Application of ZmRIN4 protein in regulation and control of corn stalk strength

Abstract

The invention discloses application of ZmRIN4 protein in regulation and control of corn stalk strength, and belongs to the technical field of biological breeding. The technical problem to be solved by the invention is how to regulate and control the stalk strength of plants, for example, how to regulate and control the stalk strength of corns. In order to solve the technical problem, the invention provides a method for increasing the stalk strength and / or stalk diameter of a plant, and the method can be used for increasing or improving the stalk strength and / or stalk diameter of a receptor plant by knocking out ZmRIN4 protein in the receptor plant. The receptor plant is a plant containing a coding gene of the ZmRIN4 protein, and the ZmRIN4 protein is a protein with an amino acid sequence as shown in SEQ ID No. 1. The application discloses the effect of ZmRIN4 in regulating and controlling the strength of corn stalks for the first time; the method can be applied to corn breeding to directionally and accurately improve lodging-resistant and close-planting molecular design breeding of corn, and has a wide market prospect.

Description

Technical Field

[0001] The present application belongs to the field of biological breeding technology, and specifically relates to the application of ZmRIN4 protein in regulating corn stalk strength. Background Art

[0002] Corn is one of the main grain crops in my country, and it has the largest planting area among all grain crops in my country. Planting density is one of the important factors affecting corn yield. Reasonable close planting is a key technical measure for high yield and high efficiency. Increasing planting density has become an important way to obtain high yield in the group. With the increase of planting density, the quality of single ear grains decreases, the corn stalks become thinner, the stalk strength decreases, and the lodging rate increases. The relevant traits of the plant stems, such as the internode length near the ground, the stem thickness, and the stem epidermal puncture strength, can all affect the plant's resistance to lodging. The resistance to lodging increases with the thickening of the stems and the increase of the stem epidermal puncture strength. The higher the group density, the more significant the correlation between the group's resistance to lodging and the stem strength. The mechanical properties of the stems can be used as an important indicator to determine whether the level of mechanical grain harvesting has been reached, and the stem strength is closely related to the level of mechanical grain harvesting.

[0003] The key to corn lodging resistance breeding lies in the basic materials. There are few excellent corn materials with short stalks, thick stalks, developed root systems, high mechanical strength, and resistance to dense planting. Generally speaking, corn varieties with short plants, developed root systems, strong and thick stalks have strong lodging resistance. So far, the research on corn lodging has mainly focused on a few traits such as plant height and ear height. Zhu et al. selected six traits related to corn lodging for QTL positioning under different planting densities, and detected a total of 27 lodging-related QTLs under two planting densities, including two for thick stems. Flint-Garcia et al. conducted QTL positioning for the stalk puncture strength of four F2:3 populations under six different environments, and located 36 QTL loci, some of which were related to lignin synthesis and phenylpropane-like pathways. Zhang et al. selected 257 inbred line populations to conduct a multi-locus genome-wide association analysis on traits related to maize stalk lodging resistance, and used 48,193 high-quality single nucleotide polymorphism markers for genotyping. A total of 423 quantitative trait nucleotides (QTNs) significantly associated with lodging resistance were detected. Among these QTNs, 29, 34, and 48 were associated with stalk diameter, stalk bending strength, and stalk epidermal puncture strength, respectively. Few maize stalk strength-related genes have been cloned so far. Zhang et al. precisely located a gene stiffl that regulates maize stalk strength on chromosome 6, which encodes an F-box domain protein. The presence of a 27.2kb transposon insertion in the gene promoter can inhibit gene transcription, increase the content of lignin and cellulose in the cell wall, and thus improve maize stalk strength. Appenzeller et al. took samples from the elongating internodes of corn to establish a cDNA library, and screened out genes related to cellulose synthase based on the library information. Their research showed that ZmCesl.9 was mainly involved in the primary wall synthesis of corn cell walls.

[0004] Although some QTLs for maize lodging resistance-related traits have been located, since the stalk is a complex quantitative trait regulated by multiple genes, existing studies have only been able to detect limited genetic loci from their respective research populations. Therefore, it is still necessary to conduct genetic analysis of maize stalk-related traits such as stalk diameter, strength, and cellulose content to deepen the understanding of the molecular mechanism of maize stalk trait variation. Summary of the invention

[0005] The technical problem to be solved by the present application is how to regulate the stalk strength and / or stalk diameter of plants, for example, how to regulate the stalk strength and / or stalk diameter of corn.

[0006] To solve this technical problem, the present application provides a method for increasing or improving plant stem strength and / or stem diameter, the method comprising step M1, wherein M1 may be increasing or improving the stem strength and / or stem diameter of the recipient plant by down-regulating, reducing or inhibiting the expression of a gene encoding a ZmRIN4 protein in a recipient plant, or down-regulating, reducing or inhibiting the activity or content of the ZmRIN4 protein in the recipient plant; the recipient plant may be a plant containing a gene encoding the ZmRIN4 protein,

[0007] The ZmRIN4 protein may be any of the following proteins:

[0008] a1), the amino acid sequence is the protein shown in SEQ ID No.1;

[0009] a2), a protein having more than 80% identity with the amino acid sequence shown in a1) obtained by substitution and / or deletion and / or addition of amino acid residues of the amino acid sequence shown in a1);

[0010] a3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of a1) or a2).

[0011] Furthermore, in the method described above, the ZmRIN4 protein may be derived from corn.

[0012] SEQ ID No. 1 consists of 80 amino acid residues.

[0013] The above proteins can be artificially synthesized, or their encoding genes can be synthesized first and then expressed biologically.

[0014] The protein tag refers to a polypeptide or protein that is fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The protein tag can be a Flag protein tag, a His protein tag, an MBP protein tag, an HA protein tag, a myc protein tag, a GST protein tag and / or a SUMO protein tag, etc.

[0015] Furthermore, in the method described above, M1 includes introducing a gRNA gene targeting the ZmRIN4 gene and a gene encoding a Cas protein into the recipient corn.

[0016] Furthermore, in the method, the Cas protein may be a Cas9 protein.

[0017] Furthermore, in the method described above, the target nucleotide sequence of the gRNA gene may be position 2759-2778 of SEQ ID No. 3 (5'-GGCCGTCCCTTGCCAAAGTT-3').

[0018] Furthermore, in the method described above, the plant is selected from monocotyledonous plants.

[0019] Furthermore, in the method described above, the monocotyledonous plant is selected from the Poaceae family.

[0020] Furthermore, in the method described above, the grass plant is selected from the genus Zea mays.

[0021] Furthermore, in the method described above, the Zea plant is selected from corn (Zea mays L).

[0022] Furthermore, in the method, the plant is corn, and the M1) can be any one of the following:

[0023] M1-1), deleting the nucleotide AA at positions 2773-2774 of the DNA molecule having the nucleotide sequence of SEQ ID No. 3 in the genome of the recipient corn;

[0024] M1-2), deleting nucleotides 2776-2796 of the DNA molecule with the nucleotide sequence of SEQ ID No. 3 in the genome of the recipient corn;

[0025] M1-3), deleting the nucleotide A at position 2773 of the DNA molecule having the nucleotide sequence of SEQ ID No. 3 in the genome of the recipient corn;

[0026] M1-4), deleting the nucleotides AAA at positions 2772-2774 of the DNA molecule having the nucleotide sequence of SEQ ID No. 3 in the genome of the recipient corn;

[0027] M1-5), replacing the nucleotides AAA at positions 2773-2775 of the DNA molecule with the nucleotide sequence of SEQ ID No. 3 in the genome of the recipient corn with AAAA.

