Application of storage root development related protein and coding gene thereof in regulation and control of storage root development

Abstract

The invention discloses application of a storage root development related protein and a coding gene thereof in regulation and control of storage root development. The storage root development related protein (IbNF-YA1 protein) disclosed by the invention is derived from sweet potatoes and is the protein as shown in SEQ ID NO. 1. The IbNF-YA1 protein and the coding gene thereof disclosed by the invention can regulate and control the development of storage roots of plants; compared with wild plants, the weight of the storage roots of strains overexpressed with the IbNF-YA1 gene is reduced. Therefore, the IbNF-YA1 protein and the coding gene thereof play an important role in regulating the yield of the plant storage roots, the yield of the plant storage roots can be regulated through the IbNF-YA1 protein and the coding gene thereof, and the IbNF-YA1 protein and the coding gene thereof have wide application space and market prospect in the agricultural field.

Description

Technical Field

[0001] The invention relates to the field of agricultural biotechnology, and application of storage root development-related proteins and encoding genes thereof in regulating storage root development. Background Art

[0002] With the rapid increase of global population, food and energy problems have become more serious. Sweet potato has the characteristics of high yield, stable yield and high starch content. It can be used as a staple food, as well as a new type of biomass energy crop, which can be converted into fuel ethanol. The yield of sweet potato is directly determined by the number and expansion of storage roots. The differentiation and growth of sweet potato storage roots is a multiphase process, including the development of vascular cambium, cell division and expansion, starch formation and starch accumulation. This complex process involves the participation of many genes, is regulated by a variety of endogenous hormones, and is affected by a variety of external conditions. In addition to sweet potato, plants such as radish, carrot and beet also use storage roots as the main harvest. So far, there are few reports on the expansion of plant storage roots, and its regulatory mechanism is unclear. Therefore, cloning and identifying genes related to storage root development and exploring their molecular mechanisms are of great significance to improve yield and quality. Summary of the invention

[0003] The technical problem to be solved by the present invention is how to regulate the development of storage roots of plants.

[0004] In order to solve the above technical problems, the present invention first provides any of the following applications of storage root development-related proteins or substances for regulating the content or activity of storage root development-related proteins: D1) Regulates the development of plant storage roots; D2) Preparation of products for regulating the development of plant storage roots; D3) Regulates the production of plant storage roots; D4) Preparation of products for regulating the production of plant storage roots; D5) Regulates the IAA content in plant storage roots; D6) preparing products for regulating the IAA content of plant storage roots; D7) regulates the JA content in plant storage roots; D8) Preparation of products for regulating JA content in plant storage roots; D9) Regulates the dry matter content of plant storage roots; D10) Preparation of products for regulating the dry matter content of plant storage roots; D11) Regulate plant root length; D12) Preparation of products for regulating plant root growth; D13) Regulates plant leaf size; D14) preparing products for regulating plant leaf size; The storage root development-related protein (denoted as IbNF-YA1) is derived from sweet potato (Ipomoea batatas), which is as follows A1) or A2) or A3): A1) a protein with an amino acid sequence as shown in SEQ ID NO.1; A2) a protein having more than 90% identity and the same function as the protein shown in A1) obtained by replacing and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO.1; A3) A fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of A1) or A2).

[0005] The IbNF-YA1 protein in A2) above is a protein having an amino acid sequence with 90% or more identity to the protein shown in SEQ ID NO.1 and having the same function. Identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as a Matrix, setting the Gap existence cost, Per residue gap cost and Lambdaratio to 11, 1 and 0.85 (default value) respectively, and searching for the identity of a pair of amino acid sequences for calculation, the identity value (%) can be obtained. The identity of more than 90% is 90%, 95%, 96%, 97%, 98% or 99%.

[0006] The IbNF-YA1 protein in A2) above can be artificially synthesized, or its encoding gene can be synthesized first and then expressed biologically.

[0007] The gene encoding the IbNF-YA1 protein in A2) above can be obtained by deleting one or several codons of amino acid residues in the DNA sequence shown in SEQ ID NO.2, and / or performing missense mutation of one or several base pairs, and / or connecting the coding sequence of the tag shown in the above table to its 5′ end and / or 3′ end. The DNA molecule shown in SEQ ID NO.2 encodes the IbNF-YA1 shown in SEQ ID NO.1.

[0008] The tag in A3) can be a polypeptide or protein fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The tag can be Poly-Arg, Poly-His, FLAG, Strep-tag II, c-myc, MBP tag, HA tag, GST tag and / or SUMO tag, etc.

[0009] The leaf size may be reflected in leaf width and / or leaf length.

[0010] The storage roots may be storage roots at the harvest stage.

[0011] In the above application, the substance may be any one of the following B1) to B9): B1) a nucleic acid molecule encoding IbNF-YA1; B2) an expression cassette containing the nucleic acid molecule described in B1); B3) a recombinant vector containing the nucleic acid molecule described in B1) or a recombinant vector containing the expression cassette described in B2); B4) a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); B5) a transgenic plant cell line containing the nucleic acid molecule described in B1) or a transgenic plant cell line containing the expression cassette described in B2); B6) transgenic plant tissue containing the nucleic acid molecule described in B1) or transgenic plant tissue containing the expression cassette described in B2); B7) a transgenic plant organ containing the nucleic acid molecule described in B1) or a transgenic plant organ containing the expression cassette described in B2); B8) a nucleic acid molecule that reduces the level of IbNF-YA1; B9) An expression cassette, a recombinant vector, a recombinant microorganism, a transgenic plant cell line, a transgenic plant tissue or a transgenic plant organ containing the nucleic acid molecule described in B8).

