SgRNA for specifically recognizing pig Wip1 gene and application of sgRNA

Abstract

The invention provides sgRNA for specifically recognizing a pig Wip1 gene and application of the sgRNA, and relates to the field of gene engineering. The sgRNA for specifically recognizing the 5 'UTR region of the pig Wip1 gene comprises sgRNA-1 for specifically recognizing the 5' UTR region of the pig Wip1 gene, and / or sgRNA-2 for specifically recognizing the 5 'UTR region of the pig Wip1 gene. The sgRNA-1 and the sgRNA-2 have cleavage activity, the sgRNA-1 and the sgRNA-2 are matched with a CRISPR / Cas9 system, and the knockout efficiency can reach 24% and 27% respectively, so that gene editing operation, such as amino acid modification and replacement, on the pig Wip1 gene can be efficiently realized, and the application in the aspects of gene function research, disease-resistant breeding and the like of pig cells or individuals can be realized.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering, and in particular to an sgRNA specifically recognizing a porcine Wip1 gene and an application thereof. Background Art

[0002] The following statements merely provide background information related to the present disclosure and do not necessarily constitute prior art.

[0003] As one of the important livestock breeds in my country, pigs play a key role in many fields. In the field of agricultural economy, pigs occupy a pivotal position; and in medical disease models and molecular genetics research, pigs are also an indispensable research object.

[0004] Wild-type p53-induced phosphatase 1 (Wip1) is a prouein phosphatase 1D (Mg / Mn-dependent protein kinase). 2+ / Mn 2+ The Wip1 gene (Gene ID: 100525714) of pigs is located on chromosome 12, with a length of about 50,559 bp, 6 exons, and 605 amino acids. Studies have reported that Wip1 regulates the repair of DNA damage in the nucleus and the proliferation, senescence, apoptosis, and autophagy of inflammatory cells by dephosphorylating a variety of important signaling molecules such as p38 MAPK, p53, and ataxia telangiectasia mutated (auaxia uelangiecuasia-muuaued, AuM) kinase, thereby affecting the normal function of cells. In addition, the Wip1 gene also plays an important role in cell growth and development, immune regulation, tumorigenesis, and animal reproduction.

[0005] Gene-edited pigs have shown extremely high application value in research fields such as biology, breeding of new agricultural varieties, and biomedicine. The emergence of the CRISPR / Cas9 system has greatly promoted the efficiency of pig gene editing and provided strong technical support for in-depth research in related fields. Editing the 5'UTR region of the porcine Wip1 gene and exploring the regulation of the regulatory elements in this region on growth and development, immunity, tumors, and reproduction has important application value for the study of pig gene function and the preparation and breeding of new gene-edited pigs.

[0006] In view of this, the present invention is proposed. Summary of the invention

[0007] The object of the present invention is to provide a sgRNA for CRISPR / Cas9 system, which can specifically recognize the 5'UTR region of the porcine Wip1 gene. Another object of the present invention is to provide the application of the above sgRNA.

[0008] In order to solve the above technical problems, the present invention particularly adopts the following technical solutions:

[0009] In a first aspect, a sgRNA that specifically recognizes the 5'UTR region of the porcine Wip1 gene is provided, including sgRNA-1 and / or sgRNA-2;

[0010] The target sequence of the sgRNA-1 specifically binds to the 5'UTR region of the porcine Wip1 gene and contains the RNA sequence shown in SEQ ID NO.1;

[0011] The target sequence of the sgRNA-2 specifically binds to the 5'UTR region of the porcine Wip1 gene and contains the RNA sequence shown in SEQ ID NO.2.

[0012] In a second aspect, a DNA molecule encoding sgRNA is provided, wherein the DNA molecule is transcribed to produce the sgRNA that specifically recognizes the 5'UTR region of the porcine Wip1 gene as described in the first aspect.

[0013] In the third aspect, a vector is also provided, which carries the DNA molecule described in the second aspect.

