A method for amplifying the full-length sequence of pitaya virus GAV2, a detection method and application thereof

Abstract

The present invention relates to a method for amplifying the full-length sequence of pitaya virus GAV2, a detection method and an application thereof, and belongs to the field of molecular detection technology. The present invention designs full-length sequence amplification primers and detection primers based on RPA-Cas12a according to the characteristics of pitaya virus GAV2. The present invention obtains a pitaya virus GAV2 sample by rapidly amplifying the full sequence of pitaya virus GAV2, thereby providing a reference for determining the type of pitaya virus GAV2, thereby being able to reduce the spread rate of the virus and reduce the economic losses of planting units. The detection method provided by the present invention has the characteristics of strong stability, high sensitivity and suitability for rapid on-site detection, thereby avoiding the generation of false positives; at the same time, rapid visual monitoring is achieved through fluorescent test strips, so as to facilitate rapid pathogen identification.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular detection and relates to a method for amplifying the full-length sequence of pitaya virus GAV2, a detection method and application thereof. Background Art

[0002] Pitaya is a tropical fruit native to Central America and is now grown in tropical and subtropical regions around the world. It has high nutritional value and is rich in vitamin C, B vitamins, minerals, dietary fiber and plant protein. As its cultivation and consumption gradually increase worldwide, viral infection can lead to decreased yields and reduced fruit quality, thus affecting farmers' income and market supply. Therefore, it becomes necessary to study the genome sequences and genetic variations of these viruses and their detection technologies.

[0003] The pitaya virus GAV2 is a virus that exists in pitaya in Hainan Province. It can cause mottled yellowing, chlorosis and deformity on the surface of the stem segments of pitaya plants, weak plant growth, low fruit yield or almost no yield, resulting in serious economic losses. Therefore, strengthening plant virus detection and establishing a detection system for GAV2 virus are of great significance for preventing the further spread of these viruses and protecting agricultural production. The technical personnel of the present invention sampled pitaya varieties such as Dahong, Zilong, Jindu and Changlong in Ledong, Dongfang, Lingao and other places in Hainan, and isolated a pitaya virus GAV2 from pitaya. The technical personnel of the present invention found that the partial genome sequence of pitaya virus GAV2 has a similarity of 98.94% with the known sequence (SEQ ID NO: 5) reported in the Guangxi alphaflexivirus 2 virus genome with Genbank accession number: MW897280.1. However, to date, technicians in this field have limited knowledge of the Guangxi alphaflexivirus 2 viral genome, and detailed information on the full length of the virus has not yet been fully clarified. However, it is important to obtain the full length of the viral genome and construct a viral replication system. The acquisition of genomic information is of great significance for virus research.

[0004] Recombinase polymerase amplification (RPA) technology is a new type of multi-enzyme constant temperature nucleic acid amplification technology proposed in 2006, which can quickly and conveniently perform nucleic acid detection and analysis. Under constant temperature conditions of 25-43°C, RPA technology can amplify specific nucleic acid sequences and observe the results within 5-20 minutes. Since its emergence, gene editing detection technology has been a hot research in the biological field. Some enzymes in the gene editing system, such as Cas12a enzyme, have side cutting ability. When the target DNA is cut under the guidance of the guide sequence sgRNA, it can start the single-stranded DNA in the non-target cutting reaction system. By adding labeled single-stranded DNA, the cutting reaction can be visualized after the labeled DNA is cut, making Cas12a also a genetic detection tool. However, the current detection of viruses is mainly carried out by PCR amplification, which has a complex detection process, a long detection time, high sample requirements, and relatively low accuracy, which is not conducive to rapid on-site detection of whether dragon fruit contains viruses.

