Gene Aokap10, method and application for improving kojic acid production of Aspergillus oryzae
Targeted gene editing of the Aokap10 gene in Aspergillus oryzae using CRISPR/Cas9 technology enhances citric acid production, overcoming the limitations of traditional mutagenesis methods.
Patent Information
- Application Number
- CN202411583810.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-07
- Publication Date
- 2025-07-15
- Estimated Expiration
- 2044-11-07
AI Technical Summary
In the prior art, the yield of koji acid aspergillus oryzae is not high, and the traditional mutagenesis screening effect is limited. It is necessary to improve the yield of koji acid through genetic engineering, but there is a lack of clear genetic targets.
Through gene editing technology, the CRISPR/Cas9 system is used to target the knockout of Aspergillus oryzae Aokap10 gene, destroying the biological function of its encoding protein, and constructing a highly yielded Konolic acid-engineered strain.
The production of Aspergillus oryzae is significantly improved, the construction efficiency of engineering strains of kojic acid production is improved, and the genetic improvement of kojic acid production is achieved.
Smart Images

Figure CN119464321B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and particularly relates to the gene Aokap10 for improving the kojic acid production of Aspergillus oryzae, methods and applications thereof. Background Art
[0002] Aspergillus oryzae is a filamentous fungus with important production and application value. Aspergillus oryzae has been used for hundreds of years in the production of traditional fermented foods such as soy sauce and rice wine and is considered a GRAS strain. Due to its strong protein production and secretion ability, it is used as a host for protein production. In addition, Aspergillus oryzae can also be used to produce some secondary metabolites with important application value, such as kojic acid.
[0003] Kojic acid is an organic acid with various uses. Due to its biological activities such as antibacterial, antioxidant, and inhibiting tyrosinase, it is widely used in the fields of food, medicine, agriculture, and cosmetics. Currently, kojic acid is mainly produced by Aspergillus oryzae through fermentation of sugars. However, the kojic acid production of Aspergillus oryzae isolated from nature is generally not high, and it is usually necessary to carry out mutagenesis screening for high-yield kojic acid strains. At present, research shows that the effect of mutagenesis to improve kojic acid production is becoming less and less obvious. Therefore, compared with traditional mutagenesis to improve kojic acid production, genetic engineering to genetically modify Aspergillus oryzae and increase its kojic acid production is a more advantageous means. However, the premise of genetically modifying Aspergillus oryzae by genetic engineering and increasing kojic acid production is to clarify the gene targets for increasing kojic acid production. Therefore, it is urgent to deeply study the kojic acid synthesis regulation mechanism to provide excellent gene targets for realizing efficient biosynthesis of kojic acid. Summary of the Invention
[0004] To solve the above technical problems, the present invention provides the gene Aokap10 for improving the kojic acid production of Aspergillus oryzae, methods and applications thereof.
[0005] The technical solution adopted by the present invention to achieve the technical purpose is as follows:
[0006] In a first aspect, the present invention provides the gene Aokap10 for improving the kojic acid production of Aspergillus oryzae, and the encoded protein of the gene Aokap10 has any one of the following amino acid sequences:
[0007] A1) The amino acid sequence shown in SEQ ID NO.1;
[0008] A2) A protein obtained by substituting and / or deleting and / or adding amino acid residues to the amino acid sequence shown in SEQ ID No.1, having more than 75% identity with the protein shown in A1) and having the same function;
[0009] A3) A protein obtained by connecting a tag to the N-terminus and / or C-terminus of A1) or A2) and having the same function.
[0010] A person of ordinary skill in the art can easily use known methods, such as directed evolution or site-directed mutagenesis, to mutate the nucleotide sequence encoding protein Aokap10 of the present invention. Those nucleotides that have been artificially modified and have 75% or more identity with the nucleotide sequence of protein Aokap10 isolated from the present invention, as long as they encode protein Aokap10 and have the function of protein Aokap10, are all derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention.
[0011] The above-mentioned 75% or more identity can be 80%, 85%, 90% or more than 95% identity.