[0028] Furthermore, in the method, the coding sequence of the ZmRIN4 protein coding gene is a DNA molecule whose nucleotide sequence is SEQ ID No. 2. The genomic nucleotide sequence of the ZmRIN4 protein coding gene is SEQ ID No. 3.

[0029] The present application also provides a method for reducing plant stem strength and / or stem diameter, which includes step M2, wherein M2 can be performed by upregulating, increasing or promoting the expression of the above-mentioned ZmRIN4 protein encoding gene in the recipient plant or upregulating, increasing or promoting the activity or content of the ZmRIN4 protein in the recipient plant, thereby reducing the stem strength and / or stem diameter of the recipient plant.

[0030] Furthermore, in the method described above, the M2 comprises introducing a gene encoding the above-mentioned ZmRIN4 protein into a recipient plant.

[0031] Furthermore, in the method described above, the coding gene may be a DNA molecule as shown in any one of g1) to g3) below:

[0032] g1), the coding sequence of the coding strand is a DNA molecule of SEQ ID No. 2;

[0033] g2), the nucleotide sequence of the coding strand is a DNA molecule of SEQ ID No. 3;

[0034] g3) A DNA molecule that has more than 80% identity with the DNA molecule described in g1) or g2) and regulates plant stress resistance.

[0035] Furthermore, in the method described above, the gene encoding the above-mentioned ZmRIN4 protein is introduced into the recipient plant in the form of a recombinant expression vector.

[0036] In some embodiments of the present application, the recombinant expression vector is pCAMBIA3301-ZmRIN4, and its physical map is as follows: Figure 1 As shown. The coding gene of the ZmRIN4 protein is transcribed and expressed by the Ubi promoter.

[0037] The present application also provides a method for preparing corn with improved stalk strength and / or stalk diameter, the method comprising obtaining the target corn with higher stalk strength and / or stalk diameter than that of the recipient corn by down-regulating, reducing or inhibiting the expression of the ZmRIN4 protein encoding gene or the activity or content of the ZmRIN4 protein in the recipient corn, wherein the recipient corn is corn containing the ZmRIN4 protein encoding gene.

[0038] Furthermore, in the method described above, the down-regulation, reduction or inhibition of the expression of the ZmRIN4 protein encoding gene in the recipient corn or the activity or content of the ZmRIN4 protein includes introducing a gRNA gene targeting the ZmRIN4 gene and a Cas protein encoding gene into the recipient corn, so as to down-regulate, reduce or inhibit the expression of the ZmRIN4 protein encoding gene in the recipient plant or the activity or content of the ZmRIN4 protein.

[0039] Furthermore, in the method described above, the plant is selected from monocotyledonous plants.

[0040] Furthermore, in the method described above, the monocotyledonous plant is selected from the Poaceae family.

[0041] Furthermore, in the method described above, the grass plant is selected from the genus Zea mays.

[0042] Furthermore, in the method described above, the Zea plant is selected from corn (Zea mays L).

[0043] Furthermore, in the method described above, the target nucleotide sequence of the gRNA gene may be SEQ ID No. 3, position 2759-2778 (5'-GGCCGTCCCTTGCCAAAGTT-3')

[0044] In some embodiments of the present application, the gene encoding the Cas protein may be a DNA molecule whose nucleotide sequence is the 435-4535th position of the nucleotide sequence of the CRISPR-ZmRIN4 vector.

[0045] In some embodiments of the present application, the gRNA gene may be a DNA molecule at positions 7180-7282 of the nucleotide sequence of the CRISPR-ZmRIN4 vector, wherein positions 7180-7199 are the gRNA target sequence, and positions 7200-7282 are the structural sequence (gRNA scaffold) of the sgRNA gene.

[0046] Furthermore, in the method, the plant is corn, and the down-regulation, reduction or inhibition of the expression of the gene encoding the ZmRIN4 protein in the recipient corn or the activity or content of the ZmRIN4 protein may include any of the following:

[0047] M1-1), deleting the nucleotide AA at positions 2773-2774 of the DNA molecule having the nucleotide sequence of SEQ ID No. 3 in the genome of the recipient corn;

[0048] M1-2), deleting nucleotides 2776-2796 of the DNA molecule with the nucleotide sequence of SEQ ID No. 3 in the genome of the recipient corn;

[0049] M1-3), deleting the nucleotide A at position 2773 of the DNA molecule having the nucleotide sequence of SEQ ID No. 3 in the genome of the recipient corn;

[0050] M1-4), deleting the nucleotides AAA at positions 2772-2774 of the DNA molecule having the nucleotide sequence of SEQ ID No. 3 in the genome of the recipient corn;

[0051] M1-5), replacing the nucleotides AAA at positions 2773-2775 of the DNA molecule with the nucleotide sequence of SEQ ID No. 3 in the genome of the recipient corn with AAAA.

[0052] The present application also provides the use of a protein or a substance regulating gene expression or a substance regulating the activity or content of the protein in any of the following items, wherein the gene encodes the protein, and the protein is the above-mentioned ZmRIN4 protein;

[0053] A1) Application in regulating plant stem strength;

[0054] A2) Application in the preparation of products for regulating the strength of plant stems;

[0055] A3) Application in regulating plant stem diameter;

[0056] A4) Application in the preparation of products for regulating the diameter of plant stems;

[0057] A5) Application in plant breeding or plant assisted breeding.

[0058] Furthermore, in the application, the purpose of plant breeding includes cultivating plants with improved stem strength.

[0059] Furthermore, in the application, the purpose of plant breeding also includes cultivating plants with increased stem diameter.

[0060] Furthermore, in the application, the evaluation index of plant breeding includes the stem strength of the plant.

[0061] Furthermore, in the application, the evaluation index for plant breeding includes the stem diameter of the plant.

[0062] In the present application, the stem strength assessment index includes the tensile force of the plant stem.

[0063] In the present application, the improvement in stem strength is manifested as an increase in the tensile force of the plant stem.

[0064] In the present application, the stalk tension refers to the tension of the first stalk node below the corn cob.

[0065] In some embodiments of the present application, the method for measuring the stalk strength is: on the day of silking, a digital push-pull dynamometer is used to measure the pulling force when the first stalk node under the ear position is tilted 45°, and the unit is recorded in N.

[0066] In this application, the stalk diameter is the diameter of the first stem node below the corn ear.

[0067] In some embodiments of the present application, the method for determining the stem diameter is: dig up the entire plant on the day of silking, remove the leaves and leaf sheaths and take photos, and use ImageJ to measure the diameter of the stem section below the ear position, and the unit is recorded in cm.