[0005] The prior art has not yet achieved amplification of the full-length genome sequence of the pitaya virus GAV2. The present invention technicians designed amplification full-length sequence primers and RPA-Cas12a-based detection primers based on the characteristics of the pitaya virus GAV2, and achieved rapid amplification and detection of the pitaya virus GAV2. Summary of the invention

[0006] The purpose of the present invention is to provide a method for amplifying the full-length sequence of pitaya virus GAV2, a detection method and an application thereof. The genome sequence of the pitaya virus GAV2 is shown in SEQ ID NO: 4. Specifically, the present invention is a method for rapidly detecting pitaya virus GAV2 sequence combination, a detection method and an application thereof based on CRISPR / Cas12a technology combined with RT-RPA technology. The method has the characteristics of good specificity, high sensitivity, simplicity and rapidity, low sample requirement and high efficiency, and can meet the requirements for rapid detection in the field, thereby improving the detection efficiency and providing a new choice for the detection method of pitaya virus GAV2.

[0007] To achieve the above object, the present invention provides the following technical solutions:

[0008] The first aspect of the present invention provides primers for cloning the full-length genome sequence of pitaya virus GAV2, including the following three pairs of primers:

[0009] Primer pair 1 included, forward primer: 5′-ATGGCTCGTGTGCGTGAG-3′, reverse primer: 5′-CTATTGGGTCATCAGTTTGTACACAGTTG-3′;

[0010] Primer pair 2 included, forward primer: 5′-ATGCCTTCTGGAACAAGCTCG-3′, reverse primer: 5′-TCAGGGGGCGGCGTCA-3′;

[0011] Primer pair 3 includes, forward primer: 5'-ATGTCAGGTGCCCCGC-3', reverse primer: 5'-TTATTCAGGGCCCGGTAGAAACTGA-3'.

[0012] The second aspect of the present invention provides a method for amplifying the full-length genome sequence of pitaya virus GAV2, comprising the following steps:

[0013] S1, extracting genomic RNA from positive samples;

[0014] S2, reverse transcribing the extracted genomic RNA into cDNA;

[0015] S3, using the above primer pairs 1-3 to perform PCR amplification on the cDNA of samples, the corresponding expected amplified fragment sizes are fragment 3442 bp, fragment 2140 bp and fragment 1155 bp, respectively;

[0016] S4. Detect the PCR amplification products by agarose gel electrophoresis, recover and purify the PCR amplification products that meet the expected amplification fragment size, connect them to the pTOPO vector respectively, transform the ligation products into Escherichia coli GV3101, identify the Escherichia coli GV3101 bacterial solution by PCR to obtain positive clones, sequence and compare the positive clones to obtain fragments 1, 2 and 3 containing the genome sequence of pitaya virus GAV2; splice them to obtain the full-length genome sequence of pitaya virus GAV2.

[0017] The third aspect of the present invention provides a sequence combination for detecting pitaya virus GAV2, the sequence combination comprising an RT-RPA primer pair sequence and a crRNA sequence, the RT-RPA primer pair sequence being: the sequence of the upstream primer F is as shown in SEQ ID NO: 1; the sequence of the downstream primer R is as shown in SEQ ID NO: 2; the crRNA sequence is as shown in SEQ ID NO: 3;

[0018] The sequence combination also includes a ssDNA probe sequence, which is a ssDNA probe sequence of pitaya virus GAV2 for visual fluorescence detection or a ssDNA probe sequence of pitaya virus GAV2 for test strip detection. The ssDNA probe sequence of pitaya virus GAV2 for visual fluorescence detection is ssDNA-FQ, and the specific sequence is: FAM-CCGGAAAAAAAAAAAACCGG-BHQ1; the ssDNA probe sequence of pitaya virus GAV2 for test strip detection is ssDNA-FB, and the specific sequence is: 5'-fluorescent group-TTATTTTATTTTATT-Biotin-3';

[0019] Among them, the genome sequence of the pitaya virus GAV2 is shown in SEQ ID NO:4.

[0020] The fourth aspect of the present invention provides the use of the sequence combination for detecting pitaya virus GAV2 in preparing a detection kit for pitaya virus GAV2.