[0012] In the present invention, the identity of more than 80% can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.
[0013] In order to facilitate the purification or detection of the protein in, a tag protein can be linked to the amino terminus or carboxyl terminus of the protein composed of the amino acid sequence shown in SEQ ID No.1 in the sequence listing.
[0014] The tag protein includes but is not limited to: GST (glutathione S-transferase), His6 tag protein (histidine tag protein), MBP (maltose binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow fluorescent protein) or mCherry (monomeric red fluorescent protein).
[0015] In a second aspect, the present invention provides gene Aokap10 for increasing the kojic acid production of Aspergillus oryzae, and the gene Aokap10 has any one of the following nucleotide sequences:
[0016] C1) The coding sequence is the cDNA molecule of SEQ ID No.2;
[0017] C2) The nucleotide sequence is the DNA molecule of SEQ ID No.2;
[0018] C3) A nucleic acid molecule obtained by modifying codon preference based on the nucleotide sequence shown in SEQ ID No.2;
[0019] C4) A nucleic acid molecule having a consistency of more than 95% with the nucleotide sequence shown in SEQ ID No.2 and derived from the same species.
[0020] The gene Aokap10 described in the present invention can be any nucleotide sequence capable of encoding the encoded protein of the above-mentioned gene Aokap10. Considering the degeneracy of codons and the codon preference of different species, those skilled in the art can use codons suitable for expression in a specific species as needed.
[0021] In a third aspect, the present invention provides a biological material related to the regulation of the expression of gene Aokap10, and the biological material includes a nucleic acid capable of disrupting the biological function of the encoded protein of gene Aokap10.
[0022] Among them, the biological material related to the regulation of the expression of gene Aokap10 can be a substance that performs at least one of the following 6 types of regulations:
[0023] 1) Regulation carried out at the transcriptional level of the gene; 2) Regulation carried out after gene transcription (that is, regulation of the splicing or processing of the primary transcript of the gene); 3) Regulation of the RNA transport of the gene (that is, regulation of the transport of the mRNA of the gene from the nucleus to the cytoplasm); 4) Regulation of the translation of the gene; 5) Regulation of the degradation of the mRNA of the gene; 6) Regulation after translation of the gene (that is, regulation of the activity of the protein translated from the gene).
[0024] Furthermore, the regulation of gene expression can be to inhibit or reduce the expression of the gene, and the inhibition or reduction of the gene expression can be achieved by gene knockout or by gene silencing.
[0025] The so-called gene knockout refers to the phenomenon of inactivating a specific target gene through homologous recombination. Gene knockout inactivates a specific target gene by changing the DNA sequence.
[0026] The so-called gene silencing refers to the phenomenon of gene non-expression or low expression without damaging the original DNA. Gene silencing enables gene non-expression or low expression on the premise of not changing the DNA sequence. Gene silencing can occur at two levels. One is transcriptional gene silencing caused by DNA methylation, heterochromatinization, and position effects, etc. The other is post-transcriptional gene silencing, that is, at the post-transcriptional level of the gene, the gene is inactivated by specifically inhibiting the target RNA, including antisense RNA, co-suppression, quelling, RNA interference (RNAi), and translation inhibition mediated by microRNA (miRNA), etc.
[0027] In the present invention, the nucleic acid may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA or antisense RNA.
[0028] Preferably, the nucleic acid includes sgRNA for mutating the gene Aokap10, and the target sequence of the sgRNA is the 198th to 217th positions of the sequence shown in SEQ ID NO.2.
[0029] More preferably, the biological material further includes an expression cassette, a vector, a host cell, an engineered bacterium or a transgenic plant cell line containing the nucleic acid.
[0030] The vector in the present invention is well known to those skilled in the art, including but not limited to: plasmids, phages (such as λ phage or M13 filamentous phage, etc.), cosmids (i.e., cosmid plasmids), Ti plasmids, viral vectors, etc.
[0031] In one embodiment of the present invention, the vector may be a pPRTII-Cas9 vector.
