Gene editing method of lactic acid bacteria from activated sludge

Abstract

The invention discloses a gene editing method of lactic acid bacteria from activated sludge, and belongs to the technical field of gene engineering. The invention provides a lactobacillus plantarum gene editing system based on original bacteriophage recombinase combined with a cre-lox system, which is characterized in that a fusion linear double-stranded DNA (deoxyribonucleic acid) fragment containing upstream and downstream homologous arms of a target gene and a resistance gene with a lox site is transformed into lactobacillus plantarum for expressing the original bacteriophage recombinase; and genome editing is realized by a homologous recombination method. In addition, the resistance screening marker is recovered by inducing transient expression of Cre enzyme, so that subsequent continuous editing of other genes is facilitated.

Description

Technical Field

[0001] The invention relates to a gene editing method for lactic acid bacteria derived from activated sludge, and belongs to the technical field of genetic engineering. Background Art

[0002] Lactobacillus plantarum is a food-grade microorganism belonging to the lactic acid bacteria (LAB) group, many of whose species are of industrial and medical interest. It participates in the fermentation of many food ingredients and is a symbiont of the human gastrointestinal tract. Certain strains from this group have been used as probiotics or as delivery vehicles for therapeutic compounds. In addition, Lactobacillus plantarum has a good ability to remove ammonia nitrogen, nitrite, and phosphate in the treatment of sewage and sludge. With the development of metabolic engineering and synthetic biology, many LAB species are now used as cell factories for the bioproduction of value-added chemicals. Precise and smooth genetic manipulation is essential for the functional genomics of these species. The construction of a gene editing system in Lactobacillus plantarum is conducive to its development and utilization as a chassis cell, laying the foundation for expanding its application range.

[0003] Red / recet-mediated double-stranded DNA (dsDNA) recombination has greatly facilitated rapid and precise functional genomic analysis in Escherichia coli and several other organisms. The Red recombination protein is encoded by three adjacent genes, gam, bet, and exo, in λ bacteriophage, and the RecET recombination protein is encoded by two adjacent genes, recE and recT, in Rac bacteriophage. However, the Red / RecET system has had limited success in bacteria other than E. coli because of the need for specific interactions between the recombinase and host-encoded proteins. Therefore, the recombinase protein mediates recombination more efficiently in its native host or a closely related host.

[0004] Currently, a single-stranded DNA (ssDNA) recombination system has been established in Lactobacillus reuteri, and a dsDNA recombination system based on prophage recombinase has been established in Lactobacillus casei, but there is still a lack of a dsDNA recombination system for Lactobacillus plantarum. Summary of the invention

[0005] The invention provides a Lactobacillus plantarum gene editing system, comprising a recombinant plasmid pSIP-Lp_0640-41-42 containing a prophage recombinase gene, an expression vector pSIP-Cre containing a Cre site-specific recombinase, and a linear dsDNA fragment capable of identifying a target gene.

[0006] In one embodiment, the nucleotide sequence encoding gene Lp_0640-41-42 is shown as SEQ ID NO.1.

[0007] In one embodiment, the nucleotide sequence encoding gene Cre is shown as SEQ ID NO.2.

[0008] In one embodiment, the linear dsDNA fragment has a structure shown as "target gene upstream homology arm-lox66-cat-lox71-target gene downstream homology arm", and the nucleotide sequence encoding lox66-cat-lox71 is shown as SEQ ID NO.3.

[0009] The present invention also provides application of the Lactobacillus plantarum gene editing system in editing the Lactobacillus plantarum gene pbp1A.

[0010] In one embodiment, the use is to reduce the expression of the gene pbp1A.

[0011] In one embodiment, the linear dsDNA fragment used for editing the gene pbp1A has a nucleotide sequence as shown in SEQ ID NO.4.

[0012] In one embodiment, the linear dsDNA fragment contains two loxP sites, a resistance gene cat, and homology arms of 1500 bp upstream and downstream of the target gene.