[0021] A fifth aspect of the present invention provides a method for detecting pitaya virus GAV2, wherein the genome sequence of pitaya virus GAV2 is shown in SEQ ID NO: 4, and the detection method comprises the following steps:

[0022] Step 1: extracting genomic RNA from the sample to be tested;

[0023] Step 2: Using genomic RNA as a template, an upstream primer F as shown in SEQ ID NO: 1 and a downstream primer R as shown in SEQ ID NO: 2 are used to perform an RT-RPA amplification reaction to obtain an RT-RPA amplification product; the reaction system of the RT-RPA amplification reaction includes: 29.4 μL Buffer A, 2.0 μL of upstream and downstream primers, 2.5 μL Buffer B, 2 μL template RNA, and ddH2O is added to 50 μL, and each component in the reaction system is added to a reaction tube containing a recombinase, a DNA polymerase, a reverse transcriptase, and dNTP lyophilized powder in sequence; the reaction conditions of the RPA amplification reaction are: 37°C-47°C for 5-30 min

[0024] Step 3, using the RT-RPA amplification product, Cas12a protein, crRNA as shown in SEQ ID NO: 3 and a nucleic acid probe to establish an RPA-Cas12a detection system, obtain a reaction product after the reaction, and then perform fluorescence detection or test strip detection.

[0025] Furthermore, in step three, the reaction product of the fluorescence detection is RPA-Cas12a-FQ, and the obtaining method is as follows: 0.3ul Cas12a, 1.25ul crRNA, 0.4ul ssDNA-FQ, 1×Buffer 2, and 2μL RT-RPA amplification product are mixed, ddH2O is filled to 20μL, mixed, and reacted at 37°C for 30min to obtain the reaction product RPA-Cas12a-FQ; the sequence of the ssDNA-FQ is FAM-CCGGAAAAAAAAAAAACCGG-BHQ1.

[0026] Furthermore, the reaction product RPA-Cas12a-FQ is irradiated with ultraviolet light. If fluorescence is present, it is judged as positive, indicating that the sample contains pitaya virus GAV2; if no fluorescence is present, it is judged as negative, indicating that the sample does not contain pitaya virus GAV2.

[0027] Furthermore, in step three, the reaction product detected by the test strip is RPA-Cas12a-FB, and the obtaining method is as follows: 0.3ul Cas12a, 1.25ul crRNA, 0.4ul ssDNA-FB, 1×Buffer 2ul, and 2μL RT-RPA amplification product are mixed, ddH2O is filled to 20μL, mixed well, and reacted at 37°C-47°C for 5-30 min to obtain the reaction product RPA-Cas12a-FB; the sequence of the ssDNA-FB is 5'-fluorescent group-TTATTTTATTTTATT-Biotin-3'.

[0028] Furthermore, the reaction product RPA-Cas12a-FB was detected using Tiosbio's Cas12 / 13 special nucleic acid detection test strip, and red strips appeared on the test strip quality control line C line and the detection line T line; if the test strip quality control line C line did not show color, and the detection line T line showed a red strip, it was judged as a positive result. The above two situations both indicate that Cas12 / 13 can be effectively cut and activate the reporter group to develop color, indicating that the sample contains pitaya virus GAV2; if a red strip appears on the test strip quality control line C line and the detection line T line does not show color, it is judged as a negative result, indicating that Cas12 / 13 failed to cut the reporter molecule, failed to activate the reporter group to develop color, and the sample did not contain pitaya virus GAV2.

[0029] Beneficial effects of the present invention:

[0030] The invention designs detection primers and full-length genome sequence amplification primers according to the characteristics of pitaya virus GAV2, which can not only effectively detect pitaya virus GAV2, but also obtain pitaya virus GAV2 samples by rapidly amplifying the full sequence of pitaya virus GAV2, thereby providing a reference for determining the type of pitaya virus GAV2, and further reducing the spreading speed of the virus and reducing the economic losses of planting units.

[0031] 1. The present invention provides a rapid detection method for pitaya virus GAV2 based on RPA-Cas12a, which has the characteristics of strong stability, high sensitivity and suitability for rapid on-site detection.