[0032] The recombinant vector in the present invention may specifically be pPRTII-Cas9-Aokap10. The recombinant vector pPRTII-Cas9-Aokap10 contains an editing target site (the 198th - 217th positions of SEQ ID No.2) and the coding gene of Cas9 protein. After being introduced into the recipient Aspergillus oryzae, the transcribed guide RNA (sgRNA) can target the target sequence (target site) near PAM in the genome of the recipient Aspergillus oryzae through base complementary pairing, that is, target the Aokap10 gene, and edit (targeted mutation) the Aokap10 gene, thereby achieving the knockout of the Aokap10 gene.
[0033] Fourthly, the present invention provides a method for regulating kojic acid synthesis of Aspergillus oryzae or constructing a high-yield kojic acid engineering strain, including: by destroying the biological function of the encoded protein of the gene Aokap10, increasing the kojic acid yield of Aspergillus oryzae.
[0034] The above-mentioned destruction of the biological function of the encoded protein of the gene Aokap10 can be achieved by conventional technical means in the art. For example, using gene mutation, gene knockout, gene editing or gene knockdown techniques to reduce or inactivate the coding gene activity of the protein Aokap10 in the genome of the target fungus.
[0035] Preferably, the biological function of the encoded protein of the gene Aokap10 is disrupted using the CRISRP / Cas9 technology; the target sequence of the sgRNA used in the CRISRP / Cas9 technology is the 198th to 217th positions of the sequence shown in SEQ ID NO.2.
[0036] More preferably, in one embodiment of the present invention, the above method comprises:
[0037] (1) Construct a CRISPR / Cas9 recombinant vector targeting and editing the 198th to 217th positions of SEQ ID No.2;
[0038] (2) Introduce the recombinant vector constructed in step (1) into the target fungus (such as Aspergillus oryzae);
[0039] (3) Obtain a transgenic fungus with kojic acid production higher than that of the target fungus through screening and identification.
[0040] Preferably, in step (1) above, the CRISRP / Cas9 gene editing plasmid is a type II CRISPR system.
[0041] Preferably, in step (2) above, the CRISRP / Cas9 gene editing plasmid constructed in step (1) is introduced into Aspergillus oryzae by means of protoplasts.
[0042] Preferably, in step (3) above, the specific method of the identification is: amplify the transformed Aspergillus oryzae Aokap10 gene fragment using the specific primers of the Aspergillus oryzae Aokap10 gene and perform sequencing. If an insertion or deletion mutation occurs in the nucleic acid sequence at the 198th to 217th positions of the sequence shown in SEQ ID NO.2, it indicates that the biological function of the Aspergillus oryzae Aokap10 gene is disrupted.
[0043] The host cell of the present invention is a filamentous fungal host cell Aspergillus oryzae, preferably a filamentous fungal host cell of the genus Aspergillus, including but not limited to Aspergillus oryzae.
[0044] In a fifth aspect, the present invention provides the application of the above gene Aokap10, its encoded protein or the above biological material in regulating kojic acid synthesis in Aspergillus oryzae or constructing a high-kojic acid-producing engineering bacterium.
[0045] Preferably, in the above application, the kojic acid production of Aspergillus oryzae is increased by disrupting the biological function of the encoded protein of the gene Aokap10.
[0046] The beneficial effects of the present invention are as follows:
[0047] (1) The present invention provides a new gene, Aokap10 gene, which can improve the kojic acid content of Aspergillus oryzae. By gene editing the Aokap10 gene, the kojic acid production of Aspergillus oryzae can be significantly increased. Experiments have proved that the Aokap10 gene has the function of improving the kojic acid production of Aspergillus oryzae. By destroying the biological function of the protein encoded by the Aokap10 gene, the kojic acid production of Aspergillus oryzae can be significantly promoted. The present invention provides an important functional gene for the genetic improvement of the kojic acid production of Aspergillus oryzae.