[0014] In a fourth aspect, a porcine Wip1 gene editing composition is also provided, wherein the porcine Wip1 gene editing composition comprises (i) and (ii):

[0015] (i) The sgRNA that specifically recognizes the 5'UTR region of the porcine Wip1 gene as described in the first aspect, or the DNA molecule as described in the second aspect, or the vector as described in the third aspect.

[0016] (ii) Cas nuclease or a polynucleotide encoding a Cas nuclease.

[0017] In the fifth aspect, the present invention also provides the use of the sgRNA that specifically recognizes the 5'UTR region of the pig Wip1 gene as described in the first aspect, or the DNA molecule as described in the second aspect, or the vector as described in the third aspect, or the pig Wip1 gene editing composition as described in the fourth aspect in the preparation of pig gene editing products, or editing pig genes for non-diagnostic and therapeutic purposes.

[0018] In the sixth aspect, a pig gene editing kit is also provided, which contains the sgRNA that specifically recognizes the 5'UTR region of the pig Wip1 gene as described in the first aspect, or the DNA molecule as described in the second aspect, or the vector as described in the third aspect, or the pig Wip1 gene editing composition as described in the fourth aspect.

[0019] In the seventh aspect, a method for editing the porcine Wip1 gene for non-diagnostic and therapeutic purposes is also provided, the method comprising introducing the porcine Wip1 gene editing composition described in the fourth aspect into a test cell.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] The sgRNA provided by the present invention is used in the CRISPR / Cas9 system and can specifically identify the 5'UTR region of the porcine Wip1 gene. The present invention has experimentally found that sgRNA-1 and sgRNA-2 have cutting activity, and the sgRNA cooperates with the CRISPR / Cas9 system, and the knockout efficiency is 24% and 27% respectively, which can efficiently perform gene editing operations on the porcine Wip1 gene, and can realize the application in the study of gene function of pig cells or individuals and disease-resistant breeding, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0023] Figure 1 The PCR product sequencing results of cells transfected with pX458-WIP1-sgRNA1, pX458-WIP1-sgRNA2 and pX458-WIP1-sgRNA3 in the effect examples are shown in Figure 1. (a), (b) and (c) represent the sequencing results of PCR products of the target regions of sgRNA-1, sgRNA-2 and sgRNA-3, respectively.

[0024] Figure 2These are the gel electrophoresis images of the PCR product digestion fragments of cells transfected with pX458-WIP1-sgRNA1, pX458-WIP1-sgRNA2 and pX458-WIP1-sgRNA3 in the effect examples, in which M represents 100 bp DNA Marker; 1 and 2 represent the digestion results of PCR products of cells transfected with pX458-WIP1-sgRNA1; 3 and 4 represent the digestion results of PCR products of cells transfected with pX458-WIP1-sgRNA2; 5 and 6 represent the digestion results of PCR products of cells transfected with pX458-WIP1-sgRNA3; 7 represents wild blank control cells; and 8 represents water. DETAILED DESCRIPTION

[0025] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0026] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly used in the field to which the present invention belongs. For the purpose of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural form, and vice versa.

[0027] Unless the context clearly dictates otherwise, the expressions "a", "an" and "an" as used herein include plural references. For example, reference to "a cell" includes a plurality of such cells and equivalents thereof known to those skilled in the art, and so forth.

[0028] As used herein, "and / or" is used to indicate that one or both of the described situations may occur, for example, A and / or B includes (A and B) and (A or B).

[0029] In this document, unless otherwise stated, arbitrary numbering is used to distinguish one entity or action from another entity or action, and does not necessarily require or imply any actual such relationship, order, or importance between such entities or actions, such as numbers (i) and (ii).

[0030] As used herein, unless otherwise stated, "optionally", "optional", "optional" or "optional" means that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs or does not occur.