[0068] Furthermore, in the application, the substance regulating gene expression or the substance regulating the activity or content of the protein may be a biological material, and the biological material is any one of the following:

[0069] B1), a nucleic acid molecule that inhibits or reduces the expression of the gene encoding the ZmRIN4 protein or inhibits or reduces the activity of the ZmRIN4 protein;

[0070] B2), an expression cassette containing the nucleic acid molecule described in B1);

[0071] B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0072] B4), a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3);

[0073] B5), a transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3);

[0074] B6), transgenic plant tissue containing the nucleic acid molecule described in B1), or transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3);

[0075] B7), a transgenic plant organ containing the nucleic acid molecule described in B1), a transgenic plant organ containing the expression cassette described in B2), or a transgenic plant organ containing the recombinant vector described in B3);

[0076] B8), a nucleic acid molecule encoding the ZmRIN4 protein;

[0077] B9), an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line containing the nucleic acid molecule described in B8).

[0078] Furthermore, in the above application, B1) the nucleic acid molecule may be a gRNA (gRNA gene) targeting the gene.

[0079] Furthermore, in the above application, the target nucleotide sequence of the gRNA gene may be SEQ ID No. 3, position 2759-2778 (5'-GGCCGTCCCTTGCCAAAGTT-3').

[0080] Furthermore, in the application, in the above-mentioned related biological materials, the expression cassette described in B2) refers to a DNA capable of expressing sgRNA in a host cell, and the DNA may include not only a promoter for initiating transcription of the sgRNA gene, but also a terminator for terminating transcription of the sgRNA gene.

[0081] Among the above-mentioned related biological materials, the recombinant microorganisms described in B4) can specifically be yeast, bacteria, algae and fungi.

[0082] Among the above-mentioned related biological materials, the plant tissue described in B6) can be derived from roots, stems, leaves, flowers, fruits, seeds, pollen, embryos and anthers.

[0083] Among the above-mentioned related biological materials, the transgenic plant organs described in B7) can be roots, stems, leaves, flowers, fruits and seeds of transgenic plants.

[0084] Among the above-mentioned related biological materials, the transgenic plant cell lines, transgenic plant tissues and transgenic plant organs may or may not include propagation materials.

[0085] Furthermore, in the above application, the nucleic acid molecule described in B8) is a DNA molecule described in any one of g1) to g3) below:

[0086] g1), the coding sequence of the coding strand is a DNA molecule of SEQ ID No. 2;

[0087] g2), the nucleotide sequence of the coding strand is a DNA molecule of SEQ ID No. 3;

[0088] g3) A DNA molecule that has more than 80% identity with the DNA molecule described in g1) or g2) and regulates plant stress resistance.

[0089] In the above-mentioned related biological materials, the expression cassette described in B9) refers to a DNA capable of expressing ZmRIN4 protein in a host cell, and the DNA may include not only a promoter for initiating transcription of a gene encoding ZmRIN4 protein, but also a terminator for terminating transcription of a gene encoding ZmRIN4 protein.

[0090] Furthermore, B9) the expression cassette may further include an enhancer sequence.

[0091] In the above-mentioned related biological materials, the recombinant vector described in B9) may contain the DNA molecule encoding the ZmRIN4 protein shown in SEQ ID No.2.

[0092] Furthermore, in the application, the plant is selected from monocotyledonous plants.

[0093] Furthermore, in the application, the monocotyledonous plant is selected from the Poaceae family.

[0094] Furthermore, in the application, the grass plant is selected from the genus Zea mays.

[0095] Furthermore, in the application, the Zea plant is selected from corn (Zea mays L.).

[0096] In the present application, the above 80% identity may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity. The above 85% identity may be at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity. The above 90% identity may be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity. The greater than 95% identity may be at least 95%, 96%, 97%, 98% or 99% identity.

[0097] In the present application, identity refers to the identity of an amino acid sequence or a nucleotide sequence. The identity of an amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST webpage on the NCBI homepage website. For example, in Advanced BLAST 2.1, by using blastp as a program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as a Matrix, setting Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively and performing a search to calculate the identity of an amino acid sequence, the value (%) of identity can then be obtained.

[0098] In the present application, the substance that regulates the activity or content of the protein may be a substance that downregulates or reduces or knocks out the gene encoding the protein and / or a substance that downregulates or reduces the expression of the gene encoding the protein. The regulating plant stem strength may be to increase the plant stem strength.

[0099] In the present application, the substance that regulates gene expression may be a substance that performs at least one of the following six types of regulation: 1) regulation at the transcription level of the gene; 2) regulation after transcription of the gene (that is, regulation of the splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (that is, regulation of the transport of the mRNA of the gene from the nucleus to the cytoplasm); 4) regulation of the translation of the gene; 5) regulation of the degradation of the mRNA of the gene; 6) post-translational regulation of the gene (that is, regulation of the activity of the protein translated by the gene).

[0100] In the present application, the regulating gene expression may be inhibiting or reducing the gene expression, and the inhibiting or reducing the gene expression may be achieved by gene knockout or by gene silencing.

[0101] The gene knockout refers to the phenomenon of inactivating a specific target gene through homologous recombination. Gene knockout is the inactivation of a specific target gene by changing the DNA sequence.

[0102] The gene silencing refers to the phenomenon that the gene is not expressed or is underexpressed without damaging the original DNA. Gene silencing is based on the premise that the DNA sequence is not changed, so that the gene is not expressed or is underexpressed. Gene silencing can occur at two levels, one is gene silencing at the transcriptional level caused by DNA methylation, heterochromatinization and position effect, and the other is post-transcriptional gene silencing, that is, at the level after gene transcription, the gene is inactivated by specifically inhibiting the target RNA, including antisense RNA, co-suppression, gene repression, RNA interference (RNAi) and microRNA (miRNA)-mediated translation inhibition, etc.

[0103] In the present application, the substance regulating gene expression may be an agent that inhibits or reduces the expression of the gene. The agent that inhibits or reduces the expression of the gene may be an agent that knocks out the gene, such as an agent that knocks out the gene by homologous recombination, or an agent that knocks out the gene by CRISPR-Cas9. The agent that inhibits or reduces the expression of the gene may include a polynucleotide that targets the gene, such as siRNA, shRNA, sgRNA, miRNA or antisense RNA.

[0104] The beneficial technical effects achieved by this application are as follows:

[0105] 1. This application reveals for the first time the mechanism of action of ZmRIN4 in regulating corn stalk strength, explores the application prospects of ZmRIN4 in corn biological breeding, and provides new genetic resources for corn breeding. It can be applied to major corn breeding units to achieve targeted and precise improvement of corn lodging resistance and close planting molecular design breeding, and has broad market prospects.

[0106] 2. The future development trend of corn is dense-density tolerance, high yield, and mechanized harvesting. Lodging resistance is one of the important factors restricting mechanized harvesting. Corn lodging resistance is related to a series of factors such as the strength, diameter, and cellulose content of the stalks near the ground, and the lodging trait is a complex quantitative trait genetic characteristic controlled by multiple genes. Planting lodging-resistant corn varieties is the most effective way to prevent lodging and ensure high and stable yields of corn. The ZmRIN4 gene regulates the diameter and strength of corn stalks, providing a new idea for improving corn dense-density tolerance and high-yield, and also providing key gene resources for dense-density-tolerant and high-yield corn biological varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0107] Figure 1 It is the relative expression level of the target gene in the overexpression corn lines and the control KN5585.

[0108] Figure 2 is the mutant genotype of the gene knockout strain.