[0012] In the above application, the nucleic acid molecule in B1) may be as follows: b11) or b12) or b13) or b14): b11) The coding sequence is a DNA molecule of SEQ ID NO.2 in the sequence list; b12) the DNA molecule shown in SEQ ID NO.2 in the sequence listing; b13) a DNA molecule that has 75% or more identity with the nucleotide sequence defined in b11) or b12) and encodes IbNF-YA1; b14) A DNA molecule which hybridizes under stringent conditions to the nucleotide sequence defined in b11) or b12) or b13) and encodes IbNF-YA1.

[0013] The nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA.

[0014] Those skilled in the art can easily mutate the nucleotide sequence encoding the IbNF-YA1 protein of the present invention by using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides having 75% or higher identity with the nucleotide sequence of the IbNF-YA1 protein of the present invention are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the IbNF-YA1 protein of the present invention and have the same protein function.

[0015] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or more, or 85% or more, or 90% or more, or 95% or more identity to the nucleotide sequence of the protein consisting of the amino acid sequence shown in SEQ ID NO.1 of the present invention. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0016] In the above application, the stringent conditions may be as follows: 50°C, hybridization in a mixed solution of 7% sodium dodecyl sulfate (SDS), 0.5M NaPO4 and 1mM EDTA, and rinsing in 2×SSC, 0.1% SDS at 50°C; it may also be: 50°C, hybridization in a mixed solution of 7% SDS, 0.5M NaPO4 and 1mM EDTA, and rinsing in 1×SSC, 0.1% SDS at 50°C; it may also be: 50°C, hybridization in a mixed solution of 7% SDS, 0.5M NaPO4 and 1mM EDTA, and rinsing in 0.5×SSC, 0.1% SDS at 50°C; it may also be: 50°C, hybridization in a mixed solution of 7% SDS, 0.5M NaPO4 and 1mM EDTA, and rinsing in 0.1×SSC, 0.1% SDS at 50°C; it may also be: 50°C, hybridization in a mixed solution of 7% SDS, 0.5M NaPO4 and 1mM EDTA, and rinsing in 0.1×SSC, 0.1% SDS at 50°C. Hybridize in a mixed solution of NaPO4 and 1mM EDTA, rinse in 0.1×SSC, 0.1% SDS at 65°C; or in a solution of 6×SSC, 0.5% SDS at 65°C. oThe membrane can be hybridized at 68°C and then washed once with 2×SSC, 0.1% SDS and 1×SSC, 0.1% SDS. Alternatively, the membrane can be hybridized and washed twice at 68°C in a 2×SSC, 0.1% SDS solution for 5 min each time, and then hybridized and washed twice at 68°C in a 0.5×SSC, 0.1% SDS solution for 15 min each time. Alternatively, the membrane can be hybridized and washed at 65°C in a 0.1×SSPE (or 0.1×SSC), 0.1% SDS solution.

[0017] The above-mentioned 75% or more identity may be 80%, 85%, 90% or 95% or more identity.

[0018] In the above application, the expression cassette containing the nucleic acid molecule encoding the IbNF-YA1 protein (IbNF-YA1 gene expression cassette) described in B2) refers to a DNA capable of expressing the IbNF-YA1 protein in a host cell, and the DNA may include not only a promoter for initiating transcription of the IbNF-YA1 gene, but also a terminator for terminating transcription of the IbNF-YA1 gene. Further, the expression cassette may also include an enhancer sequence. Promoters that can be used in the present invention include, but are not limited to, constitutive promoters, tissue, organ and development-specific promoters, and inducible promoters. Examples of promoters include, but are not limited to, the constitutive promoter 35S of cauliflower mosaic virus; the wound-inducible promoter from tomato, leucine aminopeptidase ("LAP", Chao et al. (1999) Plant Physiol 120:979-992); the chemically inducible promoter from tobacco, pathogenesis-related 1 (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiocarboxylic acid S-methyl ester)); the tomato proteinase inhibitor II promoter (PIN2) or the LAP promoter (both can be induced by methyl jasmonate); heat shock promoters (U.S. Pat. No. 5,187,267); tetracycline-inducible promoters (U.S. Pat. No. 5,057,422); seed-specific promoters, such as millet seed-specific promoter pF128 (CN101063139B (Chinese Patent No. 200710099169.7)), seed storage protein-specific promoters (e.g., phaseolin, napin, oleosin and soybean beta conglycin promoters (Beachy et al. (1985) EMBO J. 4: 3047-3053). They can be used alone or in combination with other plant promoters. All references cited herein are incorporated in their entirety.Suitable transcription terminators include, but are not limited to, the Agrobacterium nopaline synthase terminator (NOS terminator), the cauliflower mosaic virus CaMV 35S terminator, the tml terminator, the pea rbcS E9 terminator, and the nopaline and octopine synthase terminators (see, e.g., Odell et al. (1985) Nature 313:810; Rosenberg et al. (1987) Gene, 56:125; Guerineau et al. (1991) Mol. Gen. Genet, 262:141; Proudfoot (1991) Cell, 64:671; Sanfacon et al. Genes Dev., 5:141; Mogen et al. (1990) Plant Cell, 2:1261; Munroe et al. (1990) Gene, 91:151; Ballad et al. (1989) Nucleic Acids Res. 17:7891; Joshi et al. (1987) Nucleic Acid Res., 15:9627).