[0031] Herein, the terms "comprise" or "comprising" are intended to include stated elements, integers or steps, but not to exclude any other elements, integers or steps.

[0032] The term "RNA" herein refers to a polymeric form of ribonucleotides of any length, examples of RNA include but are not limited to single-stranded, double-stranded or multi-stranded RNA. The ribonucleotides constituting RNA may be natural or non-natural, recombinant or any combination thereof, for example containing non-natural or derived purine and pyrimidine bases, or containing chemically or biochemically modified ribonucleotides. The RNA herein is allowed to be doped with deoxyribonucleotides.

[0033] The term "DNA" herein refers to a polymer form of deoxyribonucleotides of any length, and examples of DNA include but are not limited to single-stranded, double-stranded or multi-stranded RNA. The deoxyribonucleotides constituting RNA may be natural or non-natural, recombinant or any combination thereof, such as containing non-natural or derived purine and pyrimidine bases, or containing chemically or biochemically modified deoxyribonucleotides, and the DNA herein is allowed to be doped with ribonucleotides.

[0034] As used herein, the terms "polynucleotide," "nucleic acid," and "nucleic acid molecule" refer to RNA and DNA as defined above.

[0035] Herein, "Cas nuclease" refers to a Cas nuclease that can bind to a target sequence, or cut or create an incision in a target sequence, or mutate a target sequence, and the Cas nuclease includes but is not limited to a natural Cas nuclease or a polypeptide or complex containing the main functional domain of the Cas nuclease; or a mutated Cas nuclease or polypeptide; or a fusion protein containing a Cas nuclease or a Cas nuclease functional domain fused with other functional regions. The Cas nuclease includes but is not limited to Cas9, Cpf1, C2c1, C2c2, C2c3, HF Cas9, Cas12a, Cas12b, SaCas9 or SpCas9; or a protein, polypeptide or complex formed by mutation of the above Cas nuclease and / or fusion with other functional domains.

[0036] The term "vector" herein refers to a nucleic acid delivery vehicle into which a polynucleotide can be inserted. When a vector can express a protein encoded by the inserted polynucleotide, the vector is called an expression vector. The vector can be introduced into a host cell by transformation, transduction or transfection so that the genetic material elements it carries are expressed in the host cell.

[0037] The vector is well known to those skilled in the art, including but not limited to: plasmid, minicircle DNA, episomal plasmid; phagemid; cosmid; artificial chromosome, such as yeast artificial chromosome (YAC), bacterial artificial chromosome (BAC) or P1-derived artificial chromosome (PAC); bacteriophage such as lambda phage or M13 phage and animal virus, etc. Animal viruses that can be used as vectors include but are not limited to retrovirus (including lentivirus), adenovirus, adeno-associated virus, herpes virus (such as herpes simplex virus), poxvirus, baculovirus, papillomavirus, papillomavirus. In some embodiments, the vector of the present invention contains regulatory elements commonly used in genetic engineering, such as enhancers, promoters, internal ribosome entry sites (IRES) and other expression control elements (such as transcription termination signals, or polyadenylation signals and poly-U sequences, etc.).

[0038] In the first aspect, the present invention provides a sgRNA that specifically recognizes the 5'UTR region of the porcine Wip1 gene, including sgRNA-1 and / or sgRNA-2. The above sgRNA is used in the CRISPR / Cas9 system. sgRNA is a guide RNA, which is an important component of the CRISPR gene editing system. It binds to the Cas9 protein and guides the Cas9 enzyme to target genomic DNA for shearing. The sgRNA contains a target sequence and a Cas9 nuclease recruitment sequence, and the target sequence is responsible for recognizing the target fragment.

[0039] From 5' to 3' direction: the target sequence of the sgRNA-1 specifically binds to the 5'UTR region of the porcine Wip1 gene, and contains the RNA sequence shown in SEQ ID NO.1; the target sequence of the sgRNA-2 specifically binds to the 5'UTR region of the porcine Wip1 gene, and contains the RNA sequence shown in SEQ ID NO.2.