[0109] Figure 3 These are the statistical results of corn stalk diameter in the Hainan experimental field in 2022. A is the stalk diameter of ZmRIN4 overexpressing corn lines, B and C are the comparisons of the stalks of ZmRIN4 overexpressing lines OE-4 and OE-3 with the control KN5585, D is the stalk diameter of the ZmRIN4 knockout lines, and E and F are the comparisons of the stalks of ZmRIN4 knockout lines KO-2 and KO-21 with the wild type C01.

[0110] Figure 4 These are the statistical results of corn stalk diameter in the Hainan experimental field in 2023. A is the stalk diameter of ZmRIN4 overexpressing corn lines, B and C are the comparisons of the stalks of ZmRIN4 overexpressing lines OE-4 and OE-3 with the control KN5585, D is the stalk diameter of ZmRIN4 knockout lines, and E and F are the comparisons of the stalks of ZmRIN4 knockout lines KO-2 and KO-21 with the wild type C01.

[0111] Figure 5These are the results of the stalk strength measurement of corn in the control area (normal irrigation group) of the Xinjiang experimental field in 2023. In the figure, A is the comparison of the stalk strength between the ZmRIN4 overexpression line OE-9 and the control KN5585, B is the comparison of the stalk strength between the ZmRIN4 overexpression line OE-3 and the control KN5585, C is the statistical result of the stalk strength between the ZmRIN4 knockout line KO-21 and the wild type C01, and D is the statistical result of the stalk strength between the ZmRIN4 knockout line corn and the wild type C01.

[0112] Figure 6 These are the results of the stalk strength measurement of corn in the middle drought area (drought stress group) of the Xinjiang trial in 2023. A is the comparison of the stalk strength between the ZmRIN4 overexpression line OE-9 and the control KN5585, B is the comparison of the stalk strength between the ZmRIN4 overexpression line OE-3 and the control KN5585, C is the statistical result of the stalk strength between the ZmRIN4 knockout line KO-21 and the wild type C01, and D is the statistical result of the stalk strength between the ZmRIN4 knockout line corn and the wild type C01.

[0113] Figure 7 This is a map of the recombinant vector pCAMBIA3301-ZmRIN4. DETAILED DESCRIPTION

[0114] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0115] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0116] The CRISPR / Cas9 gene editing vector CPB in the following embodiments was kindly donated by the research group of Researcher Xie Chuanxiao of the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, and is disclosed in the document "Qi X, et al., Genome Editing Enables Next-Generation Hybrid Seed Production Technology. Molecular Plant, 2020, 13(9): 1262-1269." The public can obtain the above biological materials from the applicant. The obtained biological materials are only used for repeating the experiments of this application and cannot be used for other purposes;

[0117] The P-Easy-blunt vector in the following examples is a product of Beijing Quanshijin Biotechnology Co., Ltd., with the product number CB101-01;

[0118] The Escherichia coli DH5α / EC DH5α in the following examples is a product of Beijing Qingke Biotechnology Co., Ltd., with the product number TSC01;

[0119] The Agrobacterium GV3101 (pSoup) competent cells in the following examples are products of Beijing Bomade Gene Technology Co., Ltd., with the product number C314-01;

[0120] In the following embodiments FastPfu PCR SuperMix is ​​a product of Beijing Quanshijin Biotechnology Co., Ltd., with the product number AS221-11;

[0121] The pCAMBIA3301 vector in the following example is preserved by the applicant and disclosed in the document "Zhang X, et al., Overexpression of a maize BR transcription factor ZmBZR1 in Arabidopsis enlarges organ and seed size of the transgenic plants. Plant Science, 2020, 292, 110378." The public can obtain the above-mentioned biological material from the applicant. The obtained biological material is only used for repeating the experiments of this application and cannot be used for other purposes.

[0122] The digital push-pull force gauge in the following embodiments is a product of Yueqing Yileike Electric Co., Ltd., model number is YLK-500.

[0123] The present application is further described in detail below in conjunction with specific embodiments. The examples given are only for illustrating the present application, not for limiting the scope of the present application. The examples provided below can be used as a guide for further improvements by ordinary technicians in the technical field, and do not constitute a limitation of the present application in any way.

[0124] Example 1. ZmRIN4 protein and its gene

[0125] The present application discloses the use of ZmRIN4 protein and its encoding gene in regulating corn stalk strength. The amino acid sequence of ZmRIN4 protein is SEQ ID No.1, its encoding gene is Zm00001eb280910 gene, the nucleotide sequence of the encoding sequence of Zm00001eb280910 gene is SEQ ID No.2, and the genomic nucleotide sequence of Zm00001eb280910 gene is SEQ ID No.3.

[0126] Example 2. Preparation of overexpression strains

[0127] 2.1. Construction of overexpression vector

[0128] (1) Cloning of target gene

[0129] The reverse transcribed cDNA was used as a template for cloning the Zm00001eb280910 gene and PCR amplification was performed using RIN4-FW / RIN4-RV as primers. Amplification was performed using FastPfu PCR SuperMix.

[0130] The nucleotide sequence of primers RIN4-FW / RIN4-RV is as follows (5'-3'):

[0131] RIN4-FW: ATGGCGGAGGAATCAGGCC;

[0132] RIN4-RV: TCAGGATTGCGTAGGGCTGG.

[0133] The PCR reaction system was as follows: Template 1 μL, 2.5 mM dNTPs 2 μL, forward and reverse primers (10 μM) 1 μL each, 5×FastPfu Buffer 4 μL, Fast Pfu DNA polymerase 2 μL, ddH 2 HO to a total volume of 20 μL.

[0134] The PCR reaction program was as follows: denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 60°C for 30 sec, and extension at 72°C for 1 min, for a total of 35 cycles; and extension at 72°C for 10 min.

[0135] After the amplified product was detected by agarose gel electrophoresis, the target band was cut out and the total DNA amount was estimated according to the brightness of the Maker electrophoresis band. An appropriate amount of eluent was added to make the final DNA concentration meet the requirements of subsequent experiments, and the target fragment was recovered using the Tiangen DNA recovery kit.

[0136] (2) Construction of intermediate vector

[0137] The intermediate vector uses the 9zf vector with the ubi promoter, and the intermediate vector is constructed by homologous recombination. First, the 9zf vector is linearized by EcoRV digestion, and the target fragment for homologous recombination (prepared in step (1)) is amplified using primers 9zf-RIN4-FW / 9zf-RIN4-RV, and the homologous sequences on both sides of the vector insertion site are added to the 5' end of the primer. The target gene is connected to the 9zf vector using the principle of homologous recombination to construct the intermediate vector 9zf-ZmRIN4-Tnos. Then, Escherichia coli transformation and positive recombinant identification are carried out. First, 5 μL of the connection product is added to 50 μL of Trans1-T1 colon competent cells melted on ice, gently mixed, and ice bathed for 30 minutes. Heat shock in a 42°C water bath for 42 seconds, and immediately place on ice for 2 minutes. Add 500 μL of liquid LB medium without antibiotics, and culture at 37°C, 200rpm shaking for 1 hour. Centrifuge at 3,000g for 2min, discard part of the supernatant, blow the bacteria gently with a pipette until they are fully suspended, take all the bacterial liquid and spread it on a solid LB medium plate containing ampicillin antibiotics, and culture it at 37℃ overnight. Pick a single colony of medium size and put it into 5mL LB liquid medium containing antibiotics at 37℃, shake and culture it at 200rpm for about 10-16h, extract the plasmid for enzyme identification, PCR identification and sequencing identification. The sequencing results show that the structure of the intermediate vector 9zf-ZmRIN4-Tnos is: replace the fragment between the two EcoRV enzyme recognition sites of the 9zf vector with a DNA molecule with a nucleotide sequence of SEQ ID No.2, and keep the other nucleotide sequences of the 9zf vector unchanged. The clones with correct sequencing are used for the subsequent construction of overexpression vectors.