[0019] Existing expression vectors can be used to construct a recombinant vector containing the IbNF-YA1 protein gene expression cassette. The plant expression vector includes a binary Agrobacterium vector and a vector that can be used for plant microprojectile bombardment, etc. Such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa, PSN1301 or pCAMBIA1391-Xb (CAMBIA Company), etc. The plant expression vector may also contain the 3' non-translated region of the foreign gene, that is, a polyadenylic acid signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylic acid signal can guide the addition of polyadenylic acid to the 3' end of the mRNA precursor, such as the Agrobacterium crown gall induction (Ti) plasmid gene (such as the nopaline synthase gene No.), the non-translated regions transcribed at the 3' end of plant genes (such as soybean storage protein genes) all have similar functions. When using the gene of the present invention to construct a plant expression vector, enhancers can also be used, including translation enhancers or transcription enhancers. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be the same as the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging and can be natural or synthetic. The translation start region can come from the transcription start region or the structural gene. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding genes that can be expressed in plants and encode enzymes or luminescent compounds that can produce color changes ( GUS genes, luciferase genes, etc.), antibiotic marker genes (such as those that confer resistance to kanamycin and related antibiotics nptII Gene that confers resistance to the herbicide phosphinothricin there is Gene that confers resistance to the antibiotic hygromycin hp genes, and those conferring resistance to methotrexate dhfr Genes, such as EPSPS genes that confer resistance to glyphosate) or chemical resistance marker genes (such as herbicide resistance genes), mannose-6-phosphate isomerase genes that provide the ability to metabolize mannose. Considering the safety of transgenic plants, no selective marker genes can be added, and transformed plants can be directly screened by adversity.

[0020] In the above application, the vector may be a plasmid, a cosmid, a phage or a virus vector. Specifically, the plasmid may be a pCAMBIAsuper1300-GFP vector.

[0021] B3) The recombinant vector may specifically be pCAMBIA super1300-IbNF-YA1-GFP. The pCAMBIAsuper1300-IbNF-YA1-GFP is a recombinant vector obtained by replacing the small fragment between the restriction endonuclease Xba I and Pst I recognition sequences of the recombinant vector pCAMBIAsuper1300-GFP with the DNA molecule shown at positions 1 to 795 from the 5′ end of SEQ ID NO.2, and the recombinant vector can express the IbNF-YA1 protein shown in SEQ ID NO.1.

[0022] In the above application, the microorganism can be yeast, bacteria, algae or fungi. Among them, the bacteria can be Agrobacterium.

[0023] In the above applications, the transgenic plant cell lines, transgenic plant tissues and transgenic plant organs do not include propagation materials.

[0024] In the above application, the regulation of IbNF-YA1 protein content or activity may be to reduce the content or activity of IbNF-YA1 protein, the regulation of plant storage root development may be to promote or inhibit plant storage root development, the regulation of plant storage root yield may be to increase plant storage root yield, the regulation of plant storage root IAA content may be to reduce plant storage root IAA content, the regulation of plant storage root JA content may be to increase plant storage root JA content, the regulation of plant storage root dry matter content may be to reduce plant storage root dry matter content, the regulation of plant root length may be to increase plant root length, and the regulation of plant leaf size may be to increase plant leaf size; The regulation of IbNF-YA1 protein content or activity may be to increase the content or activity of IbNF-YA1 protein, the regulation of plant storage root development may be to inhibit or promote plant storage root development, the regulation of plant storage root yield may be to reduce the yield of plant storage roots, the regulation of plant storage root IAA content may be to increase the plant storage root IAA content, the regulation of plant storage root JA content may be to reduce the plant storage root JA content, the regulation of plant storage root dry matter content may be to increase the plant storage root dry matter content, the regulation of plant root length may be to reduce plant root length, and the regulation of plant leaf size may be to reduce plant leaf size.

[0025] Any of the following uses of the IbNF-YA1 protein or the substance for regulating the content or activity of the IbNF-YA1 protein: E1) Cultivating plants with enhanced or reduced storage root development; E2) Breeding plants with increased or decreased storage root production; E3) Cultivate plants with reduced or increased IAA content in storage roots; E4) Cultivate plants with increased or decreased JA content in storage roots; E5) Cultivating plants with reduced or increased storage root dry matter content; E6) Breeding plants with increased or decreased root length; E7) Cultivate plants with increased or decreased leaf size.

[0026] In the above application, the plant may be any one of the following M1)-M7): M1) dicots or monocots; M2) Convolvulaceae or Cruciferae or Apiaceae or Chenopodiaceae; M3) Ipomoea batatas; M4) Sweet potato.