[0040] It is understandable that, in addition to the target sequence responsible for recognizing the target fragment, the sgRNA may also contain sequences with other functions, including but not limited to Cas9 nuclease recruitment sequences and connection units connecting various functional units.

[0041] In an optional embodiment, the DNA sequence of the 5'UTR region of the porcine Wip1 gene is shown as SEQ ID NO.7, the nucleotide sequence of the target fragment recognized by the sgRNA-1 is shown as SEQ ID NO.8, and the nucleotide sequence of the target fragment recognized by the sgRNA-2 is shown as SEQ ID NO.9.

[0042] When sgRNA performs its guide function, in addition to the fragment responsible for recognizing the target sequence, it also contains sequences with other functions such as Cas9 nuclease recruitment sequence, which participate in the targeted cutting of DNA by CRISPR / Cas9. Therefore, optimizing the backbone sequence of sgRNA can improve the modification efficiency of the target gene by the CRISPR / Cas9 system. Therefore, in a preferred embodiment, the complete sgRNA-1 containing the backbone contains the RNA sequence shown in SEQ ID NO.4; and / or, the complete sgRNA-2 containing the backbone contains the RNA sequence shown in SEQ ID NO.5. When sgRNA-1 containing the RNA sequence shown in SEQ ID NO.4 and sgRNA-2 containing the RNA sequence shown in SEQ ID NO.5 are used in combination with Cas9, the modification efficiency of the target gene by the CRISPR / Cas9 system is better.

[0043] In a second aspect, a DNA molecule encoding sgRNA is provided, wherein the DNA molecule is transcribed to produce the sgRNA that specifically recognizes the 5'UTR region of the porcine Wip1 gene as described in the first aspect. Each DNA molecule may optionally contain a fragment encoding sgRNA-1 and / or encoding sgRNA-2.

[0044] In an optional embodiment, the DNA molecule contains a fragment encoding the sgRNA-1 target sequence, and the nucleotide sequence is shown in SEQ ID NO. 8. In an optional embodiment, the DNA molecule contains a fragment encoding the sgRNA-1, and the nucleotide sequence is shown in SEQ ID NO.11.

[0045] In an optional embodiment, the DNA molecule contains a fragment encoding the sgRNA-2 target sequence, and the nucleotide sequence is shown in SEQ ID NO. 9. In an optional embodiment, the DNA molecule contains a fragment encoding the sgRNA-2, and the nucleotide sequence is shown in SEQ ID NO.12.

[0046] In an optional embodiment, the DNA molecule further contains a fragment encoding a Cas9 molecule.

[0047] In the third aspect, a vector is also provided, which carries the DNA molecule described in the second aspect.

[0048] In an optional embodiment, the vector is an expression vector.

[0049] In a fourth aspect, a porcine Wip1 gene editing composition is also provided, wherein the porcine Wip1 gene editing composition comprises (i) and (ii):

[0050] (i) The sgRNA that specifically recognizes the 5'UTR region of the porcine Wip1 gene as described in the first aspect, or the DNA molecule as described in the second aspect, or the vector as described in the third aspect.

[0051] (ii) Cas nuclease or a polynucleotide encoding a Cas nuclease.

[0052] In an optional embodiment, the porcine Wip1 gene editing composition comprises the sgRNA and Cas nuclease that specifically recognize the 5'UTR region of the porcine Wip1 gene.

[0053] In an optional embodiment, the porcine Wip1 gene editing composition is a ribonucleoprotein complex (RNP) formed by the sgRNA and Cas nuclease that specifically recognize the 5'UTR region of the porcine Wip1 gene.

[0054] In an optional embodiment, the porcine Wip1 gene editing composition comprises the sgRNA that specifically recognizes the 5'UTR region of the porcine Wip1 gene and RNA or DNA encoding Cas nuclease, and the RNA or DNA encoding Cas nuclease is transformed into a test cell to express the Cas nuclease.