[0013] In one embodiment, the two loxP sites in the linear dsDNA fragment are lox66 and lox71, respectively.

[0014] In one embodiment, the linear dsDNA fragment sequence is upstream homology arm-lox66-cat-lox71-downstream homology arm.

[0015] In one embodiment, in the gene editing system, the amount of the linear dsDNA used is 1 μg.

[0016] The present invention also provides a method for genome editing of Lactobacillus plantarum, comprising the following steps:

[0017] S1. Construct a linear dsDNA fragment containing the upstream and downstream homology arms of the target gene, "upstream homology arm-lox66-cat-lox71-downstream homology arm";

[0018] S2, introducing the recombinant expression vector pSIP-Lp_0640-41-42 into Lactobacillus plantarum, and inducing the expression of the recombinant enzyme Lp_0640-41-42;

[0019] S3. The linear dsDNA fragment constructed by S1 is introduced into the Lactobacillus plantarum expressing the recombinase Lp_0640-41-42 constructed by S2 for gene editing.

[0020] In one embodiment, the inducer for inducing the expression of the recombinase in step S2 is the inducing peptide SppIP, the dosage is 50 ng / L, and the amino acid sequence of the inducing peptide is shown in SEQ ID NO.5.

[0021] In one embodiment, the method further comprises eliminating the resistance gene.

[0022] In one embodiment, the resistance gene is eliminated by introducing the recombinant expression vector pSIP-Cre into Lactobacillus plantarum in which S3 gene editing has been successfully verified, thereby inducing the expression of the recombinase Cre.

[0023] In one embodiment, the inducer for inducing the expression of the recombinase is the inducing peptide SppIP, and the dosage is 50 ng / L.

[0024] The present invention also provides the application of the Lactobacillus plantarum gene editing system or the method in the development of probiotics.

[0025] In one embodiment, the application includes but is not limited to constructing chassis cells.

[0026] Beneficial effects: The present invention constructs a prophage recombinase-mediated gene editing system in Lactobacillus plantarum, and combines the Cre / loxP system to achieve marker-free knockout and insertion of target genes in Lactobacillus plantarum. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 Schematic diagram of gene editing in Lactobacillus plantarum.

[0028] Figure 2 This is the electrophoresis diagram of gene amplification of recombinase Lp_0640-41-42 and Cre; M: Marker; 1: Lp_0640-41-42 fragment; 2: Cre fragment; 3: linearized vector fragment.

[0029] Figure 3 This is the plasmid map of pSIP-Lp_0640-41-42.

[0030] Figure 4 This is the pSIP-Cre plasmid map.

[0031] Figure 5 The electrophoresis diagram of the amplified fragments and fusion fragments of the upstream and downstream homology arms of the target gene; M: Marker; 1: upstream homology arm fragment; 2: downstream homology arm fragment; 3: lox66-cat-lox71 fragment; 4: up-lox66-cat-lox71-down fusion fragment.

[0032] Figure 6Schematic diagram of PCR verification of gene knockout; M: Marker; 1-7: transformants No. 1 to 7 respectively.

[0033] Figure 7 Schematic diagram of PCR verification of resistance gene elimination; M: Marker; 1-7: transformants No. 1 to 7 respectively.

[0034] Figure 8 This is an electron micrograph of the pbp1A knockout strain. DETAILED DESCRIPTION

[0035] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0036] The materials involved in the present invention are as follows:

[0037] (I) Culture medium

[0038] (1) MRS medium: tryptone 10.0 g L -1 , beef powder 8.0g·L -1 , yeast extract powder 4.0g·L -1 , glucose 20.0 g·L -1 , potassium dihydrogen phosphate 2.0 g·L -1 , ammonium citrate 2.0 g·L -1 , sodium acetate 5.0g·L -1 , magnesium sulfate heptahydrate 0.58 g·L -1 , manganese sulfate tetrahydrate 0.25g·L -1 , Tween 80 1mL·L -1 , pH 6.3~6.5.

