Truncated alginate lyase MHALY-T as well as preparation method and application thereof

Abstract

The invention belongs to the technical field of alginate lyase preparation, and particularly relates to truncated alginate lyase MHALY-T as well as a preparation method and application thereof. The invention provides truncated alginate lyase MHALY-T, and the nucleotide sequence of the truncated alginate lyase MHALY-T is as shown in SEQ ID NO. 2. The obtained alginate lyase has high hydrolytic activity on sodium alginate, the crude enzyme liquid generated through shake flask fermentation has the capacity of degrading 10 g of sodium alginate through 1 mL of crude enzyme liquid (the protein content is about 0.23 mg), and the alginate lyase has the application potential of large-scale preparation of alginate oligosaccharide and has good industrial application prospects.

Description

Technical Field

[0001] The invention belongs to the technical field of alginate lyase preparation, and particularly relates to a truncated alginate lyase MHALY-T and a preparation method and application thereof. Background Art

[0002] Alginic acid is a heteropolysaccharide formed by connecting α-L-guluronic acid and β-D-mannuronic acid through α- / β-1,4 glycosidic bonds, and is the main component of the cell wall of brown algae. Alginic acid and its salts have been widely used in food, chemical and pharmaceutical fields due to their high viscosity and easy gel formation. The degradation product of alginic acid, alginic oligosaccharides, also have broad application prospects in agriculture and food fields due to their low molecular weight and specific biological activity. Alginic acid lyase can cleave the glycosidic bonds of alginate by β elimination to produce alginic oligosaccharides containing unsaturated double bonds. At present, a large number of alginate lyases from different sources have been cloned, expressed and identified. In the prior art, the preparation of alginate lyase is mostly obtained by transferring plasmid vectors into Escherichia coli for expression, which has some technical defects. For example, the expression of free plasmid vectors is unstable and easy to be lost after multiple passages; the alginate lyase expressed by Escherichia coli is in the cell, and the target enzyme must be obtained by cell disruption, which increases the difficulty of large-scale preparation. Summary of the invention

[0003] In order to solve the above problems, the present invention aims to provide an economical and efficient specific alginate lyase. The present invention provides a truncated alginate lyase MHALY-T and a preparation method and application thereof.

[0004] The technical solution adopted by the present invention is as follows: The present invention provides a truncated alginate lyase MHALY-T, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO. 2.

[0005] Seq ID No. 2 CTCGAGAAGAGAGAGGCTGAGGCTGGTGGTACTTTGGACCCATCCTTGCCACCATCCTCCAACTTCGACTTGGGTGACTGGTACGTTTCCGTTCCAACTGACTCCAACGGTGACGGTAAGGCTGACTCCATTTACGAGTCCGAGTTGAACTCCGGTTACCAAAACTCCTCCTACTTCTACACTGCTTCCGACGGTGGTATGGTTTTCAGATGTCCAATTAACGGTTACAAGACTTCCACTAACACTTCCTACACTAGAACTGAGTTGAGAGAGATGTTGAGAAGAGGTGACACTTCCATTTCCACTCAAGGTGTTAACAAGAACAACTGGGTTTTCGGTTCCGCTCCATCCTCCGCTAGAACTGCTGCTGGTGGTGTTGACGGTGTTTTGAGAGCTACTTTGGCTGTTAACCACGTTACTACTACTGGTGACTCCTCCCAAGTTGGTAGAGTTATTGTTGGTCAAATTCACGCTAACAACGACGAGCCATTGAGATTGTACTACAGAAAGTTGCCAGGTAACTCCAAGGGTTCCATTTACATTGCTCACGAGCCAAAGGGTGGTTCCGACACTTGGTACGACATGATTGGTTCCAGATCCTCCTCCGCTGCTAACCCATCCGACGGTATTGCTTTGAACGAGACTTTCTCCTACGAGATTAAGGTTGTTGGTAACACTTTGACTGTTACTATTTCCAGACAAGGTAAGGCTGACGTTACTCAAGTTGTTAACATGTCCTCCTCCGGTTACGACACTTCCGACCAATACCACTACTTCAAGGCTGGTGTTTACAACCAAAACAACACTGGTTCCGGTTCCGACTACGTTCAAGCTACTTTCTACGAGTTGGAGAACTCCCACACTGGTTACGCTGACCACCACCACCACCACCACTAAGCGGCCGC The preparation method of the truncated alginate lyase (MHALY-T) of the present invention is as follows: after fully synthesizing the alginate lyase gene with a nucleotide sequence as shown in SEQID NO. 2, constructing it into an expression vector, and then introducing it into Pichia pastoris cells, inducing culture and obtaining secretory expressed alginate lyase.