[0048] (2) The present invention realizes the efficient site-directed knockout of Aokap10 through gene editing technology. The present invention discovers that the nucleotide sequence from the 198th to the 217th position in the Aspergillus oryzae Aokap10 gene can be used as a target sequence to efficiently achieve the site-directed knockout of the Aokap10 gene. Insertion or deletion at the 198th to the 217th position of the sequence shown in SEQ ID NO.2 will cause the destruction of the protein encoded by the Aokap10 gene, improve the kojic acid production of Aspergillus oryzae, and effectively improve the construction efficiency of high-kojic acid engineering strains based on the mutation of the Aokap10 gene. BRIEF DESCRIPTION OF THE DRAWINGS
[0049] Figure 1 Mutation types of the nucleotide sequence of the Aokap10 gene in the homozygous mutant strain of the Aokap10 gene under the background of wild-type Aspergillus oryzae 3.042.
[0050] Figure 2 Mutation types of the amino acid sequence of the Aokap10 gene in the homozygous mutant strain of the Aokap10 gene under the background of wild-type Aspergillus oryzae 3.042.
[0051] Figure 3 Analysis of kojic acid production in wild-type Aspergillus oryzae 3.042 and the homozygous mutant strain of the Aokap10 gene. DETAILED DESCRIPTION OF THE EMBODIMENTS
[0052] The present invention will be further described in detail below in conjunction with the specific embodiments. The embodiments given are only for clarifying the present invention, rather than limiting the scope of the present invention. The following embodiments can be used as a guide for those of ordinary skill in the art to make further improvements, and do not limit the present invention in any way.
[0053] The experimental methods in the following embodiments are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.
[0054] The Aspergillus oryzae strains in the following embodiments: Aspergillus oryzae 3.042 (CICC 40092) can be obtained by the public from the China Center for Industrial Culture Collection of Microorganisms.
[0055] In the embodiments of the present invention, the CRISPR-Cas9 vector is the pPRTII-Cas9 vector, which has been described in Yuzhen Li # , Huanxin Zhang # , Junxia Fan # , Ziming Chen, Tianming Chen, Bin Zeng, Zhe Zhang*A highly efficient identification of mutants generated by CRISPR / Cas9 using the non-functional DsRed assisted selection in Aspergillus oryzae, World Journal of Microbiology and Biotechnology, 2021, 37:132. The public can obtain it from the College of Life Sciences, Jiangxi University of Science and Technology. This biological material is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.
[0056] The primer sequences used in the present invention are shown in Table 1 below.
[0057] Table 1. Primer sequence information in the present invention
[0058]
[0059]
[0060] Example 1. Construction of the Aokap10 gene editing knockout vector
[0061] According to the coding sequence (SEQ ID No. 2) of the AO090023000796 gene (Aokap10 gene), the primer sequences of the Aokap10 gene knockout target sites were designed through the CRISPRdirect web server (https: / / crispr.dbcls.jp / ). The target site primer sequences are as follows:
[0062] TU6-Aokap10-F: TATCCCCGTTGCTGCCGTGAGTTTTAGAGCTAGAAATAGCAAGTTAAA
[0063] 1. Obtaining of the U6 promoter (PU6), gRNA and U6 terminator (TU6)
[0064] When amplifying the PU6 fragment: Using the genomic DNA of Aspergillus oryzae RIB40 strain as a template, and PU6-F and PU6-Aokap10-R as primers, the amplification system is shown in Table 2 to obtain the PU6-Aokap10 fragment.
[0065] When amplifying gRNA and TU6, using the previously constructed vector pPTRII-Cas9-kojA as a template (this vector contains the sgRNA and U6 terminator sequences, specifically described in Yuzhen Li # , Huanxin Zhang # , Junxia Fan # , Ziming Chen, Tianming Chen, Bin Zeng, Zhe Zhang * A highly efficient identification of mutants generated by CRISPR / Cas9 using the non-functional DsRed assisted selection in Aspergillus oryzae, World Journal of Microbiology and Biotechnology, 2021, 37:132), using TU6-Aokap10-F and TU6-R as primers, perform PCR amplification (the amplification system is shown in Table 2) to obtain Aokap10-sgRNA-TU6.