[0032] 2. The detection method provided by the present invention can be used for the distribution frequency detection of pitaya virus GAV2, providing a reliable theoretical basis for the rapid identification of pitaya disease pathogens, and delaying the invasion of pathogens to cause large-scale damage.

[0033] 3. The RNA extraction and detection method provided by the present invention has the characteristics of short detection time, simple operation, and low requirements on the quality of detection materials. The results can be analyzed by only reacting at 37°C for 15 to 40 minutes. At the same time, no large-scale instruments and equipment are required during detection, and it is suitable for large-scale screening.

[0034] 4. The detection method provided by the present invention, other pathogens isolated from pitaya will not affect the test results. The detection system has strong specificity, and crRNA can only activate the "trans-cutting" activity of Cas12a by recognizing the amplified target nucleic acid molecules. Cas12a does not participate in a large amount of off-target cutting of pitaya genomic DNA and other viruses, which can effectively reduce false positive interference. Therefore, the RPA-Cas12a-FQ detection system provided by the present invention can be applied to direct crude extraction detection of field samples without the need for additional steps to purify the target DNA. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 This is the fluorescence effect of viral RNA at different concentrations: the concentrations from left to right are 55.3ng / μL, 5.53ng / μL, 553pg / μL, 55.3pg / μL, 5.53pg / μL, 553fg / μL, 55.3fg / μL, and 5.53fg / μL.

[0036] Figure 2 The test strips show the effects of different concentrations of viral RNA: the concentrations from left to right are 55.3ng / μL, 5.53ng / μL, 553pg / μL, 55.3pg / μL, 5.53pg / μL, 553fg / μL, 55.3fg / μL, and 5.53fg / μL.

[0037] Figure 3 The test strip effects of different viral RNAs: from left to right, 55.3ng / μL GAV2 virus, 5.53ng / μL GAV2 virus, 553pg / μL GAV2 virus, blank control, 70.5ng / μL CVX virus, 58.6ng / μL PIVX virus.

[0038] Figure 4 This is a schematic diagram of the results of the Cas12 / 13-specific nucleic acid test strip. DETAILED DESCRIPTION

[0039] The specific implementation modes of the present invention are described below so that those skilled in the art can understand the present invention. However, it should be clear that the present invention is not limited to the scope of the specific implementation modes. For those of ordinary skill in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the attached claims, these changes are obvious, and all inventions and creations utilizing the concept of the present invention are protected.

[0040] The technicians of the present invention took samples from pitaya varieties such as Dahong, Zilong, Jindu and Changlong in Ledong, Dongfang, Lingao and other places in Hainan, and isolated a pitaya virus GAV2 from pitaya through RNA extraction, high-throughput sequencing, RT-PCR and other technologies. The genome sequence of the pitaya virus GAV2 is shown in SEQ ID NO: 4.

[0041] Example 1: A method for cloning the full-length genome sequence of pitaya virus GAV2

[0042] 1. Materials and methods

[0043] (1) Test virus materials: Pitaya stem segments infected with pitaya virus GAV2 were used as materials. The genomic RNA of the test samples was extracted by Trizol method for subsequent experiments.

[0044] (2) Primers: Three pairs of primers, primer pairs 1-3, with specific nucleotide sequences as follows

[0045] Primer pair 1 includes, forward primer: 5'-ATGGCTCGTGTGCGTGAG-3' (SEQ ID NO: 6), reverse primer: 5'-CTATTGGGTCATCAGTTTGTACACAGTTG-3' (SEQ ID NO: 7);

[0046] Primer pair 2 includes, forward primer: 5'-ATGCCTTCTGGAACAAGCTCG-3' (SEQ ID NO: 8), reverse primer: 5'-TCAGGGGGCGGCGTCA-3' (SEQ ID NO: 9);

[0047] Primer pair 3 includes forward primer: 5'-ATGTCAGGTGCCCCGC-3' (SEQ ID NO: 10), reverse primer: 5'-TTATTCAGGGCCCGGTAGAAACTGA-3' (SEQ ID NO: 11).