[0006] The expression vector is pPIC9.

[0007] The Pichia pastoris cell is GS115.

[0008] The specific preparation steps of the truncated alginate lyase MHALY-T include: (1) according to the preference of Pichia pastoris codon usage, Microbulbifer harenosus (1) codon optimization of the truncated alginate lyase gene; (2) total synthesis of the optimized sequence and construction into the expression vector pPIC9; (3) after restriction digestion and linearization of the constructed expression vector, the fragment containing the resistance gene was discarded, and the fragment containing the alginate lyase gene was recovered and introduced into Pichia pastoris cells GS115 to induce and obtain the secreted alginate lyase.

[0009] During gene expression, the signal peptide in the Pichia pastoris vector was used to achieve secretory expression, and the signal peptide and potential binding domain sequence of the alginate lyase itself were removed in advance.

[0010] Step (1) is to Microbulbifer harenosus The signal peptide and the binding domain were removed from the amino acid sequence encoded by the potential alginate lyase gene sequence shown in SEQ ID NO. 1, and the remaining sequence was codon optimized. The optimized nucleic acid sequence was SEQ ID NO. 2.

[0011] Step (3) First use restriction endonuclease Xho I and Not alginate lyase gene mhaly-t The cloning vector was double-digested with enzymes to obtain the target gene fragment, and the expression vector pPIC9 was double-digested with the same endonuclease.

[0012] The present invention also provides the use of truncated alginate lyase MHALY-T in preparing brown algae oligosaccharides.

[0013] The truncated alginate lyase MHALY-T utilizes the crude enzyme solution of induced expressed alginate lyase to directly hydrolyze sodium alginate.

[0014] Truncated alginate lyase MHALY-T is used alone or in combination with other sodium alginate degrading enzymes.

[0015] In addition, the present invention also provides a method for preparing brown algae oligosaccharide.

[0016] A method for preparing brown algae oligosaccharides, comprising fully synthesizing a truncated alginate lyase gene with a nucleotide sequence as shown in SEQ ID NO. 2, constructing the gene into an expression vector, and then introducing the gene into Pichia pastoris cells, inducing culture, and obtaining a crude enzyme solution of the secreted and expressed truncated alginate lyase. The crude enzyme solution obtained from the fermentation broth is directly used for the preparation of brown algae oligosaccharides without purification.

[0017] The present invention directly utilizes the crude enzyme supernatant of the induced expressed alginate lyase to hydrolyze the sodium alginate substrate and uses a liquid phase method to analyze the polymerization degree and composition of the product. The analysis results show that the obtained crude enzyme solution can achieve the hydrolysis of sodium alginate.

[0018] The invention optimizes the codons of the truncated gene encoding the potential alginate lyase to facilitate its secretory expression in Pichia pastoris, thereby efficiently and quickly obtaining the alginate lyase with high hydrolysis activity.

[0019] A recombinant expression vector comprises a truncated alginate lyase MHALY-TT nucleotide sequence.

[0020] A recombinant engineering bacterium comprises a recombinant expression vector carrying a truncated alginate lyase MHALY-TT nucleotide sequence, wherein the recombinant engineering bacterium is a Pichia pastoris engineering bacterium.

[0021] Compared with the prior art, the present invention has the following beneficial effects: 1. The alginate lyase gene of the present invention is derived from the strain Microbulbifer harenosus , secretory expression was performed using the Pichia pastoris expression system. Pichia pastoris ) expression system has been used to express food-grade enzyme preparations such as lactase and phospholipase C, and it has also been used to produce xylanase (GB2760-2014). Microbulbifer harenosus The alginate lyase gene from the source is secreted and expressed in Pichia pastoris, and its product alginate lyase can become an enzyme preparation for the production of food-grade brown algae oligosaccharides.

[0022] 2. Compared with the existing patented technology: a. The target gene is integrated into the Pichia genome by gene recombination, which is more stable than the free plasmid vector expression and is not easily lost due to multiple passages. b. The enzymes secreted and expressed in Pichia pastoris do not need to be processed by cell disruption because they are secreted outside the cell. The crude enzyme liquid obtained from the fermentation broth can be directly used for the preparation of brown algae oligosaccharides without purification.