[0066] Table 2. 50 μl amplification system of U6 promoter
[0067]
[0068] Amplification conditions: Pre-denaturation at 95°C for 30 s, denaturation at 95°C for 10 s, annealing at 55°C for 30 s, extension at 72°C for 5 min, 35 cycles, and final extension at 72°C for 5 min.
[0069] 2. Obtaining the gRNA expression cassette targeting Aokap10
[0070] Take 1 μL of each of the PU6-Aokap10 and Aokap10-sgRNA-TU6 PCR products as templates, and use PU6-F and TU6-R as primers to perform overlapping PCR amplification (the overlapping PCR amplification system is shown in Table 3). Obtain the gRNA expression cassette PU6-Aokap10-sgRNA-TU6 targeting Aokap10.
[0071] Table 3. Overlapping PCR amplification system
[0072]
[0073] Amplification conditions: Pre-denaturation at 95°C for 2 min, denaturation at 95°C for 10 s, annealing at 55°C for 30 s, and extension at 72°C for 5 min. After 5 cycles, add 4 μl of primers (mixture of PU6-F and TU6-R (10 μM)), and continue amplification for 30 cycles to obtain the sgRNA expression cassette PU6-Aokap10-sgRNA-TU6 containing the Aokap10 gene targeting sequence.
[0074] 3. Obtaining the CRISPR-Cas9 knockout vector of the Aokap10 gene
[0075] 3.1 Digestion of the CRISPR-Cas9 knockout vector pPTRII-Cas9
[0076] Digest the pPTRII-Cas9 plasmid with Sma I (the digestion system is shown in Table 4), and recover the digested product to obtain the linearized pPTRII-Cas9 fragment.
[0077] Table 4. Digestion system of the pPRTII-Cas9 vector
[0078]
[0079] Incubate at 37°C for 1 hour.
[0080] 3.2 Recombinant ligation
[0081] The ligase used is the recombinase. Use the recombinase to recombinantly ligate the linearized pPTRII-Cas9 fragment with the PU6-Aokap10-TU6 expression cassette to obtain the recombinant plasmid pPTRII-Cas9-Aokap10 (the recombinant ligation reaction system is shown in Table 5).
[0082] Table 5. Recombinant ligation reaction system
[0083]
[0084] React at 37°C for 30 min, and after the reaction, cool to 4°C or immediately place on ice to cool.
[0085] 3.3 Transformation of the recombinant vector into Escherichia coli
[0086] 1) Take 50 μl of Escherichia coli competent Trans10 stored at -80°C, add 2 μl of the above recombinant ligation product, mix well, and place on ice for 30 min;
[0087] 2) Incubate in a 42°C water bath for 45 s, and let it stand on ice for 2 min;
[0088] 3) Add 500 μl of antibiotic-free LB liquid medium to competent Escherichia coli Trans10 and culture at 37 °C with 200 rpm for 1 hour;
[0089] 4) Centrifuge at 5000 rpm for 2 min, take 200 μl of the supernatant, mix well, spread the bacterial solution on LB solid medium containing ampicillin antibiotic, and culture overnight at 37 °C;
[0090] 3.4 Identification of positive monoclonal
[0091] Pick up Escherichia coli monoclonal on the solid plate with a sterilized micropipette tip and put it into a centrifuge tube containing 1000 μl of ampicillin LB liquid medium, culture at 37 °C with 200 rpm for 6 - 8 hours. Then take 2 μl of the bacterial solution as a template and perform colony PCR detection using PU6-F / TU6-R. The PCR amplification system for bacterial solution is shown in Table 6.
[0092] Table 6. PCR amplification system for bacterial solution
[0093]
[0094] Amplification conditions: pre-denaturation at 95 °C for 2 min, denaturation at 95 °C for 10 s, annealing at 55 °C for 30 s, extension at 72 °C for 30 s, 35 cycles, and final extension at 72 °C for 5 min.
[0095] Detect the PCR products by electrophoresis, select the positive clones, send them for sequencing, and obtain the correct CRISPR-Cas9-Aokap10-1 after sequencing.