[0039] (2) SGMRS medium: 13.664 g sorbitol, 1 g glycine, add MRS liquid medium to make up to 100 mL.

[0040] (3) Resuscitation solution: 13.664 g sorbitol, 0.112 g anhydrous calcium chloride, add MRS liquid culture medium to make up to 100 mL.

[0041] (4) LB medium: 5.0 g / L yeast extract powder -1 , tryptone 10.0 g·L -1 , sodium chloride 10.0 g·L -1 .

[0042] MRS culture, SGMRS culture medium and resuscitation solution were sterilized at 115°C for 30 minutes before use, and LB culture medium was sterilized at 121°C for 20 minutes before use. Solid culture medium required the addition of 2% agar powder before sterilization.

[0043] (II) Reagent formula

[0044] (1) SM buffer: 32.6 g sucrose, 0.072 g magnesium sulfate hexahydrate, add deionized water to make up to 100 mL.

[0045] (2) 0.1M CaCl2: 1.1 g CaCl2, add deionized water to make up to 100 mL.

[0046] (3) 30% glycerol: Mix 30 mL of glycerol with 70 mL of deionized water.

[0047] The above culture media were sterilized at 121°C for 20 min before use.

[0048] Example 1: Screening and identification of Lactobacillus plantarum from activated sludge

[0049] Referring to the method in the paper "Research on Degradation of Excess Sludge by Microbial Agents", Lactobacillus plantarum was screened from activated sludge.

[0050] The screened lactic acid bacteria genome was used as a template and amplified with primers 27F and 1492R. The amplified product was sequenced by Sanger sequencing. The sequence obtained was compared on NCBI (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) to identify Lactobacillus plantarum.

[0051] The primer sequences are as follows:

[0052] 27F:AGAGTTTGATCCTGGCTCAG;

[0053] 1492R:TACCTTGTTACGACTT.

[0054] Example 2: Construction of prophage recombinase Lp_0640-41-42 and Cre site-specific recombinase expression vector

[0055] (1) Construction of Lp_0640-41-42 and Cre expression vectors

[0056] Using the genome of Lactobacillus plantarum WCFS1 (commercial strain, ATCC BAA-793) as a template, primers LP-F and LP-R were used to amplify the Lp_0640-41-42 fragment. Using plasmid pSC101-BAD-Cre-tet (nucleotide sequence as shown in SEQ ID NO.6) as a template, primers Cre-F and Cre-R were used to amplify the Cre fragment. Using plasmid pSIP-411 (nucleotide sequence as shown in SEQ ID NO.7) as a template, primers psip-F and psip-R were used to amplify the linearized vector fragment. The size of the amplified band was verified by agarose electrophoresis ( Figure 2 ), the gene fragments Lp_0640-41-42 and Cre were recombined and connected with the linearized vector using ABclonal MultiF Seamless Assembly Mix to construct plasmid pSIP-Lp_0640-41-42 ( Figure 3 ) and pSIP-Cre( Figure 4 ).

[0057] The primer sequences are as follows:

[0058] LP-F: TATAGGAGTATGATTCCCATGATACCAGCACAGGC;

[0059] LP-R: TACCGAATTCCTCGAGTCAATCTATGAGTAAGTC;

[0060] Cre-F: CAGCTAAACATGCTTCATCGTCG;

[0061] Cre-R:GATCCGCCGCATAACCAGTG;

[0062] psip-F: TTGACTCGAGGAATTCGGTACC;

[0063] psip-R:GGTATCATGGGAATCATACTCCTATA.