[0138] The nucleotide sequence of primers 9zf-RIN4-FW / 9zf-RIN4-RV is as follows (5'-3'):

[0139] 9zf-RIN4-FW: GTTACTTCTGCAGGAATTCGATATC ATGGCGGAGGAATCAGGC (homology arms are underlined);

[0140] 9zf-RIN4-RV: TAACGAGCTCTAGAAGCTTGATATC TCAGGATTGCGTAGGGCTGG (homology arms are underlined).

[0141] (3) Construction of overexpression vector

[0142] The overexpression vector was constructed using pCAMBIA3301 and an enzyme ligation method. According to the multiple cloning site on the vector, the restriction endonucleases BamHI and AflII were used to double-digest the pCAMBIA3301 vector and the intermediate vector 9zf-ZmRIN4-Tnos, and the large fragment of pCAMBIA3301 and the small fragment of the intermediate vector 9zf-ZmRIN4-Tnos were recovered. 4 The two fragments were connected by DNA ligase to construct the overexpression vector pCAMBIA3301-ZmRIN4-Tnos.

[0143] Vector linearization enzyme digestion system (20 μL system): about 5 μg of vector, 0.5 μL each of BamHI / AflII, 2 μL of 10×CutSmart, and sterile water to make up to 20 μL.

[0144] Enzyme digestion reaction conditions: 37°C water bath digestion (16h).

[0145] 1% agarose gel electrophoresis was used to detect the digestion product and the linearized vector was recovered according to the instructions of Tiangen DNA recovery kit. The recombination reaction system was designed according to the Seamless Assembly Cloning Kit of Sino-US Taihe Biotechnology Co., Ltd., 20-60ng of linearized vector was used, and the DNA fragment was used at a molar ratio of 3:1 to the vector.

[0146] The recombination reaction system is as follows (10 μL): target fragment 0.5-5 μL, linearized vector 0.5-5 μL, 2× Seamless Master Mix 5 μL, ddH 2 HO to a total volume of 10 μL.

[0147] Recombination reaction conditions: 50°C for 15 min.

[0148] Then, E. coli transformation and positive recombinant identification were performed. 5 μL of the ligation product was added to 50 μL of Trans1-T1 competent E. coli cells melted on ice, gently mixed, and placed on ice for 30 minutes; heat shock at 42°C for 42 seconds; immediately placed on ice for 2 minutes; 500 μL of liquid LB medium without antibiotics was added, and cultured at 37°C, 200 rpm for 1 hour; centrifuged at 3,000g for 2 minutes, part of the supernatant was discarded, and the bacteria were gently blown with a pipette until fully suspended, and all the bacterial liquid was spread on a solid LB medium plate containing kanamycin (later expressed as antibiotics), and cultured at 37°C overnight; a single colony of a medium-sized clone was picked and placed in 5 mL of LB liquid medium containing antibiotics, and cultured at 37°C, 200 rpm for about 10-16 hours, and the plasmid was extracted for restriction digestion identification, PCR identification, and sequencing identification. The clones with correct sequencing were used for subsequent genetic transformation. The size of the overexpression vector pCAMBIA3301-ZmRIN4 is 10.749 Kb. The map of the recombinant vector pCAMBIA3301-ZmRIN4 is as follows: Figure 7 shown.

[0149] 2.2 Construction of overexpression plants

[0150] Maize genetic transformation was carried out by the Life Science and Technology Center of China National Seed Group Corporation (Wuhan), and the overexpression transformation receptor was the maize inbred line KN5585. 0 The first generation seedlings were screened for herbicide resistance and positive transgenic plants were identified by PCR, and then self-pollinated continuously, supplemented by genotyping to obtain homozygous transgenic T 3 Generation seedlings (OE-3, OE-4, OE-6 and OE-9) were used for trait determination.

[0151] T 0 The preparation method of genetically modified corn is as follows:

[0152] (1) Callus preparation

[0153] Select embryonic callus with fast growth rate, soft texture, loose and fragile, and bright color. This kind of callus can be subcultured for a long time and can maintain its embryogenic ability for a long time.

[0154] (2) Preparation of Agrobacterium

[0155] 1) Two days before infection, streak Agrobacterium on LB medium and culture in the dark at 28°C, or select a single clone and shake the culture in liquid LB medium;

[0156] 2) Collect the bacteria, transfer them to a 50 mL centrifuge tube, and resuspend the bacteria in infection medium to obtain infection fluid so that the concentration of the infection fluid is between OD = 0.8-1.5;

[0157] 3) The prepared infection solution was shaken in a 28°C shaker at 200 rpm for 2 hours to activate the Agrobacterium to obtain the infection solution for infection.

[0158] (3) Infection

[0159] 1) Select pretreated callus tissue and transfer it into infection medium;

[0160] 2) Soak the callus tissue in the infecting solution for 10-30 minutes, break up the callus clumps, and shake well to make the callus tissue fully contact with Agrobacterium;

[0161] 3) Aspirate the remaining infection solution, transfer the infected callus into co-cultivation medium, and culture in the dark at 19°C for 3 days;

[0162] (4) Recovery culture

[0163] Use sterile water containing antibiotics to rinse the surface of the callus 3-5 times, and when the added water is no longer turbid, pour out the liquid, transfer the callus to a plate covered with filter paper, and blow dry the surface water of the callus in a clean bench. Transfer to recovery medium, culture in the dark at 28℃ for 7-10 days, and then transfer to screening medium.

[0164] (5) Screening

[0165] 1) After the culture is resumed, the transformed callus is transferred to a screening medium supplemented with antibiotics and cultured in the dark at 28°C for 20-30 days;

[0166] 2) Transfer the callus tissue into a sterile plate, break it up and press it thinly;

[0167] 3) Pick out the brighter callus particles on the UV operating table, pile 3-5 particles into a ball, and transfer them to a new screening medium;

[0168] 4) Cultivate in the dark at 28°C for 20 days, then transfer to a new screening medium for subculture and propagation;

[0169] 5) After two rounds of subculture (40 days), the fluorescent cells were picked again (without breaking up the callus tissue).

[0170] (6) Differentiation

[0171] 1) The heat-shocked callus was transferred to the pre-differentiation medium, cultured in the dark at 28°C for 10 days, and then transferred to the light culture at 28°C for 10 days;

[0172] 2) Transfer to differentiation medium, and transfer to rooting medium when the regenerated buds grow to 3-5 cm;

[0173] 3) After a large number of strong roots have grown, harden the seedlings and transplant them.