[0096] 3.5 Plasmid extraction
[0097] Extract the plasmid according to the instructions of the endotoxin-free plasmid mini-prep midiprep kit (TIANGEN, DP118) to obtain the CRISPR-Cas9-Aokap10-1 plasmid.
[0098] Example 2. Obtaining of Aokap10 knockout bacteria
[0099] 1. Protoplast transformation of Aspergillus oryzae
[0100] 1) Prepare 100 ml of DPY liquid medium (2% glucose, 1% peptone, 0.5% yeast extract, 0.5% KH2PO4, 0.05% MgSO4·7H2O, pH 5.5), inoculate the freshly harvested spores of Aspergillus oryzae 3.042 into the DPY liquid medium, and culture at 200 rpm for 16 - 20 h. Then collect the mycelia and wash them once with the buffer (50 mM maleic acid, 0.6 M (NH4)2SO4, pH 5.5);
[0101] 2) Prepare an enzyme solution containing 1% Yatalase (TaKaRa) and 1.5% lysing enzyme (Sigma) in 10 ml to lyse the above mycelia at 30 °C, 60 rpm for 3 h;
[0102] 3) Resuspend the protoplasts with washing buffer (1.2 M sorbitol, 50 mM CaCl₂·2H₂O, 35 mM NaCl, 10 mM Tris-HCl, pH 7.5), centrifuge at 2,000 rpm for 8 min at 4 °C to collect the protoplasts, resuspend the protoplasts with washing buffer, and place on ice;
[0103] Mix 10 μg of pPTRII-Cas9-Aokap10-1 with 200 μl of protoplasts and incubate on ice for 30 min. Then add PEG buffer (60% PEG 4000, 50 mM CaCl₂·2H₂O, 10 mM Tris-HCl, pH 7.5) in three portions (250 μl, 250 μl, 850 μl), gently mix, and let stand at room temperature for 10 - 20 min;
[0104] Dilute the PEG-treated protoplasts with washing buffer, centrifuge at 1,000 rpm for 8 min at 4 °C to collect the protoplasts, then add M+Met medium (0.2% NH₄Cl, 0.1% (NH₄)₂SO₄, 0.05% KCl, 0.05% NaCl, 0.1% KH₂PO₄, 0.05% MgSO₄·7H₂O, 0.002% FeSO₄·7H₂O, 2% glucose, 0.15% methionine, 1.2 M sorbitol, pH 5.5) containing 1.2 M sorbitol and 0.5% agar, mix well, spread on a plate of M+Met medium containing 1.2 M sorbitol and 1.5% agar, and culture at 30 °C for 3 - 5 days.
[0105] 2. Screening and identification of positive strains
[0106] Screening of positive strains: Transfer the mycelia grown on the M+Met solid medium to a solid medium containing CD + 0.1 μg / ml pyrithiamine (PT) for screening, and culture at 30 °C for 3 - 5 days.
[0107] PCR identification of positive strains: Pick the mycelia on the CD+PT screening medium, put them into a centrifuge tube, add 100 μl of 25 mM NaOH, and boil at 100 °C for 20 minutes. Take the supernatant as the template and amplify with primers CRISPR-S-Aokap10-F / R (SEQ ID NO.7 and SEQ ID NO.8).
[0108] The amplification system is as follows: supernatant DNA template: 2 μl; CRISPR-S-Aokap10-F / R: 4 μl; dNTPs: 4 μl; 2× Buffer: 25 μl; KOD DNA polymerase: 1 μl; ddH2O: 14 μl.
[0109] PCR amplification program: pre-denaturation at 94 °C for 2 s, denaturation at 98 °C for 10 s, annealing at 55 °C for 30 s, extension at 68 °C for 30 s, 35 cycles, and final extension at 72 °C for 5 min.
[0110] The obtained PCR product stock solution was directly sent for testing. By sequencing the DNA sequences of the Aokap10 target regions of multiple positive transformation events, it was found that the sequences of the Aokap10 target regions of 2 positive strains (ΔAokap10-1 and ΔAokap10-2) had changed. The sequences before and after editing are as Figure 1 and 2 shown.