[0048] The amplified fragments of the three designed primer pairs overlapped with each other, covering the full-length genome sequence of pitaya virus GAV2. PCR amplification was performed using the three pairs of primers respectively, and the expected amplified fragment sizes were 3442bp (fragment 1), 2140bp (fragment 2) and 4455bp (fragment 3), respectively.

[0049] (3) RT-PCR: Pitaya stem segments infected with pitaya virus GAV2 were collected and total RNA was extracted. Reverse transcription and PCR were performed using an RT-PCR kit.

[0050] For reverse transcription, use TAKARA's PrimeScript RT reagent Kit with gDNA Eraser (Cat. No. RR047A). For RNA template denaturation, use RNA free centrifuge tubes. Wear gloves and masks and operate on ice.

[0051] Genomic DNA Removal:

[0052] Table 1 Genomic DNA removal system

[0053]

[0054] Incubate the PCR instrument at 42°C for 2 min (with the hot cover set to the highest temperature), then quickly cool on ice for 2 min.

[0055] Reverse transcription reaction:

[0056] Table 2 Reverse transcription system

[0057]

[0058] Mix well by pipetting and heat in PCR machine at 37℃ for 15min and 85℃ for 5sec.

[0059] The PCR reaction system (50 μL) is as follows:

[0060] Table 3 PCR reaction system

[0061]

[0062] The PCR reaction procedure is as follows:

[0063] Table 4 PCR reaction procedure

[0064]

[0065] The PCR amplification products were detected by 1% agarose gel electrophoresis with a sample volume of 50 μl and electrophoresis at 100 V for 30 min. The samples were stained with EB and observed and photographed by UVP gel imaging system. The results showed that the fragment sizes of the PCR amplification products of the three pairs of primers were consistent with the expectations, indicating that the target bands had been successfully amplified.

[0066] (4) Cloning and sequencing of RT-PCR amplification products: Recover the target bands according to the instructions of the DNA gel recovery kit, connect them to the pTOPO vector, transform the ligation products (Escherichia coli GV3101), obtain positive clones after bacterial liquid PCR identification, sequence the positive clones, and compare and analyze the sequencing results.

[0067] (5) Assembly of the full-length genome sequence of pitaya virus GAV2: The 3' and 5' end sequences of the viral genome were obtained using the RACE kit, and the obtained fragments were assembled using DNAMAN software. The incorrect bases were corrected by comparing the sequencing peak graph, and fragments 1, 2, and 3 were assembled to obtain the full-length genome sequence of pitaya virus GAV2.

[0068] 2. Results and Analysis

[0069] The full-length genome sequence of pitaya virus GAV2 was submitted to GeneBank for BLAST analysis, and the results showed that the obtained partial genome sequence of pitaya virus GAV2 had a similarity of 98.94% with the known sequence of Guangxialphaflexivirus 2 genome with Genbank accession number: MW897280.1. However, so far, those skilled in the art have limited knowledge of the Guangxi alphaflexivirus 2 genome, and detailed information on the full length of the virus has not yet been fully clarified.

[0070] Example 2: crRNA and RT-RPA primer design

[0071] Based on the genome sequence of the new pitaya virus GAV2 (shown in SEQ ID NO: 4), crRNA was designed on the crispor.gi.ucsc.edu website. The length of the RT-RPA primer is generally 30 to 35 nucleotides. According to the position of the crRNA design site, 40 bp were extended forward and backward to serve as RPA primer sites, and the primer length was 34 bp.

[0072] The sequence of the upstream primer F: 5'-ATTGCCCTCACTGCGGTGCTAAGCACGCTCAACC-3' (shown in SEQ ID NO: 1);

[0073] The sequence of the downstream primer R is: 5'-ATGCTGATAGTTATATTATTCACAATTAGTTATA-3' (shown in SEQ ID NO: 2).

[0074] The crRNA sequence is: AAUUUCUACUGUUGUAGAUGAAGGUGUGCACAACCACUGAUA (shown in SEQ ID NO: 3).