[0027] The present invention also provides the following method X1) or X2): X1) A method for cultivating a plant with reduced storage root yield, comprising: increasing the content or activity of IbNF-YA1 protein in a recipient plant, or increasing the expression level of a gene encoding the IbNF-YA1 protein, to obtain a target plant with reduced storage root yield compared with the recipient plant; X2) A method for reducing the yield of storage roots in plants, comprising: increasing the content or activity of IbNF-YA1 protein in a recipient plant, or increasing the expression level of a gene encoding the IbNF-YA1 protein, to obtain a target plant having a reduced yield of storage roots compared to the recipient plant, thereby achieving a reduction in the yield of storage roots.

[0028] In the above method, the encoding gene may be the nucleic acid molecule described in B1).

[0029] In the above method, the plant may be any one of the following M1)-M7): M1) dicots or monocots; M2) Convolvulaceae or Cruciferae or Apiaceae or Chenopodiaceae; M3) Ipomoea batatas; M4) Sweet potato.

[0030] The target plant is understood to include not only the first generation plant in which the IbNF-YA1 protein or its encoding gene is modified, but also its progeny. For the target plant, the gene can be propagated in the species, and the gene can also be transferred into other varieties of the same species, especially including commercial varieties, using conventional breeding techniques. The target plant includes seeds, callus, whole plants and cells.

[0031] IbNF-YA1 protein also falls within the protection scope of the present invention.

[0032] The substance that regulates the content or activity of IbNF-YA1 protein also falls within the protection scope of the present invention.

[0033] The IbNF-YA1 protein derived from sweet potato and its encoding gene of the present invention can regulate the development of storage roots of plants: compared with wild-type plants, the weight of storage roots of strains overexpressing the IbNF-YA1 gene is reduced. Therefore, the IbNF-YA1 protein and its encoding gene of the present invention play an important role in regulating the yield of plant storage roots. The yield of plant storage roots can be regulated by the IbNF-YA1 protein and its encoding gene, and have broad application space and market prospects in the agricultural field.

[0034] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 The results are as follows: the identification results of the transgenic sweet potato plants of the pCAMBIA super1300-IbNF-YA1 vector, wherein M is a DNA molecule marker, WT is the wild-type sweet potato plant Li Zixiang, P is a positive control (pCAMBIA super1300-IbNF-YA1-GFP), W is a negative control water, and OE1-OE31 are overexpression positive transgenic plants obtained by pCAMBIA super1300-IbNF-YA1-GFP.

[0036] Figure 2 for IbNF-YA1 Detection of gene expression. WT is the wild type of sweet potato chestnut fragrance.

[0037] Figure 3 The results of phenotypic identification of transgenic sweet potato in vitro plants are shown in Figures AD. The results of root length, root number, leaf length, and leaf width are shown in Figures A and B.

[0038] Figure 4 The phenotype of transgenic sweet potato plants in pots. A is the appearance of the plant; B is the result of the storage root weight of a single plant.

[0039] Figure 5 AF is the field phenotype of transgenic sweet potato plants. AF is the root growth status of sweet potato at 20 days, 40 days, 60 days, 80 days, 100 days and 120 days respectively, and G is the weight of storage roots per plant.

[0040] Figure 6 The results of IAA and JA content determination in the root tubers of transgenic and wild-type plants are shown in Figure 1. A is the result of IAA content determination, and B is the result of JA content determination.

[0041] Figure 7 The results are for determination of dry matter content in root tubers of transgenic plants and wild-type plants. DETAILED DESCRIPTION

[0042] The experimental methods in the following examples are conventional methods unless otherwise specified, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, instruments, etc. used in the following examples are all commercially available unless otherwise specified. The quantitative tests in the following examples are all repeated at least three times, and the results are averaged.

[0043] The sweet potato line 'XT1' is recorded in the following document: Jia Licong. Characterization and genetic composition analysis of somatic hybrids between sweet potato and its wild relatives, PhD dissertation, China Agricultural University, 2016. The public may obtain it from the Sweet Potato Genetics and Breeding Laboratory of China Agricultural University with the consent of the applicant to repeat this experiment, but it cannot be used for other purposes.

[0044] The vector pCAMBIAsuper1300-GFP is a product of Wuhan Miaoling Biotechnology Co., Ltd., and the product catalog number is L3080.

[0045] Embodiment 1, IbNF-YA1 Acquisition of genes 1. Obtaining cDNA template Total RNA from the sweet potato line 'XT1' seedlings was extracted using a plant total RNA extraction kit and reverse transcribed into cDNA.

[0046] 2. Using the cDNA obtained in step 1 as a template, use primers IbNF-YA1 -F and IbNF-YA1 -R was used for PCR amplification to obtain a PCR amplification product of about 795 bp and sequenced. The primer sequences are as follows: IbNF-YA1 -F:5′-ATGCAATCGAAGTCTGGAACT -3′; IbNF-YA1 -R: 5′- TTAGTTGCAACTAACACTCCCC-3′.

[0047] The results showed that the nucleotide sequence of the PCR amplification product was as shown in SEQ ID NO.2 from position 1 to 795 from the 5′ end. The gene shown in the sequence was named IbNF-YA1 The gene, the protein it encodes is named IbNF-YA1 protein or protein IbNF-YA1, and the amino acid sequence is shown in SEQ ID NO.1.

