Storage root development related protein and coding gene in regulating storage root development

Abstract

The application discloses a storage root development related protein and application of a coding gene thereof in regulating storage root development. The storage root development related protein (IbNF-YA1 protein) disclosed by the application is derived from sweet potato and is a protein shown in SEQ ID NO. 1. The IbNF-YA1 protein and the coding gene thereof can regulate storage root development of plants: compared with wild type plants, the storage root weight of a strain overexpressing the IbNF-YA1 gene is reduced. Therefore, the IbNF-YA1 protein and the coding gene thereof play an important role in regulating the storage root yield of plants, and the storage root yield of plants can be regulated through the IbNF-YA1 protein and the coding gene thereof, so that the IbNF-YA1 protein and the coding gene thereof have wide application space and market prospects in the field of agriculture.

Description

Technical Field

[0001] This invention relates to the field of agricultural biotechnology, specifically the application of storage root development-related proteins and their encoding genes in regulating storage root development. Background Technology

[0002] With the surge in global population, food and energy issues have become increasingly severe. Sweet potatoes, characterized by high and stable yields and high starch content, can serve as both a staple food and a novel biomass energy crop, converting into fuel ethanol. Sweet potato yield is directly determined by the number and extent of storage root expansion. The differentiation and growth of sweet potato storage roots is a multiphase process, involving vascular cambium development, cell division and expansion, starch formation, and starch accumulation. This complex process involves numerous genes, is regulated by various endogenous hormones, and is influenced by a variety of external conditions. Besides sweet potatoes, plants such as radishes, carrots, and sugar beets also primarily harvest storage roots. To date, reports on plant storage root expansion are scarce, and its regulatory mechanisms remain unclear. Therefore, cloning and identifying genes related to storage root development and exploring their molecular mechanisms are crucial for improving yield and quality. Summary of the Invention

[0003] The technical problem to be solved by this invention is how to regulate the development of storage roots in plants.

[0004] To address the aforementioned technical problems, the present invention first provides any of the following applications of storage root development-related proteins or substances regulating the content or activity of said storage root development-related proteins:

[0005] D1) Regulates the development of plant storage roots;

[0006] D2) Prepare products that regulate the development of plant storage roots;

[0007] D3) Regulates the yield of plant storage roots;

[0008] D4) Prepare products that regulate the yield of plant storage roots;

[0009] D5) Regulates the IAA content in plant storage roots;

[0010] D6) Prepare products that regulate the IAA content in plant storage roots;

[0011] D7) Regulates the JA content in plant storage roots;

[0012] D8) Prepare products that regulate the JA content in plant storage roots;

[0013] D9) Regulates the content of dry matter stored in plant roots;

[0014] D10) is used to prepare products that regulate the content of dry matter in plant root storage;

[0015] D11) Regulates plant root length;

[0016] D12) Prepare products that regulate plant root length;

[0017] D13) Regulates plant leaf size;

[0018] D14) Prepare products that regulate plant leaf size;

[0019] The storage root development-related protein (denoted as IbNF-YA1) is derived from sweet potato (Ipomoea batatas), and is as follows: A1) or A2) or A3):

[0020] A1) A protein with the amino acid sequence shown in SEQ ID NO.1;

[0021] A2) A protein that has more than 90% identity and function with the protein shown in A1) obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO.1;

[0022] A3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of A1) or A2).

[0023] The IbNF-YA1 protein in A2) above is a protein that shares more than 90% amino acid sequence identity with the protein shown in SEQ ID NO.1 and has the same function. Identity refers to the similarity of the amino acid sequence. The identity of the amino acid sequence can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambdaratio to 11, 1, and 0.85 (default values) respectively, and performing a search for the identity of a pair of amino acid sequences to calculate the identity value (%). The identity of more than 90% means 90%, 95%, 96%, 97%, 98%, or 99%.

[0024] The IbNF-YA1 protein in A2 above can be synthesized artificially, or its encoding gene can be synthesized first and then expressed biologically.

[0025] The gene encoding the IbNF-YA1 protein in A2) above can be obtained by deleting one or more amino acid residues from the codons in the DNA sequence shown in SEQ ID NO.2, and / or by performing a missense mutation of one or more base pairs, and / or by attaching the coding sequence of the tag shown in the table above to its 5′ end and / or 3′ end. The DNA molecule shown in SEQ ID NO.2 encodes IbNF-YA1 shown in SEQ ID NO.1.