[0075] Example 3: Detection of the novel pitaya virus GAV2

[0076] The RT-RPA primer pair of the novel pitaya virus GAV2 (shown in SEQ ID NO: 4) was used to detect the upstream primer F and the downstream primer R, and the method steps are as follows:

[0077] (1) Extract genomic RNA of the sample to be tested using the Trizol method;

[0078] (2) Using genomic RNA as a template, an RT-RPA amplification reaction is performed using an upstream primer F as shown in SEQ ID NO: 1 and a downstream primer R as shown in SEQ ID NO: 2 to obtain an RT-RPA amplification product; the reaction system of the RT-RPA amplification reaction comprises: 29.4 μL Buffer A, 2.0 μL of upstream and downstream primers, 2.5 μL Buffer B, 2 μL template RNA, and ddH2O to make up to 50 μL, and each component in the reaction system is added to a reaction tube containing a recombinase, a DNA polymerase, a reverse transcriptase, and dNTP lyophilized powder in sequence; the reaction conditions of the RPA amplification reaction are: 37°C-47°C for 5-30 min.

[0079] (3) establishing an RPA-Cas12a detection system using the RT-RPA amplification product, Cas12a protein, crRNA as shown in SEQ ID NO: 3, and a nucleic acid probe, obtaining a reaction product after the reaction, and then performing fluorescence detection or test strip detection;

[0080] The reaction product of the fluorescence detection is RPA-Cas12a-FQ, and the obtaining method is as follows: 0.3ul Cas12a, 1.25ul crRNA, 0.4ul ssDNA-FQ, 1×Buffer 2, and 2μL RT-RPA amplification product are mixed, ddH2O is added to 20μL, mixed, and reacted at 37°C for 30min to obtain the reaction product RPA-Cas12a-FQ; the sequence of the ssDNA-FQ is FAM-CCGGAAAAAAAAAAAACCGG-BHQ1 (shown in SEQ ID NO: 12);

[0081] The reaction product detected by the test strip is RPA-Cas12a-FB, and the obtaining method is as follows: 0.3ul Cas12a, 1.25ul crRNA, 0.4ul ssDNA-FB, 1×Buffer 2ul, and 2μL RT-RPA amplification product are mixed, ddH2O is added to 20μL, mixed well, and reacted at 37°C-47°C for 5-30 min to obtain the reaction product RPA-Cas12a-FB; the sequence of the ssDNA-FB is 5'-fluorescent group-TTATTTTATTTTATT-Biotin-3' (shown in SEQ ID NO: 13).

[0082] (4) Determination of test results:

[0083] The reaction product RPA-Cas12a-FQ is irradiated with ultraviolet light. If fluorescence is present, it is judged as positive, indicating that the sample contains pitaya virus GAV2; if no fluorescence is present, it is judged as negative, indicating that the sample does not contain pitaya virus GAV2;

[0084] The reaction product RPA-Cas12a-FB was detected using Tiosbio's Cas12 / 13 dedicated nucleic acid detection test strips, and red strips appeared on both the test strip quality control line C and the detection line T; if the test strip quality control line C line did not show color, and the detection line T line showed a red strip, it was determined to be a positive result. Both of the above situations indicate that Cas12 / 13 can effectively cut and activate the reporter group to develop color, indicating that the sample contains pitaya virus GAV2; if a red strip appears on the test strip quality control line C line and the detection line T line does not show color, it is determined to be a negative result, indicating that Cas12 / 13 failed to cut the reporter molecule, failed to activate the reporter group to develop color, and the sample does not contain pitaya virus GAV2.

[0085] Example 4: Sensitivity of RT-RPA real-time fluorescence detection of pitaya virus GAV2

[0086] The RNA template of 553ng / μL was diluted 10 times in a gradient manner, and the detection limit of the RT-RPA real-time fluorescence detection method of pitaya virus GAV2 was tested using the method of Example 3. It can be seen that a significant fluorescence effect can be observed after 10 times dilution, that is, the minimum detectable RNA template is 55.3fg / μL ( Figure 1 ).