[0048] SEQ ID No.1 (IbNF-YA1 protein, sweet potato (Ipomoea batatas)): MQSKSGTVNRVEARSYNLPGSAVYADPWWTAAGCNPINPRSKRASVSDSSSLEQSVDDQSQSDGDDDTAKKSQNSAPSDQDGNYGQVDQSLQHAKSTISARTDESLIQPPQLELVGHSIACAPNLYTDPYFMGMMASYGQPLVPPQFLDLQQARMPLPLEMTQEPVYVNAKQYHGILRRRESRAKAESQKKLIKARKPYLHESRHQHALRRARSTGGRFAKKSETAASKETGSGAAADPQLPSINGGSSYVGGSSGGRGSVSCN。

[0049] SEQ ID No.2 ( IbNF-YA1 Gene, sweet potato (Ipomoea batatas)): ATGCAATCGAAGTCTGGAACTGTAAATCGGGTAGAAGCTCGTTCATACAATCTTCCAGGTTCAGCAGTATATGCTGATCCCTGGTGGACTGCTGCTGGCTGTAATCCAATTAACCCTCGCTCGAAGCGGGCAAGTGTATCTGATTCATCTTCACTGGAGCAATCTGTTGATGATCAATCACAGTCGGATGGTGATGATGATACTGCTAAAAAGTCACAAAATTCTGCACCTTCAGATCAAGATGGAAATTATGGACAAGTGGATCAGAGTCTTCAGCACGCCAAATCAACAATATCTGCAAGAACTGATGAGAGCCTTATACAGCCGCCACAGCTTGAACTTGTTGGGCATTCAATTGCTTGCGCTCCAAATCTGTACACAGACCCATATTTTATGGGGATGATGGCCTCTTATGGCCAGCCATTGGTTCCTCCTCAGTTTCTTGATCTGCAACAAGCTAGGATGCCTTTGCCACTTGAAATGACTCAAGAGCCCGTTTACGTGAATGCCAAGCAGTATCATGGGATCCTCCGGAGGAGAGAGTCACGTGCTAAAGCAGAATCTCAAAAGAAGCTAATAAAAGCAAGAAAGCCGTATCTTCACGAGTCTCGACATCAGCATGCTTTGAGGAGGGCTAGGAGTACTGGAGGGCGTTTCGCAAAGAAATCCGAGACAGCTGCTTCAAAAGAAACAGGCTCGGGTGCAGCTGCCGATCCCCAACTTCCATCGATAAATGGAGGCAGCAGTTACGTTGGAGGTTCATCAGGTGGACGGGGGAGTGTTAGTTGCAACTAA。

[0050] Example 2. Application of IbNF-YA1 protein in increasing the yield of storage roots of plants.

[0051] I. Construction of recombinant vector pCAMBIA super1300-IbNF-YA1-GFP 1. Artificially synthesize the double-stranded DNA molecule shown in SEQ ID NO.2 from position 1 to 795 from the 5' end. Use the double-stranded DNA molecule as a template and use OE-F-Xba I:5'-GC TCTAGA ATGCAATCGAAGTCTGGAACT-3' (underlined is the recognition sequence of restriction endonuclease Xba I) and OE-R-Pst I: 5'-AA CTGCAG PCR amplification was performed using primer TTAGTTGCAACTAACACTCCCC -3' (the underline is the recognition sequence of restriction endonuclease Pst I) to obtain a double-stranded DNA molecule containing restriction endonuclease XbaI at the 5' end and restriction endonuclease Pst I at the 3' end.

[0052] 2. Double-digest the vector pCAMBIAsuper1300-GFP with restriction endonucleases Xba I and Pst I to recover the vector backbone 1 of about 10783 bp.

[0053] 3. The PCR product obtained in step 1 was double-digested with restriction endonucleases Xba I and Pst I to recover fragment 2 containing about 807 bp.

[0054] 4. Connect fragment 2 to vector backbone 1 to obtain the recombinant vector pCAMBIA super1300-IbNF-YA1-GFP.

[0055] According to the sequencing results, the structure of the recombinant vector pCAMBIA super1300-IbNF-YA1-GFP was described as follows: the small fragment between the restriction endonuclease Xba I and Pst I recognition sequences of the recombinant vector pCAMBIAsuper1300-GFP was replaced with the DNA molecule shown in SEQ ID NO.2 from position 1 to 795 from the 5′ end, and the recombinant vector could express the IbNF-YA1 protein shown in SEQ ID NO.1.

[0056] 2. Obtaining transgenic sweet potato plants 1. Induction of embryonic callus and establishment of embryonic cell suspension line of sweet potato variety Lizixiang The harvested chestnut-scented sweet potato tubers were used to provide sweet potato stem tips. The stem tip meristems were peeled and inoculated on MS solid medium containing 2.0 mg / L 2,4-D. Callus tissue was induced in dark culture at room temperature of 27±1℃. Then, the callus tissue was expanded and subcultured to establish an embryonic cell suspension line for transformation.

[0057] 2. Cultivation of Agrobacterium After pCAMBIA super1300-IbNF-YA1-GFP was introduced into Agrobacterium, the Agrobacterium culture was activated on the resistance plate, and a single colony was picked and inoculated into 5 mL of LB liquid medium with the corresponding antibiotic added, and cultured at 28°C with shaking at 200 rpm until the OD 600 The value is in the range of 0.4 to 0.6.