[0026] The tag described in A3) can be a polypeptide or protein fused with the target protein using in vitro DNA recombination technology, to facilitate the expression, detection, tracing, and / or purification of the target protein. The tag can be Poly-Arg, Poly-His, FLAG, Strep-tag II, c-myc, MBP tag, HA tag, GST tag, and / or SUMO tag, etc.

[0027] The size of the leaf can be reflected in the leaf width and / or leaf length.

[0028] The stored root can be a stored root from the harvest period.

[0029] In the above applications, the substance may be any one of B1) to B9):

[0030] B1) Nucleic acid molecules encoding IbNF-YA1;

[0031] B2) An expression cassette containing the nucleic acid molecule described in B1);

[0032] B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0033] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);

[0034] B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2);

[0035] B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2);

[0036] B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2);

[0037] B8) Nucleic acid molecules that reduce IbNF-YA1 content;

[0038] B9) Expression cassettes, recombinant vectors, recombinant microorganisms, transgenic plant cell lines, transgenic plant tissues or transgenic plant organs containing the nucleic acid molecules described in B8).

[0039] In the above applications, the nucleic acid molecule described in B1) may be as follows: (b11), (b12), (b13), or (b14)

[0040] b11) The coding sequence is the DNA molecule of SEQ ID NO.2 in the sequence listing;

[0041] b12) The DNA molecule shown in SEQ ID NO.2 of the sequence listing;

[0042] b13) has 75% or more identity with the nucleotide sequence defined by b11) or b12) and encodes a DNA molecule that encodes IbNF-YA1;

[0043] b14) hybridizes under strict conditions with the nucleotide sequence defined by b11) or b12) or b13) and encodes a DNA molecule of IbNF-YA1.

[0044] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.

[0045] Those skilled in the art can readily mutate the nucleotide sequence encoding the IbNF-YA1 protein of this invention using known methods, such as directed evolution and point mutation. Artificially modified nucleotides that have 75% or higher identity with the nucleotide sequence of the IbNF-YA1 protein of this invention, as long as they encode the IbNF-YA1 protein of this invention and have the same protein function, are all derived from and equivalent to the nucleotide sequence of this invention.

[0046] As used herein, the term "identity" refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or higher, 85% or higher, 90% or higher, or 95% or higher identity with the nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO. 1 of this invention. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0047] In the above applications, the stringent conditions can be as follows: hybridization at 50°C in a mixed solution of 7% sodium dodecyl sulfate (SDS), 0.5M NaPO4, and 1mM EDTA, followed by rinsing at 50°C in 2×SSC and 0.1% SDS; alternatively: hybridization at 50°C in a mixed solution of 7% SDS, 0.5M NaPO4, and 1mM EDTA, followed by rinsing at 50°C in 1×SSC and 0.1% SDS; alternatively: hybridization at 50°C in a mixed solution of 7% SDS, 0.5M NaPO4, and 1mM EDTA, followed by rinsing at 50°C in 0.5×SSC and 0.1% SDS; alternatively: hybridization at 50°C in a mixed solution of 7% SDS, 0.5M NaPO4, and 1mM EDTA, followed by rinsing at 50°C in 0.1×SSC and 0.1% SDS; alternatively: hybridization at 50°C in a mixed solution of 7% SDS, 0.5M NaPO4, and 1mM EDTA, followed by rinsing at 50°C in 0.1×SSC and 0.1% SDS; alternatively: hybridization at 50°C in a mixed solution of 7% SDS, 0.5M NaPO4, and 1mM EDTA, followed by rinsing at 50°C in 7% SDS, 0.5M NaPO4, and 1mM EDTA. Hybridization was performed in a mixed solution of NaPO4 and 1 mM EDTA, followed by rinsing at 65°C in 0.1×SSC and 0.1% SDS; alternatively, hybridization was performed in a solution of 6×SSC and 0.5% SDS at 65°C. o Hybridize at C, then wash the membrane once each with 2×SSC, 0.1% SDS and 1×SSC, 0.1% SDS; alternatively: hybridize and wash twice at 68°C in a solution of 2×SSC, 0.1% SDS, each time for 5 min, then hybridize and wash twice at 68°C in a solution of 0.5×SSC, 0.1% SDS, each time for 15 min; alternatively: hybridize and wash the membrane at 65°C in a solution of 0.1×SSPE (or 0.1×SSC), 0.1% SDS.