[0055] In an optional embodiment, the porcine Wip1 gene editing composition comprises a DNA molecule encoding the sgRNA and a DNA encoding a Cas nuclease, and the DNA molecule and the DNA encoding the Cas nuclease are respectively constructed in different vectors or in the same vector. The vector is transformed into a cell to transcribe and synthesize the sgRNA and express the Cas nuclease.

[0056] In the fifth aspect, the present invention also provides the use of the sgRNA that specifically recognizes the 5'UTR region of the pig Wip1 gene as described in the first aspect, or the DNA molecule as described in the second aspect, or the vector as described in the third aspect, or the pig Wip1 gene editing composition as described in the fourth aspect in the preparation of pig gene editing products, or editing pig genes for non-diagnostic and therapeutic purposes.

[0057] In the sixth aspect, a pig gene editing kit is also provided, which contains the sgRNA that specifically recognizes the 5'UTR region of the pig Wip1 gene as described in the first aspect, or the DNA molecule as described in the second aspect, or the vector as described in the third aspect, or the pig Wip1 gene editing composition as described in the fourth aspect.

[0058] In an optional embodiment, the pig gene editing kit also contains optional reagents for gene editing known in the art, including but not limited to one or more of buffer reagents, delivery vectors, gene guns and electroporation equipment.

[0059] In alternative embodiments, the delivery vehicle comprises a liposome or a nanoparticle.

[0060] In the seventh aspect, a method for editing the porcine Wip1 gene for non-diagnostic and therapeutic purposes is also provided, the method comprising introducing the porcine Wip1 gene editing composition described in the fourth aspect into a test cell.

[0061] In an optional embodiment, the method can introduce the above-mentioned porcine Wip1 gene editing composition into the test cells by any conventional method known in the art, such as but not limited to liposome introduction, nanoparticle delivery, vector, transfection, heat shock, electrofection, transduction, gene gun or microinjection.

[0062] In an alternative embodiment, the test cells include pig testicular cells.

[0063] The present invention is further described below by means of specific examples. However, it should be understood that these examples are only used for more detailed description and should not be construed as limiting the present invention in any form.

[0064] The partial sequences involved in the following embodiments are as follows:

[0065] 1. The DNA sequence of the 5'UTR region of the Wip1 gene is shown in SEQ ID NO.7.

[0066] 2. The target sequence of sgRNA is shown in Table 1, the RNA sequence that recognizes the target sequence portion in sgRNA is shown in Table 2, the full-length sequence of sgRNA and the DNA encoding it is shown in Table 3, and the oligonucleotide DNA sequence used to construct the target sequence portion in the sgRNA vector expressing the sgRNA is shown in Table 4.

[0067] Table 1 Target sequences of sgRNA

[0068] Name Sequence (5’→3’) Sequence ID sgRNA-1 TCGGCGGAATCACTTGAACA SEQ ID NO.8 sgRNA-2 GTACTTTCCCCGATGAGCCC SEQ ID NO.9 sgRNA-3 GATGAGCCCTGGATGCAGCA SEQ ID NO.10

[0069] Table 2 RNA sequences that recognize the target sequence in sgRNA

[0070] Name Sequence (5’→3’) Sequence ID sgRNA-1 ucggcggaaucacuugaaca SEQ ID NO.1 sgRNA-2 guacuuuccccgaugagccc SEQ ID NO.2 sgRNA-3 gaugagcccuggaugcagca SEQ ID NO.3

[0071] Table 3 Full-length sequences of sgRNA and DNA encoding them

[0072]

[0073] Table 4 Oligonucleotide DNA sequences for constructing target sequence portions of sgRNA expression vectors