[0087] Example 5: Sensitivity of RT-RPA real-time test strip detection of pitaya virus GAV2

[0088] The RNA template of 553 ng / μL was diluted 10 times in a gradient manner, and the detection limit of the RT-RPA real-time test strip detection method of pitaya virus GAV2 was tested using the method of Example 3. It can be seen that obvious bands can still be observed after 10 times dilution, that is, the minimum detectable RNA template is 553 fg / μL ( Figure 2 and Figure 4 ).

[0089] Example 6: Specificity test of primers and probes for RT-RPA real-time test strip detection of pitaya virus GAV2

[0090] Using the method described in Example 3, three different concentrations of virus samples to be tested were tested, and a blank control group was set up. The specific test sample groups were: pitaya virus GAV2, pitaya virus CVX (Cactus virus X), pitaya virus PIVX (Pitaya virus X). The results are as follows Figure 4 As shown, only the pitaya virus GAV2 can be observed to have a red strip on the T line of the test strip, indicating that the RT-RPA detection primers and probes of pitaya virus GAV2 have strong specificity ( Figure 3 and Figure 4 ).

[0091] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A primer combination for cloning the full-length genome sequence of pitaya virus GAV2, characterized in that: It consists of the following 3 pairs of primers: Primer pair 1 included, forward primer: 5′-ATGGCTCGTGTGCGTGAG-3′, reverse primer: 5′-CTATTGGGTCATCAGTTTGTACACAGTTG-3′; Primer pair 2 included, forward primer: 5′-ATGCCTTCTGGAACAAGCTCG-3′, reverse primer: 5′-TCAGGGGGCGGCGTCA-3′; Primer pair 3 includes, forward primer: 5'-ATGTCAGGTGCCCCGC-3', reverse primer: 5'-TTATTCAGGGCCCGGTAGAAACTGA-3'.

2. A method for amplifying the full-length genome sequence of pitaya virus GAV2, characterized in that: The following steps are involved: S1, extracting genomic RNA from positive samples; S2, reverse transcribing the extracted genomic RNA into cDNA; S3. Using the primer pairs 1-3 in claim 1, PCR amplification is performed on the cDNA of the samples, and the corresponding expected amplified fragment sizes are 3442 bp, 2140 bp, and 1155 bp, respectively; S4, using agarose gel electrophoresis to detect the PCR amplification products, recovering and purifying the PCR amplification products that meet the expected amplification fragment size, connecting them to the pTOPO vector respectively, transforming the ligation products into Escherichia coli GV3101, identifying the Escherichia coli GV3101 bacterial solution by PCR to obtain positive clones, sequencing and comparing the positive clones to obtain fragments 1, 2 and 3 containing the genomic sequence of pitaya virus GAV2; splicing to obtain the full-length genomic sequence of pitaya virus GAV2, Among them, the genome sequence of the pitaya virus GAV2 is shown in SEQ ID NO:

4.

3. A composition for detecting pitaya virus GAV2, characterized in that, The composition includes an RT-RPA primer pair and crRNA, wherein the RT-RPA primer pair is: the sequence of the upstream primer F is shown in SEQ ID NO: 1; the sequence of the downstream primer R is shown in SEQ ID NO: 2; and the crRNA sequence is shown in SEQ ID NO: 3; The composition also includes a ssDNA probe, which is a ssDNA probe of pitaya virus GAV2 for visual fluorescence detection or a ssDNA probe of pitaya virus GAV2 for test strip detection. The ssDNA probe of pitaya virus GAV2 for visual fluorescence detection is ssDNA-FQ, and the specific sequence is: FAM-CCGGAAAAAAAAAAAACCGG-BHQ1; the ssDNA probe of pitaya virus GAV2 for test strip detection is ssDNA-FB, and the specific sequence is: 5'-fluorescent group-TTATTTTATTTTATT-Biotin-3'; Among them, the genome sequence of the pitaya virus GAV2 is shown in SEQ ID NO:

4.

4. Application of a composition for detecting pitaya virus GAV2 according to claim 3 in preparing a detection kit for pitaya virus GAV2.

Images