[0111] Nucleotide sequence alignment analysis revealed that compared with the unedited wild type (WT), the Aokap10 gene in the ΔAokap10-1 mutant had a deletion mutation (deletion of 1 base) at the target site, and the Aokap10 gene in the ΔAokap10-2 mutant had a deletion mutation (deletion of 123 bases) at the target site. These mutations caused frameshift or deletion of amino acids, so the protein functions of the Aokap10 gene in both Aokap10 mutants were absent.
[0112] Example 3. Determination of kojic acid production of Aokap10 knockout bacteria
[0113] The method for using the Aspergillus oryzae Aokap10 knockout bacteria constructed by the present invention for fermentative production of kojic acid is as follows:
[0114] Fermentation medium: 100 g / L glucose, 1 g / L dipotassium hydrogen phosphate, 0.5 g / L magnesium sulfate, 0.5 g / L potassium chloride, 1 g / L yeast extract.
[0115] Fermentation method: First, spread the Aokap10 knockout bacteria spore solution on the solid fermentation medium and culture at 30 °C. After 3 days, add an appropriate amount of sterile water, wash the spores on the medium, filter with lens paper, and collect the spore solution. Then, count the number of spores in the spore solution using a hemocytometer and inoculate at 1×10 7 spores / ml into 40 ml of liquid fermentation medium, and ferment at 30 °C and 200 rpm for 7 days.
[0116] Determination of kojic acid content by ferric sulfate colorimetric method: Take 2 ml of the fermentation supernatant and centrifuge to remove impurities in the fermentation broth. Color development system: 0.5 ml of the fermentation supernatant, 1 ml of the color reagent (0.06 M FeCl3 and 0.27 M HCl), 0.5 ml of ddH2O. Use water instead of the fermentation supernatant as a control, and measure its absorbance at a wavelength of 500 nm. Finally, calculate the kojic acid content of the sample using the kojic acid standard curve.
[0117] As shown by the kojic acid color development results, compared with the fermentation broth of the wild-type 3.042 strain, the fermentation broth of the Aokap10 knockout strain showed a deeper red color ( Figure 3 A), indicating that the knockout of Aokap10 promotes the synthesis of kojic acid by Aspergillus oryzae. The determination of kojic acid content showed that, compared with the wild-type 3.042 strain, the kojic acid production of the Aokap10 knockout strain increased by 131%, and the average content reached 37.02 mg / ml·g, as Figure 3 shown in B.
[0118] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations, and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to include any changes, uses, or improvements to the present invention, including changes made using conventional techniques known in the art that depart from the scope disclosed in this application.
Claims
1. A method for regulating kojic acid synthesis in Aspergillus oryzae ( Aspergillus oryzae ) or constructing a high-yield kojic acid engineering strain, comprising: By disrupting the gene Aokap10 to improve the kojic acid production of Aspergillus oryzae by disrupting the biological function of the encoded protein of the gene, wherein the encoded protein of the gene Aokap10 is a protein having the amino acid sequence shown in SEQ ID NO.
1.
2. The method according to claim 1, wherein Disrupt the biological function of the encoded protein of the gene using the CRISRP / Cas9 technology Aokap10 The target sequence of the sgRNA used in the CRISRP / Cas9 technology is the 198th to 217th positions of the sequence shown in SEQ ID NO.2 3. The method according to claim 2, wherein comprises the following steps: (1) Construct a CRISPR / Cas9 recombinant vector targeting the 198th to 217th positions of SEQ ID No. 2; (2) Introduce the recombinant vector constructed in step (1) into the target fungus; (3) Obtain a transgenic fungus with kojic acid production higher than that of the target fungus through screening and identification.
4. Gene Aokap10 and its encoded protein in regulating kojic acid synthesis of Aspergillus oryzae or constructing a high-yield kojic acid engineering bacterium. By disrupting the biological function of the encoded protein of gene Aokap10 , the kojic acid yield of Aspergillus oryzae is increased. The encoded protein of the gene Aokap10 is a protein with the amino acid sequence shown in SEQ ID NO.1.