[0174] (7) Hardening and transplanting

[0175] 1) After rooting, remove the sealing film on the rooting bottle and harden the seedlings in the culture medium for 2-3 days;

[0176] 2) Wash the root culture medium and transplant it into sterilized nutrient soil, and harden the seedlings indoors for 7 days;

[0177] 3) Transplant in greenhouse or field to obtain T 0 Transformant plants, T 0 The transformant plants were self-fertilized to obtain T 1 Transformant plants, T 1 The transformant plants were self-fertilized to obtain T 2 Transformant plants, T 2 The transformant plants were self-fertilized to obtain T 3 The genotypes of the transformants were identified and the homozygous T plants including OE-3, OE-4, OE-6 and OE-9 were obtained. 3 Transformant plants.

[0178] 2.3. PCR detection of target gene ZmRIN4

[0179] (1) Methods

[0180] PCR primers Ubi-Fw / Tnos-Rv were designed according to the gene sequence, and the expected amplified fragment size was 445 bp.

[0181] The nucleotide sequence of primer Ubi-Fw / Tnos-Rv is as follows (5'-3'):

[0182] Ubi-Fw: AGCCCTGCCTTCATACGCTA;

[0183] Tnos-Rv:AATCATCGCAAGACCGGCAA;

[0184] Extract genomic DNA and amplify according to the following PCR parameters:

[0185] Reaction system: 30ng template DNA, 2.0μL 10× buffer, 1.0μL 2mM dNTPs, 1.5μL 25mM MgCl 2 , 0.4 μL 10 μM primer, 1.5 U Taq enzyme, ddH 2 HO to a total volume of 20 μL.

[0186] Reaction procedure: denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 60°C for 30 sec, extension at 72°C for 45 sec, for a total of 35 cycles; extension at 72°C for 5 min.

[0187] (2) Results

[0188] PCR detection of transformant plants showed that: 1 The size of the target gene amplified fragment in the next generation was consistent with that of the amplified fragment of the positive plasmid control PCR, which was about 445 bp, indicating that the ZmRIN4 gene overexpression cassette had been integrated into the maize genome.

[0189] 2.4 Gene overexpression level

[0190] The ZmRIN4 gene knockout materials were selected as KO-21 and KO-2, wild type C01, T 3 The ZmRIN4 overexpressing materials OE-3, OE-4, OE-6 and OE-9 and the control KN5585 were sown in Changji City, Xinjiang Uygur Autonomous Region for field trials. Three replicates were planted, with 6 rows and 12 plants per row (2023), and normal water and fertilizer management was carried out.

[0191] The plants with the same growth in the field were selected on the day of silking, and the control group of KN5585 and T 3 The female ears of the overexpression lines OE-3, OE-4, OE-6 and OE-9 were quickly placed in liquid nitrogen, RNA was extracted and reversely transcribed into cDNA, and the relative expression level of the ZmRIN4 gene in each line was determined by qPCR.

[0192] ZmActin1-Fw:ACCTCACCGACCACCTAATG;

[0193] ZmActin1-Rv:CTGAACCTTTCTGACCCAAT;

[0194] R4-qPCR-Fw:ATGTCAACGATCCCGGCTTCC;

[0195] R4-qPCR-Rv: AGACTCCACCTCTCCAGTCC;

[0196] The reaction system was: 2×SYBR Mix 10 μL, Forward Primer (10 μM) 0.5 μL, Reverse Primer (10 μM) 0.5 μL, cDNA 7 μL, ddH 2 Add 0.1% HO to make up to 20 μL.

[0197] ABI7500 fluorescent quantitative PCR instrument was used for quantitative analysis. The qPCR reaction program was: 95°C, 3 min; (95°C, 5 sec, 60°C, 30 sec) × 40 cycles.

[0198] The results showed that the relative expression levels of ZmRIN4 gene in OE-3, OE-4, OE-6 and OE-9 were increased by 14.2, 45.6 and 19.5 times, respectively, compared with the control KN5585 ( Figure 1 ).

[0199] Example 3. Preparation of knockout strains

[0200] 3.1 Construction of CRISPR-Cas9 vector

[0201] (1) Design of sgRNA

[0202] The sgRNA design website: http: / / www.rgenome.net / cas-designer / was used to design sgRNA targeting the genomic sequence of ZmRIN4 protein. The nucleotide sequence of the target of the sgRNA was finally screened as follows:

[0203] sgRNA: GGCCGTCCCTTGCCAAAGTT TGG (The underlined sequence is the PAM sequence, and the rest is the target sequence, which is positions 16-35 of SEQ ID No. 2 and positions 2759-2778 of SEQ ID No. 3).

[0204] (2) Amplification of U6 promoter

[0205] The U6 promoter was amplified using the plasmid containing the U6 promoter as a template, and the amplification primers were MU61-3F / MU61-1R.

[0206] The PCR reaction system was as follows: Template 1 μL, 2.5 mM dNTPs 2 μL, Forward Primer (10 uM) 0.5 μL, Reverse Primer (10 uM) 0.5 μL, 5×FastPfu Buffer 4 μL, FastPfu DNA polymerase 2 μL, ddH 2 Add 0.1% HO to make up to 20 μL.

[0207] The nucleotide sequence of primers MU61-3F / MU61-1R is as follows (5'-3'):

[0208] MU61-3F: TGCACTGCACAA;

[0209] MU61-1R:AATTCGGTGCTTGCCGGCTC;

[0210] The PCR reaction program was as follows: denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 60°C for 30 sec, and extension at 72°C for 1 min, for a total of 35 cycles; and extension at 72°C for 10 min.

[0211] (3) Fusion of U6 and sgRNA

[0212] Using the PCR product from the previous step and the synthesized sgRNA as templates, primers MUsgR-1F and MUsgR-2R were used to fuse U6 and sgRNA together through overlap PCR to obtain a DNA fragment containing the sgRNA expression cassette. The PCR system and procedure refer to step (2).

[0213] The nucleotide sequences of primers MUsgR-1F and MUsgR-2R are as follows (5'-3'):

[0214] MUsgR-1F:GAGCCGCAAGCACCGAATTGGCCGTCCCTTGCCAAAGTT;

[0215] MUsgR-2R: GGCCAGTGCCAAGCTTAAAAAAAGCACCGACTCG;

[0216] (4) Finally, the DNA fragment containing the sgRNA expression cassette was fused to the CRISPR-cas9 vector using the principle of homologous recombination to construct the CRISPR-ZmRIN4 vector. The nucleotide sequence (5′→3′) of the CRISPR-ZmRIN4 vector contains the Cas9 coding gene at positions 435-4535, the U6 promoter at positions 6680-7179, the gRNA gene at positions 7180-7282 (the gRNA target sequence at positions 7180-7199, and the structural sequence (gRNA scaffold) of the sgRNA gene at positions 7200-7282).

[0217] Then, the ligation transformation and positive recombinant identification were carried out. 5 μL of the ligation product was added to 50 μL of Trans1-T1 competent cells melted on ice, gently mixed, and placed on ice for 30 minutes; heat shock was performed in a 42°C water bath for 42 seconds; immediately placed on ice for 2 minutes; 500 μL of liquid LB medium without antibiotics was added, and cultured at 37°C, 200 rpm for 1 hour; centrifuged at 3,000 g for 2 minutes, part of the supernatant was discarded, and the bacteria were gently blown with a pipette until fully suspended, and all the bacterial liquid was spread on a solid LB medium plate containing kanamycin, and cultured at 37°C overnight; a single colony of medium size was selected and placed in 5 mL of LB liquid medium containing antibiotics, and cultured at 37°C, 200 rpm for about 10-16 hours, and the plasmid was extracted for restriction digestion identification, PCR identification, and sequencing identification. The clones with correct sequencing were used for subsequent genetic transformation.