[0074] Name Sequence (5’→3’) Sequence ID sgRNA-1-g-up CACCGTGTTCAAGTGATTCCGCCGA SEQ ID NO.14 sgRNA-1-g-dn AAACTCGGCGGAATCACTTGAACAC SEQ ID NO.15 sgRNA-2-g-up CACCGTACTTTCCCCGATGAGCCC SEQ ID NO.16 sgRNA-2-g-dn AAACGGGCTCATCGGGGAAAGTAC SEQ ID NO.17 sgRNA-3-g-up CACCGTGCTGCATCCAGGGCTCATC SEQ ID NO.18 sgRNA-3-g-dn AAACGATGAGCCCTGGATGCAGCAC SEQ ID NO.19

[0075] Example 1

[0076] This embodiment provides a sgRNA-1 for knocking out the Wip1 gene in pig testicular cells in cooperation with the CRISPR / Cas9 system. This embodiment is for the pig Wip1 gene, and the target site region is designed according to the 20N+NGG principle, where 20N indicates that the target sequence length is 20bp, and NGG is the PAM (primitive intergenic short palindromic repeat sequence adjacent site) region. When designing sgRNA, it is necessary to ensure that the target sequence is immediately before the NGG PAM motif.

[0077] The target sequence of sgRNA-1 is shown in SEQ ID NO. 8 (see Table 1), which is the 5'UTR region of the porcine Wip1 gene.

[0078] Oligonucleotide (Oligo) DNA sequences (SEQ ID NO.14 and SEQ ID NO.15, see Table 4) were designed and synthesized according to the sgRNA targeting sequence (1 OD for each synthesis, and PAGE was selected as the purification method). Oligo DNA was annealed to form a double-stranded DNA fragment sgRNA-1-g with sticky ends.

[0079] The double-stranded DNA fragment sgRNA-1-g with sticky ends was ligated with the pX458 vector (purchased from addgene, catalog number #48138, also known as pSpCas9(BB)-2A-GFP, pX458 vector with cas9 system, vector size of 9288 bp) recovered by restriction endonuclease BsmBI to obtain the pX458-Wip1-sgRNA1 vector.

[0080] The connected recombinant plasmid was transformed, and a single colony was picked for sequencing and identification. After sequencing, the pX458-Wip1-sgRNA1 vector was obtained by inserting the coding gene of the sequence shown in SEQ ID NO.8 into the pX458 vector, and fused with the fragment on the vector to express the DNA encoding sgRNA-1 as shown in SEQ ID NO.11. The vector expressed the full-length sgRNA-1 as shown in SEQ ID NO.4, wherein the target sequence RNA sequence is shown in SEQ ID NO.1 (see Tables 2 and 3).

[0081] Example 2

[0082] This embodiment provides a sgRNA-2 for knocking out the Wip1 gene in pig testicular cells in cooperation with the CRISPR / Cas9 system. This embodiment is directed to the pig Wip1 gene, and the target site region is designed according to the 20N+NGG principle.

[0083] The target sequence of sgRNA-2 is shown in SEQ ID NO. 9 (see Table 1), which is the 5'UTR region of the porcine Wip1 gene.

[0084] Oligonucleotide (Oligo) DNA sequences (SEQ ID NO.16 and SEQ ID NO.17, see Table 4) were designed and synthesized according to the sgRNA targeting sequence (1 OD for each synthesis, and PAGE was selected as the purification method). Oligo DNA was annealed to form a double-stranded DNA fragment sgRNA-2-g with sticky ends.

[0085] The double-stranded DNA fragment sgRNA-2-g with sticky ends was ligated to the pX458 vector (addgene #48138) recovered by digestion with the restriction endonuclease BsmBI to obtain the pX458-Wip1-sgRNA2 vector.

[0086] The connected recombinant plasmid was transformed, and a single colony was picked for sequencing and identification. After sequencing, the pX458-Wip1-sgRNA2 vector was obtained by inserting the coding gene of the sequence shown in SEQ ID NO.9 into the pX458 vector, and fused with the fragment on the vector to express the DNA encoding sgRNA-2 as shown in SEQ ID NO.12. The vector expressed the full-length sgRNA-2 as shown in SEQ ID NO.5, wherein the target sequence RNA sequence is shown in SEQ ID NO.2 (see Tables 2 and 3).