[0023] 3. The alginate lyase gene of the present invention has been optimized according to the codon preference of Pichia pastoris, and the signal peptide and potential binding domain sequence have been removed, so that efficient secretory expression can be achieved in Pichia pastoris. The alginate lyase obtained by the present invention has a high hydrolysis activity on sodium alginate. The crude enzyme liquid produced by shake flask fermentation has the ability to degrade 10 g of sodium alginate with 1 mL of crude enzyme liquid (protein content of about 0.23 mg). It has the potential for large-scale preparation of brown algae oligosaccharides and has good industrial application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The recombinant expression vector in Example 2 of the present invention mhaly-t -pPIC9 Xho I and Not I Gel electrophoresis pattern of double enzyme digestion products.

[0025] Figure 2 This is the SDS-PAGE map of the supernatant of the fermentation broth of the Pichia pastoris engineered bacteria containing the truncated alginate lyase gene in Example 3 of the present invention.

[0026] Figure 3 This is the HPLC analysis chart of the truncated sodium alginate enzymatic hydrolysate (ALOS-MHALY-T) in Example 4 of the present invention. DETAILED DESCRIPTION

[0027] The technical scheme of the present invention is described in detail below in conjunction with the examples. The reagents and biological materials used below are all commercial products unless otherwise specified. If no specific conditions are specified in the examples, the conventional conditions or the conditions recommended by the manufacturer shall be followed.

[0028] Example 1 Codon Optimization and Whole Gene Synthesis of Truncated Alginate Lyase Gene Without changing the amino acid sequence, according to the preference of Pichia pastoris codon usage, the amino acid sequence encoded by the potential alginate lyase gene SEQ ID NO.1 of the strain Microbulbifer harenosus from the American bioinformatics database NCBI was removed from the signal peptide and binding domain (1-327 aa), and the remaining sequence was codon optimized. The optimized nucleic acid sequence is shown in SEQ ID NO.2, and the identity with the original nucleic acid sequence is 72%. Beijing Qingke Biotechnology Co., Ltd. was commissioned to fully synthesize the optimized sequence, and the synthesized nucleic acid sequence was recorded as mhaly-t.

[0029] Example 2 Truncated gene of alginate lyase mhaly-t Expression vector construction First, use restriction enzymes XhoI and Not alginate lyase gene mhaly-t The cloning vector was double-digested with enzymes to obtain the target gene fragment, and the expression vector pPIC9 was double-digested with the same endonuclease to recover the large fragment. The two recovered products were connected to obtain a recombinant vector named mhaly-t -pPIC9. To confirm that the target alginate lyase gene has been constructed into the vector, use Xho I and Not I double-digested the recombinant vector and subjected the product to agarose gel electrophoresis. The results were as follows: Figure 1 As shown. Figure 1 It can be seen that: mhaly-t After double restriction digestion of -pPIC9, the target gene fragment appeared around 1000 bp, which was consistent with mhaly-t The gene fragment length is consistent with 905 bp.

[0030] Example 3 Screening of Pichia pastoris engineered bacteria producing alginate lyase and preparation of alginate lyase The obtained recombinant plasmid mhaly-t -pPIC9 was cleaved by restriction endonuclease Bgl II After linearization, separate and cut out large nucleic acid fragments containing the target gene by gel electrophoresis, and then introduce them into Pichia pastoris GS115 by electroporation. Recombinant colonies are obtained by screening on histidine nutrient-deficient MD plates. Pick 8 colonies for shake flask induction expression: inoculate the colonies in 50 mL BMGY medium, culture at 28°C and 220 rpm for 48 h, add methanol to a final concentration of 1% for induction, and then add it every 24 h for a total of 72 h. Centrifuge and use the obtained supernatant (crude enzyme) to hydrolyze 1% sodium alginate, and select the strain with the highest sodium alginate degradation activity by viscosity method. Use SDS-PAGE to detect the protein expression of the strain with the highest activity, and the results are shown as follows. Figure 2 As shown in the figure, an obvious band appeared near 50 kDa and 40 kDa, which was larger than the expected relative molecular mass of alginate lyase MHALY-T (31.8 kDa), and it was speculated that different degrees of glycosylation modification occurred. The protein concentration in the fermentation supernatant was 0.23 mg / mL as determined by the Bradford method. The above-mentioned MD agar plate, BMMY agar plate, BMGY medium, and BMMY medium are commonly used culture media for yeast expression systems, which can be purchased directly or prepared according to existing literature techniques.