[0218] 3.2. Preparation of maize knockout lines

[0219] The constructed CRISPR-ZmRIN4 vector was handed over to the Life Science and Technology Center of China National Seed Group Corporation (Wuhan) for genetic transformation to obtain T 0 The knockout strain was generated, and the transformed recipient was the corn inbred line C01. The preparation method of the gene knockout homozygous strain was referred to Example 3, the only difference being that the overexpression plasmid was replaced with the knockout plasmid, and the recipient corn was replaced with the corn inbred line C01. The CRISPR / Cas9 gene editing strain was self-pollinated to select homozygous strains, and the editing site and type were determined by sequencing. 0 The knockout strain was self-pollinated to obtain T 1 After continuous self-pollination, the knockout homozygous strain T was obtained. 3 After 3 generations, homozygous mutants including KO-2 and KO-21 were obtained through sequencing.

[0220] (1) Methods

[0221] PCR primers RIN4-Crispr-F / RIN4-Crispr-R were designed based on the gene sequence, and the genomic DNA of the maize inbred line C01 was used as a template. The expected amplified fragment size was 663 bp.

[0222] The nucleotide sequences of primers RIN4-Crispr-F / RIN4-Crispr-R are as follows (5'-3'):

[0223] RIN4-Crispr-F: ATCTGCTTGCAGAAGCCTGT

[0224] RIN4-Crispr-R:GCTGGCTGTCACACAACAAA

[0225] Extract genomic DNA and perform PCR amplification according to the following reaction system:

[0226] Reaction system: 30ng template DNA, 2.0μL 10× buffer, 1.0μL 2mM dNTPs, 1.5μL 25mM MgCl 2 , 0.4 μL 10 μM primer, 1.5 U Taq enzyme, ddH 2 Add 0.1% HO to make up to 20 μL.

[0227] The reaction procedure was as follows: denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 60°C for 30 sec, and extension at 72°C for 45 sec, for a total of 35 cycles; and extension at 72°C for 5 min.

[0228] (2) Results

[0229] The knockout homozygous strain was determined by Sanger sequencing. The sequencing results of the knockout homozygous strain were as follows: Figure 2 The mutations of homozygous mutants KO-1, KO-2, KO-3, KO-21 and KO+1 are as follows:

[0230] Homozygous mutant plant KO-2: Compared with the wild-type corn C01, the target genes in the two homologous chromosomes of the mutant KO-2 underwent the following changes: the nucleotide AA at positions 2773-2774 of SEQ ID No.3 was deleted, resulting in a frameshift mutation in the target gene, which in turn caused the target protein to be unable to be expressed normally, thereby achieving the knockout of the target gene.

[0231] Homozygous mutant plant KO-21: Compared with the wild-type corn C01, the target genes in the two homologous chromosomes of the mutant KO-21 underwent the following changes: the nucleotides AAGTTTGGTGAATGGGATGTC at positions 2776-2796 of SEQ ID No.3 were deleted, resulting in a mutation in the target gene, which in turn resulted in the inability to express the target protein normally, thereby achieving the knockout of the target gene.

[0232] Homozygous mutant plant KO-1: Compared with the wild-type corn C01, the target genes in the two homologous chromosomes of the mutant KO-1 underwent the following changes: the nucleotide A at position 2773 of SEQ ID No.3 was deleted, resulting in a frameshift mutation in the target gene, which in turn caused the target protein to be unable to be expressed normally, thereby achieving the knockout of the target gene.

[0233] Homozygous mutant plant KO-3: Compared with the wild-type corn C01, the target genes in the two homologous chromosomes of the mutant KO-3 underwent the following changes: the nucleotide A at positions 2772-2774 of SEQ ID No.3 was deleted, resulting in a frameshift mutation in the target gene, which in turn caused the target protein to be unable to be expressed normally, thereby achieving the knockout of the target gene.

[0234] Homozygous mutant plant KO+1: Compared with the wild-type corn C01, the target genes in the two homologous chromosomes of the mutant KO+1 underwent the following changes: the nucleotides AAA at positions 2773-2775 of SEQ ID No.3 were replaced by AAAA, resulting in a frameshift mutation in the target gene, which in turn resulted in the inability to express the target protein normally, thereby achieving the knockout of the target gene.

[0235] Example 4: ZmRIN4 regulates corn stalk strength

[0236] The ZmRIN4 gene knockout materials were selected as KO-21, KO-2 and wild type C01, T 3 The ZmRIN4 overexpression materials OE-3, OE-4, OE-6 and the control KN5585 (a total of 7 lines) were sown in the Hainan experimental field in the winter of 2022 and 2023, respectively. Each line was planted with three replicates, and each replicate was set up with 2 rows, with 12 plants in each row.

[0237] The ZmRIN4 gene knockout materials were selected as KO-21, KO-2 and wild type C01, T 4 The ZmRIN4 overexpression materials OE-3, OE-4, OE-6, OE-9 and the control KN5585 (a total of 8 lines) were sown in the experimental field in Changji City, Xinjiang Uygur Autonomous Region in the summer of 2023. Two water treatments, normal irrigation (also called control area or normal irrigation group or non-drought stress group) and drought stress during flowering period (also called drought area or drought stress group) were set. Each line was planted with three replicates, each replicate was set with 6 rows (18 rows were set for the two water treatments), and there were 12 plants in each row.

[0238] 4.1. Stem diameter

[0239] Method for measuring stem diameter: on the day of silking, the whole plant was dug up, and the leaves and sheaths were removed and photographed. The diameter of the stem section below the ear position was measured using ImageJ, and the unit was recorded in cm. Eight plants with consistent growth were selected from each line and measured. The statistical method of conventional phenotypic data was statistically analyzed using the Student's t-test method in Excel (Excel 2013, Microsoft) (*: P < 0.05, **: P < 0.01).

[0240] The results of the 2022 winter survey in Hainan showed that the stems of the ZmRIN4 overexpressing plants (OE-3 and OE-4) became thinner, with a stem diameter of 1.68-2.02 cm, which was 14.28-29.51% lower than that of the control KN5585 (2.38 cm). The stems of the gene-edited plants (KO-2 and KO-21) became thicker, with a stem diameter of 1.68-2.35 cm, which was 17.52-64.28% higher than that of the wild type C01 (1.43 cm). Figure 3 ).

[0241] The results of the 2023 winter survey in Hainan showed that the stems of the ZmRIN4 overexpressing plants (OE-3 and OE-4) in the control area (normal irrigation group) became thinner, with a stem diameter of 1.62-1.89 cm, which was 16.54-25.72% lower than that of the control KN5585 (2.18 cm). The stems of the gene-edited plants (KO-2 and KO-21) became thicker, with a stem diameter of 1.86-2.23 cm, which was 7.30-28.32% higher than that of the wild type C01 (1.74 cm). Figure 4 ). The above results indicate that the ZmRIN4 gene can regulate the diameter of maize stalks.