[0087] Comparative Example 1

[0088] This comparative example provides an sgRNA-3 for knocking out the Wip1 gene in pig testicular cells in cooperation with the CRISPR / Cas9 system. This comparative example is aimed at the pig Wip1 gene, and the target site region is designed according to the 20N+NGG principle.

[0089] The target sequence of sgRNA-3 is shown in SEQ ID NO. 10 (see Table 1), which is the 5'UTR region of the porcine Wip1 gene.

[0090] Oligonucleotide (Oligo) DNA sequences (SEQ ID NO.18 and SEQ ID NO.19, see Table 4) were designed and synthesized according to the sgRNA targeting sequence (1 OD for each synthesis, and PAGE was selected as the purification method). Oligo DNA was annealed to form a double-stranded DNA fragment sgRNA-3-g with sticky ends.

[0091] The double-stranded DNA fragment sgRNA-3-g with sticky ends was ligated to the pX458 vector (addgene #48138) recovered by digestion with the restriction endonuclease BsmBI to obtain the pX458-Wip1-sgRNA3 vector.

[0092] The connected recombinant plasmid was transformed, and a single colony was picked for sequencing and identification. After sequencing, the pX458-Wip1-sgRNA3 vector was obtained by inserting the coding gene of the sequence shown in SEQ ID NO.10 into the pX458 vector, and fused with the fragment on the vector to express the DNA encoding sgRNA-3 as shown in SEQ ID NO.13. The vector expressed the full-length sgRNA-3 as shown in SEQ ID NO.6, wherein the target sequence RNA sequence is shown in SEQ ID NO.3 (see Tables 2 and 3).

[0093] Effect example

[0094] 1. Obtaining gene-edited pig testicular cells (ST cells)

[0095] When the cell confluence reached about 80%, 5 ug of the pX458-Wip1-sgRNA1 vector, pX458-Wip1-sgRNA2 vector, and pX458-Wip1-sgRNA3 vector prepared in Examples 1 and 2 and Comparative Example 1 were electro-transfected into ST cells to obtain pX458-Wip1-sgRNA1 transfected cells, pX458-Wip1-sgRNA2 transfected cells, and pX458-Wip1-sgRNA3 transfected cells.

[0096] 2. Detection of Wip1 gene sgRNA activity

[0097] The cells were collected and lysed 48 hours after transfection, and the lysate was used as a template to amplify the region near the Wip1 gene sgRNA. The product size was 680 bp, and the amplification primers were shown in Table 5 below:

[0098] Table 5 Amplification primer sequences

[0099] Primer Name Primer Sequence (5'-3') Number Wip1-sgRNA-F GCTTTCGCTTTGCAGTGGG SEQ ID NO.20 Wip1-sgRNA-R AACTGACCTGCCAACTCTGA SEQ ID NO.21

[0100] Some PCR products were sent to the company for sequencing. The sequencing results were as follows Figure 1As shown in the figure, the red box is the PAM region of the sgRNA, and the position selected in blue is the position where the sgRNA produces cutting. In the sequencing peak graph, when a stray peak appears near the PAM, it indicates that the sgRNA has cutting activity, and the absence of a stray peak indicates that the sgRNA does not produce cutting on the sequence, that is, it has no cutting activity. It can be seen that stray peaks appear when transfected with pX458-Wip1-sgRNA1 vector and pX458-Wip1-sgRNA2 vector, and no stray peaks appear when transfected with pX458-Wip1-sgRNA3 vector, indicating that sgRNA-1 and sgRNA-2 have cutting activity.