[0064] (2) Preparation and transformation of Escherichia coli JM109 competent cells

[0065] a. Pick a single colony of E. coli from the LB plate and place it in 5 mL of liquid LB medium. Shake and culture at 37°C for 12-14 hours until the late logarithmic growth period. Inoculate the bacterial suspension at a ratio of 2% into 100 mL of liquid LB medium and shake and culture at 37°C for 1.5-2 hours until the OD 600 0.5±0.5;

[0066] b. Transfer the culture medium into a 50 mL sterile centrifuge tube, place on ice for 10 min, centrifuge at 4°C, 5000 rpm for 10 min, and discard the supernatant;

[0067] c. Resuspend the cells in 20 mL of pre-cooled CaCl2 solution, place on ice for 30 min, centrifuge at 5000 rpm for 10 min at 4°C, and discard the supernatant;

[0068] d. Add 2 mL of CaCl2 solution and 2 mL of 30% glycerol to resuspend, then dispense into 100 μL / tube and store in a -80°C refrigerator;

[0069] e. Take out the competent cells from the -80℃ refrigerator and immediately place them on ice to thaw for 5-10 minutes;

[0070] f. Add 10 μL of gene fragment Lp_0640-41-42, Cre and linearized vector ligation product, mix gently, and place on ice for 30 min;

[0071] g. Heat shock at 42°C for 90 seconds, incubate in ice water bath for 2 minutes;

[0072] h. Add 500 μL LB medium and incubate at 37°C for 1 h;

[0073] i. After centrifugation, take 100 μL of bacterial solution and spread it evenly on an LB plate with a final concentration of 250 μg / mL erythromycin. Invert the plate and culture it at 37°C overnight.

[0074] Example 3: Construction of linear dsDNA fragments

[0075] Using the plant lactobacillus genome screened in Example 1 as a template, primers pbp1A-UP-F / pbp1A-UP-R and pbp1A-Down-F / pbp1A-Down-R were used to amplify the target gene pbp1A upstream and downstream 1500bp homology arm fragments respectively. Using plasmid pNZ8148 as a template, primers cat-F / cat-R were used to amplify the lox66-cat-lox71 fragment (nucleotide sequence as shown in SEQ ID NO.3). By fusion PCR, the upstream and downstream homology arms were integrated with the lox66-cat-lox71 fragment to form up-lox66-cat-lox71-down, and the fusion PCR product was detected by agarose electrophoresis ( Figure 4 ).

[0076] The primer sequences are as follows:

[0077] pbp1A-UP-F:ATGACATTATCTAAGAAGCCGTCCAC;

[0078] pbp1A-UP-R: CATACATTATACGAACGGTAGATGTTCTCCTTTAATGAATTGATG;

[0079] pbp1A-Down-F: TGTATGCTATACGAACGGTAGAATCACCCAAGACCACTGAATTCG; pbp1A-Down-R: GAAGGCTGATAGGTTAATAGCTGGCC;

[0080] cat-F: TACCGTTCGTATAATGTATGCTATACGAAGTTATACGAAAGTCGACGGCAATAG;

[0081] cat-R: TACCGTTCGTATAGCATACATTATACGAAGTTATCTGTAATATAAAAACCTTC.

[0082] Example 4: Lactobacillus plantarum genome editing mediated by Lp_0640-41-42

[0083] (1) Preparation of competent cells of Lactobacillus plantarum

[0084] a. Activate the plant lactobacillus obtained from activated sludge on MRS agar plates, pick a single colony and inoculate it into 5 mL of fresh MRS liquid medium, and let it stand at 37°C overnight;

[0085] b. Inoculate 2% of the inoculum into 50 mL of SGMRS liquid medium and incubate at 37°C until OD 600 Up to 0.6-0.8;

[0086] c. Place the bacterial solution in an ice bath for 30 minutes, dispense the cooled bacterial solution into 50 mL centrifuge tubes, centrifuge at 4°C, 4000 rpm for 10 minutes, discard the supernatant, and invert the centrifuge tube for 1 minute to remove all the residual culture medium;

[0087] d. Gently resuspend the cells in pre-cooled SM buffer, centrifuge at 4°C, 4000 rpm for 10 min, and discard the supernatant;

[0088] e. Repeat the previous step 1-2 times;

[0089] f. Add 800 μL SM buffer and gently suspend the bacteria to obtain competent cells. Aliquot 80 μL / tube and store at -80℃. Use within one week.