[0242] 4.2. Stem strength

[0243] In the summer of 2023, a field experiment was conducted in Changji City, Xinjiang Uygur Autonomous Region. ZmRIN4 knockout materials KO-21 and KO-2, wild type C01, ZmRIN4 overexpression materials OE-3, OE-4, OE-6 and OE-9 with consistent field growth were selected, and KN5585 was used as the control. Drought treatment was carried out according to the effective accumulated temperature (GDD). The soil water potential in the drought area reached 150 cBar 7 days before flowering, and drought stress lasted until 14 days after silking, during which the soil water potential was maintained at 150-180 cBar. The control area was irrigated normally.

[0244] Method for measuring stem strength: On the day of silking, a digital push-pull force gauge was used to measure the pulling force of the first stem node under the ear position when it was tilted 45°. The unit was recorded in N. Under the two water treatment conditions, 15-20 plants were measured for each material. The statistical method of conventional phenotypic data was statistically analyzed using the Student's t-test method in Excel (Excel 2013, Microsoft) (*: P < 0.05, **: P < 0.01, ***: P < 0.001).

[0245] The results showed that in the control area (normal irrigation group), the stems of ZmRIN4 overexpressing plants became thinner, with a stem strength of 12.1-13.1N, which was 5.07-12.32% lower than that of the control KN5585 (13.8N); the stems of gene-edited plants (KO-1, KO-2 and KO-21) became thicker, with a stem strength of 16.6-22.1N, which was 5.73%-45.86% higher than that of wild-type C01 (15.7N). Figure 5 In the drought-prone area (under drought stress during flowering), the stems of RIN4 overexpressing plants became thinner, with a stem strength of 11.1-12.3N, which was 8.89-17.78% lower than that of the control KN5585 (13.5N). The stems of gene-edited plants (KO-1, KO-2, and KO-21) became thicker, with a stem strength of 18.9-22.7N, which was 8.0%-29.71% higher than that of the wild-type C01 (17.5N). Figure 6 The above results indicate that the ZmRIN4 gene can regulate maize stalk strength under both drought stress and non-drought stress conditions.

[0246] Table 1: Main sequences in this application

[0247]

[0248]

[0249]

[0250]

[0251]

[0252]

[0253]

[0254]

[0255]

[0256] The present application has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present application, and without the need to carry out unnecessary experimental conditions, the present application can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present application provides specific embodiments, it should be understood that further improvements can be made to the present application. In a word, according to the principles of the present application, the present application is intended to include any changes, uses or improvements to the present application, including departure from the disclosed scope in the present application and changes made with conventional techniques known in the art.

Claims

1. A method for increasing or improving plant stem strength and / or stem diameter, characterized in that: The method comprises step M1, wherein M1 is to increase or improve the stem strength and / or stem diameter of the recipient plant by down-regulating, reducing or inhibiting the expression of the ZmRIN4 protein encoding gene in the recipient plant or down-regulating, reducing or inhibiting the activity or content of the ZmRIN4 protein in the recipient plant; the recipient plant is a plant containing the ZmRIN4 protein encoding gene, The ZmRIN4 protein is any of the following proteins: a1), the amino acid sequence is the protein shown in SEQ ID No.1; a2), a protein having more than 80% identity with the amino acid sequence shown in a1) obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence shown in a1); a3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of a1) or a2).

2. The method according to claim 1, characterized in that: The M1 includes introducing a gRNA gene targeting the ZmRIN4 gene and a gene encoding a Cas protein into the recipient corn.

3. The method according to claim 2, characterized in that: The target nucleotide sequence of the gRNA gene is SEQ ID No. 3, positions 2759-2778.

4. The method according to claim 2, characterized in that: The plant is corn, and the M1) is any one of the following: M1-1), deleting the nucleotide AA at positions 2773-2774 of the DNA molecule having the nucleotide sequence of SEQ ID No. 3 in the genome of the recipient corn; M1-2), deleting nucleotides 2776-2796 of the DNA molecule with the nucleotide sequence of SEQ ID No. 3 in the genome of the recipient corn; M1-3), deleting the nucleotide A at position 2773 of the DNA molecule having the nucleotide sequence of SEQ ID No. 3 in the genome of the recipient corn; M1-4), deleting the nucleotides AAA at positions 2772-2774 of the DNA molecule having the nucleotide sequence of SEQ ID No. 3 in the genome of the recipient corn; M1-5), replacing the nucleotides AAA at positions 2773-2775 of the DNA molecule with the nucleotide sequence of SEQ ID No. 3 in the genome of the recipient corn with AAAA.

5. A method for reducing plant stem strength and / or stem diameter, characterized in that: The method comprises step M2, wherein M2 is to reduce the stem strength and / or stem diameter of the recipient plant by up-regulating, increasing or promoting the expression of the ZmRIN4 protein encoding gene in claim 1 in the recipient plant or up-regulating, increasing or promoting the activity or content of the ZmRIN4 protein in the recipient plant.

6. A method for preparing corn with increased stalk strength and / or stalk diameter, characterized in that: The method comprises obtaining target corn having higher stalk strength and / or stalk diameter than that of the recipient corn by down-regulating, reducing or inhibiting the expression of the ZmRIN4 protein encoding gene of claim 1 or the activity or content of the ZmRIN4 protein in the recipient corn, wherein the recipient corn is corn containing the ZmRIN4 protein encoding gene.

7. The method according to claim 6, characterized in that: The down-regulation, reduction or inhibition of the expression of the ZmRIN4 protein encoding gene in the recipient corn or the activity or content of the ZmRIN4 protein includes introducing a gRNA gene targeting the ZmRIN4 gene and a Cas protein encoding gene into the recipient corn to down-regulate, reduce or inhibit the expression of the ZmRIN4 protein encoding gene in the recipient plant or the activity or content of the ZmRIN4 protein.

8. The method according to claim 7, characterized in that: The target nucleotide sequence of the gRNA gene is SEQ ID No. 3, positions 2759-2778.

9. Use of a protein or a substance regulating gene expression or a substance regulating the activity or content of the protein in any of the following items, wherein the gene encodes the protein, and the protein is the ZmRIN4 protein in the method according to claim 1; A1) Application in regulating plant stem strength; A2) Application in the preparation of products for regulating the strength of plant stems; A3) Application in regulating plant stem diameter; A4) Application in the preparation of products for regulating the diameter of plant stems; A5) Application in plant breeding or plant assisted breeding.

10. The use according to claim 9, characterized in that: The substance regulating gene expression or the substance regulating protein activity or content is a biological material, and the biological material is any one of the following: B1), a nucleic acid molecule that inhibits or reduces the expression of the gene encoding the ZmRIN4 protein of claim 1 or the activity of the protein of claim 1; B2), an expression cassette containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4), a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); B5), a transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3); B6), transgenic plant tissue containing the nucleic acid molecule described in B1), or transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3); B7), a transgenic plant organ containing the nucleic acid molecule described in B1), a transgenic plant organ containing the expression cassette described in B2), or a transgenic plant organ containing the recombinant vector described in B3); B8), a nucleic acid molecule encoding the protein according to claim 1; B9), an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line containing the nucleic acid molecule described in B8).

Images