[0058] 3. Preparation of suspension cell lines and infection with Agrobacterium tumefaciens Select the suspension cell line obtained in step 1 that has grown for 8 to 12 weeks and is in good condition for grinding. After subculture for 3 days, take out the embryonic suspension cell mass with a diameter of about 0.7-1.4 mm and use the Agrobacterium solution obtained in step 2 for infection and transformation.

[0059] 4. Co-culture and delayed culture The suspension cell line infected with Agrobacterium obtained in step 3 was transferred to MS solid medium containing 30 mg / L acetosyringone (AS) and 2 mg / L 2,4-D for co-culture in a dark environment at 27±1°C. After 3 days of co-culture, the cell mass was washed once with MS liquid medium containing 200 mg / L cephalosporin (CS) and 2 mg / L 2,4-D, and then soaked in MS liquid medium containing 100 mg / L CS and 2 mg / L 2,4-D for 30 min, and finally delayed cultured with MS liquid medium containing 2 mg / L 2,4-D for 1 week. The culture conditions were 27±1°C, 500 Lux light (13 h light per day), and shaking at 100 rpm.

[0060] 5. Screening and culture of resistant cell clusters After delayed culture, the cell mass was transferred to MS solid medium containing 5.0 mg / L hygromycin (Hyg), 100 mg / L CS and 2 mg / L 2,4-D for dark culture at 27±1°C, and the medium was replaced every 2 weeks. After 4 weeks, the resistant cell mass was transferred to MS solid medium containing 10.0 mg / L Hyg, 100 mg / L CS and 2 mg / L 2,4-D and cultured for 4 to 8 weeks, with the medium replaced every 2 weeks.

[0061] 6. Induction of somatic embryos The resistant cell clusters with good growth status were transferred to MS medium containing 1.0 mg / L ABA and 100 mg / L CS to induce somatic embryo growth. The culture conditions were 27±1℃ and 3000 Lux light (13 h light per day).

[0062] 7. Regeneration and identification of transgenic plants The mature somatic embryos that turned green on the medium containing ABA after 2 to 4 weeks of induction were transferred to MS solid medium together with callus tissue and cultured until complete plants were formed. The temperature was 27±1℃, the light intensity was 13 h per day, and the light intensity was 3000 Lux. Transgenic sweet potato plants expressing the pCAMBIA super1300-IbNF-YA1-GFP vector were obtained.

[0063] 8. Identification of transgenic plants: A combination of PCR and qRT-PCR was used.

[0064] 1) The PCR detection method is as follows: DNA of wild-type Li Zixiang and transgenic plants was extracted for PCR identification. pCAMBIAsuper1300-IbNF-YA1-GFP vector was used as a positive control, water and wild-type Li Zixiang were used as negative controls, and pCAMBIAsuper1300-F and pCAMBIA super1300-R were used to detect transgenic sweet potato plants of pCAMBIA super1300-IbNF-YA1-GFP. The PCR product of the positive plant contained a specific fragment of 795 bp. The primers are as follows: pCAMBIA super1300-F: 5'- GACGCACAATCCCACTATCC -3'; pCAMBIA super1300-R: 5'-TTAGTTGCAACTAACACTCCCC-3'.

[0065] The amplified PCR products were separated by electrophoresis in 1% (w / v) agarose gel, and the strain numbers of the PCR-positive plants were recorded.

[0066] The results are as follows Figure 1 As shown, the wild-type Li Zi Xiang and the negative control water did not show any bands. In the pseudo-transgenic sweet potato plants obtained by pCAMBIAsuper1300-IbNF-YA1-GFP, OE-1~OE-31 and the positive control all showed specific electrophoresis bands near 795 bp, indicating that OE-1~OE-31 were all positive transgenic plants; in the pseudo-transgenic sweet potato plants obtained by pCAMBIA1300-35SI-X-IbNF-YA1, Ri-1~Ri-12 and the positive control all showed specific electrophoresis bands near 790 bp, indicating that Ri-1~Ri-12 were all positive transgenic plants.

[0067] 2) qRT-PCR The RNA of each positive sweet potato plant detected in step 1) was extracted and reverse transcribed to obtain cDNA, which was then subjected to qRT-PCR, with the wild-type sweet potato plant Lizixiang as a control.

[0068] Ibactin The gene was used as an internal reference, and the primers were as follows: IbActin -F: 5′-AGCAGCATGAAGATTAAGGTTGTAGCAC-3′; IbActin -R: 5′-TGGAAAATTAGAAGCACTTCCTGTGAAC-3′.

[0069] Detection IbNF-YA1 The gene primer sequences are: IbNF-YA1 -qRT-F: 5′-ATCAGAGTCTTCAGCACGCC -3′; IbNF-YA1 -qRT-R: 5′-CAGATTTGGAGCGCAAGCAA-3′.

[0070] The results are as follows Figure 2 As shown, OE-1 to OE-31 IbNF-YA1 The gene expression levels were significantly higher than those of the wild type. IbNF- YA1 Significantly differentially expressed in transgenic sweet potato plants. IbNF-YA1 The transgenic sweet potato lines OE-29 and OE-31 were propagated to obtain IbNF-YA1 The T1 generation transgenic sweet potato lines OE-29 and OE-31 were subjected to subsequent experiments.