[0031] Example 4: Preparation of brown algae oligosaccharides by enzymatic hydrolysis of alginate with MHALY-T Weigh 1 g of commercial sodium alginate, dissolve it in water and make it up to 100 mL. Add 0.1 mL of MHALY-T crude enzyme solution and stir the reaction at 40°C for 48 h. Centrifuge to remove insoluble matter, freeze-dry the supernatant to obtain the finished brown algae oligosaccharide, recorded as ALOS-MHALY-T. Weigh a certain amount of homemade brown algae oligosaccharide freeze-dried sample, prepare it into an acetonitrile aqueous solution with a concentration of 5 mg / mL (acetonitrile: water, 1:1, v / v), filter it and use it for high-performance liquid chromatography analysis. The high-performance liquid chromatograph is connected to an evaporative light scattering detector for oligosaccharide signal detection, and the brown algae oligosaccharide is separated using an XAmide column (Huapu Xinchuang Technology Co., Ltd.), the column temperature is 40°C, the flow rate is 1 mL / min, and the mobile phase is 0.1 M formic acid ammonium (pH 3.2) and acetonitrile. The elution procedure was as follows: decreasing acetonitrile concentration (70%-50%), increasing 0.1 M ammonium formate (pH 3.2) concentration (30%-50%), and elution time of 40 min. Figure 3 As shown, the products of sodium alginate hydrolyzed by MHALY-T are mainly brown algal oligosaccharides with a degree of polymerization of 2-6.

[0032] The above are only some preferred embodiments of the present invention, and the present invention is not limited to the contents of the embodiments. For those skilled in the art, various changes and modifications can be made within the scope of the technical solution of the present invention, and any changes and modifications made are within the protection scope of the present invention.

Claims

1. A truncated alginate lyase MHALY-T, the nucleotide sequence of which is shown in SEQ ID NO.

2.

2. The method for preparing the truncated alginate lyase MHALY-T according to claim 1, comprising fully synthesizing the truncated alginate lyase gene with a nucleotide sequence as shown in SEQ ID NO.2, constructing it into an expression vector, and then introducing it into Pichia pastoris cells, inducing culture and obtaining the secretory expression of the truncated alginate lyase.

3. The preparation method according to claim 2, characterized in that: The specific preparation steps include: (1) The nucleotide sequence of the truncated alginate lyase MHALY-T shown in SEQ ID NO. 2 was fully synthesized and constructed into the expression vector pPIC9; (2) After the constructed expression vector was linearized by enzyme digestion, the fragment containing the resistance gene was discarded, and the fragment containing the alginate lyase gene was recovered and introduced into Pichia pastoris cells GS115 to induce and obtain the secretory expression of the truncated alginate lyase MHALY-T.

4. The preparation method according to claim 3, characterized in that: Step (1) further comprises codon optimization of the truncated gene of alginate lyase from the strain Microbulbifer harenosus according to the preference of Pichia pastoris codon usage, to obtain the nucleotide sequence shown in SEQ ID NO.2; during gene expression, the signal peptide in the Pichia pastoris vector is used to achieve secretory expression, and the signal peptide and potential binding domain sequence of the alginate lyase itself have been removed in advance.

5. The preparation method according to claim 3, characterized in that: Step (1) is to Microbulbifer harenosus The signal peptide and the binding domain were removed from the amino acid sequence encoded by the potential alginate lyase gene sequence shown in SEQ ID NO. 1, and the remaining sequence was codon optimized. The optimized nucleic acid sequence was SEQ ID NO.

2.

6. The preparation method according to claim 3, characterized in that: Step (2) First use restriction endonuclease XOt I and Not alginate lyase gene mhaly-t The cloning vector was double-digested with enzymes to obtain the target gene fragment, and the expression vector pPIC9 was double-digested with the same endonuclease.

7. Use of the truncated alginate lyase MHALY-T according to claim 1 in preparing brown algae oligosaccharides.

8. The use according to claim 7, characterized in that: The truncated alginate lyase MHALY-T utilizes the crude enzyme solution of induced expressed alginate lyase to directly hydrolyze sodium alginate.

9. The use according to claim 7, characterized in that: Truncated alginate lyase MHALY-T is used alone or in combination with other sodium alginate degrading enzymes.

10. A method for preparing brown algae oligosaccharides, comprising fully synthesizing a truncated alginate lyase gene with a nucleotide sequence as shown in SEQ ID NO. 2, constructing the gene into an expression vector, and then introducing the gene into Pichia pastoris cells, inducing culture, and obtaining a crude enzyme solution of the secreted truncated alginate lyase. The crude enzyme solution obtained from the fermentation broth is directly used for the preparation of brown algae oligosaccharides without purification.

Images