[0090] (2) Transformation of Lactobacillus plantarum

[0091] Take the competent state of Lactobacillus plantarum and place it on ice to melt. After melting, add 200ng of the recombinant plasmid pSIP-Lp_0640-41-42 constructed in Example 2 to 80μL of lactic acid bacteria competent state, mix gently, and place it on ice for standby. Carefully add the lactic acid bacteria competent cell mixture containing the recombinant plasmid to the precooled electric rotating cup, adjust the electric rotating instrument electric shock voltage to 2000V, time 5ms. After the electric shock, immediately add 900μL of resuscitation solution to the electric rotating cup, stand for recovery at 37℃ for 2h, take the bacterial solution after recovery and apply it to the MRS plate with a final concentration of 10μg / mL erythromycin, and stand for cultivation at 37℃.

[0092] (3) Functional verification of the Lp_0640-41-42 system

[0093] After activation, Lactobacillus plantarum carrying plasmid pSIP-Lp_0640-41-42 was inoculated into SGMRS liquid medium at 2% (v / v) and cultured at 37°C until OD 600 When the concentration was about 0.5, SppIP was added at a final concentration of 50 ng / mL and induced at 30°C for 40 min to prepare competent cells. The linear dsDNA fragment up-lox66-cat-lox71-down constructed in Example 3 was transformed into competent cells of Lactobacillus plantarum expressing the recombinase Lp_0640-41-42, and coated on MRS plates with a final concentration of 10 μg / mL chloramphenicol, and cultured at 37°C for 24 h. The transformants were verified by PCR using primers pbp1A-UP-F and pbp1A-Down-R ( Figure 6 ).

[0094] Example 5: Elimination of resistance genes using the Cre / loxP system

[0095] (1) Elimination of plasmid pSIP-Lp_0640-41-42

[0096] The correct transformant verified in Example 3 was streaked on an MRS plate with a final concentration of 10 μg / mL chloramphenicol, and a single colony was picked in 5 mL of MRS liquid culture medium with 10 μg / mL chloramphenicol. After 24 hours, the colonies were streaked on MRS plates with 10 μg / mL chloramphenicol and 10 μg / mL erythromycin, respectively. If the colony grew on the MRS plate with 10 μg / mL chloramphenicol and did not grow on the MRS plate with 10 μg / mL erythromycin, it indicated that the plasmid pSIP-Lp_0640-41-42 had been eliminated. If the colony was not eliminated, the colony was subcultured in the MRS liquid culture medium with 10 μg / mL chloramphenicol and the above steps were repeated.

[0097] (2) Elimination of genomic resistance markers

[0098] After the transformation of the eliminated plasmid pSIP-Lp_0640-41-42 was activated, it was inoculated into SGMRS liquid medium at 2% (v / v), and 10 μg / mL chloramphenicol was added to prepare the competent state and transform the plasmid pSIP-Cre, and the MRS plate with erythromycin added at a final concentration of 10 μg / mL was coated and cultured at 37°C for 24 h. The transformant was inoculated into 5 mL of MRS with erythromycin added at a final concentration of 10 μg / mL, and cultured at 37°C until OD 600 When the concentration was about 0.5, SppIP was added at a final concentration of 50 ng / mL and induced at 30°C for 12 h. The colonies grown only on the MRS plate were selected for PCR verification using primers pbp1A-UP-F and pbp1A-Down-R ( Figure 7 ).