[0071] 3. Phenotypic identification of transgenic sweet potato plants Test plants: Wild-type Lizixiang (WT), overexpression IbNF-YA1 T1 generation transgenic sweet potato lines OE-29 and OE-31.

[0072] 1. In vitro phenotypic identification of transgenic sweet potato plants Specific steps: Plant the plants to be tested on MS solid culture medium and culture them at 27±1℃, 13h of light per day, and 3000 Lux of light intensity. After 4 weeks, count the root length, root number, leaf width and leaf length of each strain to preliminarily identify its development. Set up 3 replicates for each strain and take the average value of the results.

[0073] The results are as follows Figure 3As shown, after 4 weeks of cultivation on MS solid medium, there were significant differences in root length and leaf width between OE-29, OE-31 plants and wild-type Li Zixiang, and the growth of the overexpression plants was significantly weaker than that of the wild type.

[0074] Preliminary interpretation of in vitro identification results IbNF-YA1 Overexpression of the gene weakened the growth of sweet potato plants.

[0075] 2. Potted phenotype identification of transgenic sweet potato plants After acclimation, the test tube seedlings of the plants to be tested were transplanted to the isolated field. After growing for 2 months, 20 cm stem segments were cut and planted in 35 x 35 cm round pots. Samples were taken and photographed to observe their growth status at 15 d, 30 d, 60 d, 80 d, 120 d and 150 d, and the weight of the storage roots of each plant was measured. Three replicates were set for each strain.

[0076] The results are as follows Figure 4 As shown, the tuber weight of the overexpression line was significantly higher than that of the WT line in the early stage (before 60 days), and the tuber weight of the overexpression line was significantly lower than that of the WT line in the later stage (after 80 days).

[0077] The experimental results show that IbNF-YA1 Genes significantly regulate sweet potato storage root development.

[0078] 3. Field phenotypic identification of transgenic sweet potato plants The stem segments of the plants to be tested were planted in the field, and five consecutive samples were taken at 20 d, 40 d, 60 d, 80 d, 100 d and 120 d to observe their growth status, and the weight of the storage roots of each plant was measured.

[0079] The results are as follows Figure 5 As shown in the figure, the root weight of the overexpression strain was significantly higher than that of the WT strain in the early stage (40 days), and significantly lower than that of the WT strain in the later stage (after 60 days). When the sweet potato was harvested at 120 days, the root weight of the overexpression plant was reduced by 29.15% to 40.22% compared with that of the WT plant.

[0080] The experimental results show that IbNF-YA1 Genes significantly regulate sweet potato storage root development.

[0081] 4. Determination of physiological and biochemical indicators (1) Determination of IAA and JA content Auxin (IAA) plays an important role in the root system. It can affect the growth and development of primary roots, gravitropism, the formation of root caps, lateral roots and root hairs, and the maintenance of stem cell characteristics in the root apical meristem through polar transport, concentration gradient distribution and signal transduction. Studies have shown that the concentration of IAA in early swelling sweet potato storage roots gradually increases, but after the sweet potato storage roots begin to grow secondary growth, the IAA content gradually decreases. Therefore, IAA has an important relationship with the secondary growth of sweet potato storage roots.

[0082] In addition to participating in plant resistance responses such as mechanical damage and pests and diseases, jasmonic acid (JA) also regulates processes such as plant embryo differentiation, seed germination, aging and root development. The JA content in sweet potato storage roots is relatively high, and exogenous JA can increase the probability and diameter of sweet potato storage roots.

[0083] The determination method of IAA and JA content refers to the reference: Xue Luyao. Sweet potato IbbHLH118 , IbNF-YA1 and IbNF- YA10 Research on the function and molecular regulation mechanism of genes, PhD dissertation, China Agricultural University, 2023.

[0084] The storage roots of OE-29, OE-31 and wild-type Li Zixiang plants harvested 120 days in the field in step 3 were taken to determine the IAA and JA contents.

[0085] The results are as follows Figure 6 As shown, IbNF-YA1 The IAA content in the tuberous roots of overexpressing sweet potato plants was significantly higher than that of WT (increased by 21.45% to 33.6%), while the JA content was significantly lower than that of WT (decreased by 46.97% to 57.6%).

[0086] The above results show that IbNF-YA1 Genes can regulate the development of sweet potato storage roots through IAA and JA.

[0087] (2) Determination of dry matter rate The field potato tubers harvested in the field 120 days after harvest in step 3 were chopped up, 100 g were weighed and put into paper bags (3 replicates), and the samples were dried to constant weight (80°C oven). The dry matter content was calculated as the weight after drying (g) divided by 100 (g) multiplied by 100%.

[0088] Determination method refers to reference: Xue Luyao. Sweet potato IbbHLH118 , IbNF-YA1 and IbNF-YA10 Research on the function and molecular regulation mechanism of genes, PhD dissertation, China Agricultural University, 2023.

[0089] The storage roots of OE-29, OE-31 and wild-type Lizixiang plants were harvested in the field at 120 days and their dry matter content was determined.

[0090] The results are as follows Figure 7 As shown, IbNF-YA1 The dry matter content of the overexpression plants was significantly higher than that of WT (increased by 33.08% to 35.2%).

