoisomerase and terpene synthase.

5. The use according to claim 4, characterized in that: The deoxyxylulose-5-phosphate synthase includes deoxyxylulose-5-phosphate synthase 1 and / or deoxyxylulose-5-phosphate synthase 2.

6. The use according to any one of claims 1 to 3, characterized in that: The monoterpene component is linalool.

7. The use according to claim 2 or 3, characterized in that: The biological material for increasing the expression level of the CsAOS1-2 gene comprises: one or more of an expression cassette, an expression vector and a recombinant bacterium containing the coding sequence of the CsAOS1-2 gene.

8. A biomaterial for promoting the synthesis of citrus monoterpene components, characterized in that: The biological material comprises: one or more of an expression cassette, an expression vector and a recombinant bacterium containing a CsAOS1-2 gene coding sequence, and the amino acid sequence of the protein encoded by the CsAOS1-2 gene is shown in SEQ ID NO:

1.

9. Use of the biological material according to claim 8 in citrus breeding.

10. The use according to claim 9, characterized in that: The citrus breeding includes: cultivating transgenic citrus varieties with increased monoterpene components.

Images