[0099] Example 6: Morphological characterization of pbp1A knockout strain

[0100] The wild strain of Lactobacillus plantarum and the pbp1A knockout strain constructed in Example 5 were cultured for 12 h, fixed, dehydrated, embedded, sectioned, and imaged under a transmission electron microscope ( Figure 8 ), the steps are as follows:

[0101] (1) Add 2.5% glutaraldehyde solution and fix at 4°C in the dark for 2 hours;

[0102] (2) Wash the samples 4 times with phosphate buffer for 2 hours;

[0103] (3) Fix the rinsed samples with 1% osmium hydroxide at 4°C in the dark for 2 hours;

[0104] (4) Wash the fixed samples three times with phosphate buffer, 10 minutes each time;

[0105] (5) Rinse the sample with 50% acetone at 4°C for 15 minutes;

[0106] (6) Rinse the sample with 70% acetone at 4°C for 15 minutes;

[0107] (7) Dehydrate the sample with 90% acetone at 4°C for 15 minutes;

[0108] (8) Dehydration with 100% acetone at 4°C for 15 min, repeated twice;

[0109] (9) Embed and slice the processed Lactobacillus plantarum samples and observe them under a transmission electron microscope.

[0110] The results are as follows Figure 8 As shown, the wild-type strain had intact cell morphology and a smooth cell surface, while the PBP1A knockout strain had a thinner cell wall and obvious exudation around the cells.

[0111] Example 7: Application of Lp_0640-41-42-mediated editing system in gene editing of other Lactobacillus plantarum

[0112] The commercial Lactobacillus plantarum WCFS1 was gene-edited according to the method of Example 4, and the resistance marker was eliminated according to the method of Example 5. The cell morphology was observed under a transmission electron microscope. The results showed that the PBP1A knockout strain had morphological changes such as cell wall hydrolysis and cytoplasmic exudation.

[0113] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A Lactobacillus plantarum gene editing system, characterized in that include: The recombinant plasmid pSIP-Lp_0640-41-42 contains a gene encoding a prophage recombinase, an expression vector pSIP-Cre containing a Cre site-specific recombinase, and a linear dsDNA fragment that can recognize a target gene.

2. The Lactobacillus plantarum gene editing system according to claim 1, characterized in that The nucleotide sequence encoding Lp_0640-41-42 is shown in SEQ ID NO.1; the nucleotide sequence encoding gene Cre is shown in SEQ ID NO.

2.

3. The Lactobacillus plantarum gene editing system according to claim 1 or 2, characterized in that The linear dsDNA fragment has a structure shown as "target gene upstream homology arm-lox66-cat-lox71-target gene downstream homology arm", and the nucleotide sequence encoding the lox66-cat-lox71 fragment is shown as SEQ ID NO.

3.

4. Use of the Lactobacillus plantarum gene editing system according to any one of claims 1 to 3 in editing the Lactobacillus plantarum gene pbp1A.

5. The use according to claim 4, characterized in that: The linear dsDNA fragment used for editing the gene pbp1A has the nucleotide sequence shown in SEQ ID NO.

4.

6. A method for genome editing of Lactobacillus plantarum, characterized in that: The following steps are involved: S1, construct a linear dsDNA fragment containing the upstream and downstream homology arms of the target gene "upstream homology arm-lox66-cat-lox71-downstream homology arm"; S2, introducing the recombinant expression vector pSIP-Lp_0640-41-42 into Lactobacillus plantarum to induce the expression of the recombinase Lp_0640-41-42; S3. The linear dsDNA fragment constructed by S1 is introduced into the Lactobacillus plantarum expressing the recombinase Lp_0640-41-42 constructed by S2 for gene editing.

7. The method according to claim 6, characterized in that The inducer for inducing the expression of the recombinase in step S2 is the inducing peptide SppIP, and the amino acid sequence of the inducing peptide is shown in SEQ ID NO.

5.

8. The method according to claim 6 or 7, characterized in that: The method also includes eliminating the resistance gene.

9. The method according to claim 8, characterized in that The method for eliminating the resistance gene is to introduce the recombinant expression vector pSIP-Cre into the Lactobacillus plantarum in which the S3 gene editing has been successfully verified, so as to induce the expression of the recombinase Cre.

10. Use of the Lactobacillus plantarum gene editing system according to any one of claims 1 to 3, or the method according to any one of claims 6 to 9 in the development of probiotics.

Images