[0091] The above results show that IbNF-YA1 Changes in dry matter rate of transgenic sweet potato storage roots.

[0092] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. Any of the following uses of a storage root development-related protein or a substance that regulates the content or activity of the storage root development-related protein: D1) Regulates the development of plant storage roots; D2) Preparation of products for regulating the development of plant storage roots; D3) Regulates the production of plant storage roots; D4) Preparation of products for regulating the production of plant storage roots; D5) Regulates the IAA content in plant storage roots; D6) preparing products for regulating the IAA content of plant storage roots; D7) regulates the JA content in plant storage roots; D8) Preparation of products for regulating JA content in plant storage roots; D9) Regulates the dry matter content of plant storage roots; D10) Preparation of products for regulating the dry matter content of plant storage roots; D11) Regulate plant root length; D12) Preparation of products for regulating plant root growth; D13) Regulates plant leaf size; D14) preparing products for regulating plant leaf size; The storage root development-related protein is as follows A1) or A2) or A3): A1) a protein with an amino acid sequence as shown in SEQ ID NO.1; A2) a protein having more than 90% identity and the same function as the protein shown in A1) obtained by replacing and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO.1; A3) A fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of A1) or A2).

2. The use according to claim 1, characterized in that: The substance is any one of the following B1) to B9): B1) a nucleic acid molecule encoding the storage root development-related protein of claim 1; B2) an expression cassette containing the nucleic acid molecule described in B1); B3) a recombinant vector containing the nucleic acid molecule described in B1) or a recombinant vector containing the expression cassette described in B2); B4) a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); B5) a transgenic plant cell line containing the nucleic acid molecule described in B1) or a transgenic plant cell line containing the expression cassette described in B2); B6) transgenic plant tissue containing the nucleic acid molecule described in B1) or transgenic plant tissue containing the expression cassette described in B2); B7) a transgenic plant organ containing the nucleic acid molecule described in B1) or a transgenic plant organ containing the expression cassette described in B2); B8) a nucleic acid molecule that reduces the content of the storage root development-related protein of claim 1; B9) An expression cassette, a recombinant vector, a recombinant microorganism, a transgenic plant cell line, a transgenic plant tissue or a transgenic plant organ containing the nucleic acid molecule described in B8).

3. The use according to claim 2, characterized in that: B1) The nucleic acid molecule is as follows: b11) or b12) or b13) or b14): b11) The coding sequence is a DNA molecule of SEQ ID NO.2 in the sequence list; b12) the DNA molecule shown in SEQ ID NO.2 in the sequence listing; b13) a DNA molecule having 75% or more identity with the nucleotide sequence defined in b11) or b12) and encoding the storage root development-related protein of claim 1; b14) A DNA molecule which hybridizes with the nucleotide sequence defined in b11) or b12) or b13) under stringent conditions and encodes the storage root development-related protein of claim 1.

4. The use according to any one of claims 1 to 3, characterized in that: The regulating the content or activity of the storage root development-related protein is to increase the content or activity of the storage root development-related protein, the regulating plant storage root development is to inhibit or promote plant storage root development, the regulating plant storage root yield is to reduce the plant storage root yield, the regulating plant storage root IAA content is to increase the plant storage root IAA content, the regulating plant storage root JA content is to reduce the plant storage root JA content, the regulating plant storage root dry matter content is to increase the plant storage root dry matter content, the regulating plant root length is to reduce the plant root length, and the regulating plant leaf size is to reduce the plant leaf size.

5. Any of the following uses of the storage root development-related protein of claim 1 or the substance of any one of claims 1 to 3: E1) Cultivating plants with enhanced or reduced storage root development; E2) Breeding plants with increased or decreased storage root production; E3) Cultivate plants with reduced or increased IAA content in storage roots; E4) Cultivate plants with increased or decreased JA content in storage roots; E5) Cultivating plants with reduced or increased storage root dry matter content; E6) Breeding plants with increased or decreased root length; E7) Breeding plants with increased or decreased leaf size.

6. The use according to any one of claims 1 to 5, characterized in that: The plant is any one of the following M1)-M7): M1) dicots or monocots; M2) Convolvulaceae or Cruciferae or Apiaceae or Chenopodiaceae; M3) Ipomoea batatas; M4) Sweet potato.

7. The following method X1) or X2): X1) A method of developing plants with reduced storage root production, comprising: Increasing the content or activity of the storage root development-related protein of claim 1 in a recipient plant, or increasing the expression level of the gene encoding the storage root development-related protein of claim 1, to obtain a target plant with reduced storage root yield compared with the recipient plant; X2) A method for reducing the yield of storage roots in plants, comprising: increasing the content or activity of the storage root development-related protein described in claim 1 in a recipient plant, or increasing the expression level of the gene encoding the storage root development-related protein described in claim 1, to obtain a target plant with reduced storage root yield compared to the recipient plant, thereby achieving a reduction in storage root yield.

8. The method according to claim 7, characterized in that: The plant is any one of the following M1)-M7): M1) dicots or monocots; M2) Convolvulaceae or Cruciferae or Apiaceae or Chenopodiaceae; M3) Ipomoea batatas; M4) Sweet potato.

9. The storage root development-related protein of claim 1.

10. The substance for regulating the content or activity of the storage root development-related protein according to any one of claims 1 to 3.

Images