[0101] The PCR amplification product was denatured and annealed, and T7E1 enzyme and buffer were added for enzyme digestion reaction. The digestion product was subjected to polyacrylamide gel electrophoresis, and the cutting efficiency was calculated using ImageJ software. Figure 2 As shown in the figure, after T7E1 enzyme cutting, the PCR product of sgRNA-1 showed three bands of 680bp, 503bp and 177bp, indicating that sgRNA-1 produced base sequence mutations in the target site region. The PCR product of sgRNA-2 showed three bands of 680bp, 476bp and 204bp, indicating that sgRNA-2 produced base sequence mutations in the target site region. The band brightness was calculated by ImageJ software, and the cutting efficiency of sgRNA-1 was about 24%, and the cutting efficiency of sgRNA-2 was about 27%.

[0102] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. An sgRNA that specifically recognizes the 5'UTR region of the porcine Wip1 gene, characterized in that: including sgRNA-1 and / or sgRNA-2; The target sequence of the sgRNA-1 specifically binds to the 5'UTR region of the porcine Wip1 gene and contains the RNA sequence shown in SEQ ID NO.1; The target sequence of the sgRNA-2 specifically binds to the 5'UTR region of the porcine Wip1 gene and contains the RNA sequence shown in SEQ ID NO.

2.

2. The sgRNA according to claim 1, characterized in that The DNA sequence of the 5'UTR region of the porcine Wipl gene is shown in SEQ ID NO.

7.

3. The sgRNA according to claim 1 or 2, characterized in that The sgRNA-1 contains the RNA sequence shown in SEQ ID NO.4; and / or, the sgRNA-2 contains the RNA sequence shown in SEQ ID NO.

5.

4. A DNA molecule encoding sgRNA, characterized in that The DNA molecule is transcribed to produce the sgRNA that specifically recognizes the 5'UTR region of the pig Wip1 gene according to any one of claims 1 to 3.

5. The DNA molecule according to claim 4, characterized in that The DNA molecule contains a fragment encoding the sgRNA-1 target sequence, and the nucleotide sequence is shown in SEQ ID NO.8; and / or, the DNA molecule contains a fragment encoding the sgRNA-2 target sequence, and the nucleotide sequence is shown in SEQ ID NO.9; Optionally, the DNA molecule contains a fragment encoding the sgRNA-1, and the nucleotide sequence is shown in SEQ ID NO.11; and / or, the DNA molecule contains a fragment encoding the sgRNA-2, and the nucleotide sequence is shown in SEQ ID NO.12; Optionally, the DNA molecule also contains a fragment encoding a Cas9 molecule.

6. A carrier, characterized in that Carrying the DNA molecule according to claim 4 or 5.

7. A porcine Wip1 gene editing composition, characterized in that: Contains (i) and (ii): (i) the sgRNA that specifically recognizes the 5'UTR region of the porcine Wip1 gene according to any one of claims 1 to 3, or the DNA molecule according to claim 4 or 5, or the vector according to claim 6; (ii) Cas nuclease or a polynucleotide encoding a Cas nuclease.

8. Use of the sgRNA that specifically recognizes the 5'UTR region of the porcine Wip1 gene as described in any one of claims 1 to 3, or the DNA molecule as described in claim 4 or 5, or the vector as described in claim 6, or the porcine Wip1 gene editing composition as described in claim 7 in the preparation of porcine gene editing products, or in editing porcine genes for non-diagnostic and therapeutic purposes.

9. A pig gene editing kit, characterized in that: A composition for editing the porcine Wip1 gene comprising the sgRNA that specifically recognizes the 5'UTR region of the porcine Wip1 gene as described in any one of claims 1 to 3, or the DNA molecule as described in claim 4 or 5, or the vector as described in claim 6, or the porcine Wip1 gene as described in claim 7.

10. A method for editing the porcine Wip1 gene for non-diagnostic and therapeutic purposes, characterized in that It comprises introducing the porcine Wip1 gene editing composition of claim 7 into a test cell.

Images