[0048] The aforementioned 75% or higher degree of identity can be 80%, 85%, 90%, or 95% or higher degree of identity.

[0049] In the above application, the expression cassette (IbNF-YA1 gene expression cassette) containing a nucleic acid molecule encoding the IbNF-YA1 protein described in B2) refers to DNA capable of expressing the IbNF-YA1 protein in host cells. This DNA may include not only a promoter to initiate IbNF-YA1 gene transcription but also a terminator to terminate IbNF-YA1 gene transcription. Furthermore, the expression cassette may also include an enhancer sequence. Promoters that can be used in this invention include, but are not limited to: constitutive promoters, tissue-, organ-, and development-specific promoters, and inducible promoters. Examples of promoters include, but are not limited to: constitutive promoter 35S of cauliflower mosaic virus; wound-inducible promoters from tomatoes, leucine aminopeptidase ("LAP", Chao et al. (1999) Plant Physiol 120: 979-992); chemically induced promoters from tobacco, pathogenesis-related 1 (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiohydroxy acid S-methyl ester)); tomato protease inhibitor II promoter (PIN2) or LAP promoter (both induced by methyl jasmonic acid); heat shock promoters (US Patent 5,187,267); tetracycline-inducible promoters (US Patent 5,057,422); seed-specific promoters, such as the millet seed-specific promoter pF128 (CN101063139B (Chinese Patent 200710099169.7)); and promoters specific to seed storage proteins (e.g., beta-carotene, napin, etc.). The promoters of oleosin and soybean beta-conglycin (Beachy et al. (1985) EMBO J. 4: 3047-3053)). They can be used alone or in combination with other plant promoters. All references cited herein are cited in full.Suitable transcription terminators include, but are not limited to: Agrobacterium carmine synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator, and carmine and octopine synthase terminators (see, for example: Odell et al. (1985) Nature 313:810; Rosenberg et al. (1987) Gene, 56:125; Guerineau et al. (1991) Mol. Gen. Genet, 262:141; Proudfoot (1991) Cell, 64:671; Sanfacon et al. Genes Dev., 5:141; Mogen et al. (1990) Plant Cell, 2:1261; Munroe et al. (1990) Gene, 91:151; Ballad et al. (1989) Nucleic Acids Res. 17:7891; Joshi et al. (1987) Nucleic Acid Res., 15:9627.

[0050] Recombinant vectors containing the IbNF-YA1 protein gene expression cassette can be constructed using existing expression vectors. These plant expression vectors include binary Agrobacterium vectors and vectors suitable for plant microbombardment, such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa, PSN1301, or pCAMBIA1391-Xb (CAMBIA). The plant expression vectors may also contain the 3' untranslated region of the exogenous gene, i.e., containing a polyadenylate signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylate signal can guide the addition of polyadenylate to the 3' end of the mRNA precursor, such as Agrobacterium crown gall tumor inducing (Ti) plasmid genes (e.g., carmine synthase genes). No.The untranslated regions transcribed at the 3' end of plant genes (such as soybean storage protein genes) have similar functions. When constructing plant expression vectors using the genes of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, but they must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes. To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes encoding enzymes or luminescent compounds that can be expressed in plants (e.g., those encoding enzymes that produce color changes). GUS Genes, luciferase genes, etc.), antibiotic marker genes (such as those conferring resistance to kanamycin and related antibiotics). nptII Genes that confer resistance to the herbicide phosphinic acid there is Genes that confer resistance to the antibiotic hygromycin hp Genes, and the genes that confer resistance to methotrexate dhfr Genes such as EPSPS genes (which confer resistance to glyphosate) or chemical reagent resistance marker genes (such as herbicide resistance genes), and mannose-6-phosphate isomerase genes that provide the ability to metabolize mannose, can be used. From a safety perspective, transgenic plants can be directly selected by stress screening without adding any selective marker genes.

[0051] In the above applications, the vector can be a plasmid, granule, bacteriophage, or viral vector. Specifically, the plasmid can be the pCAMBIAsuper1300-GFP vector.

[0052] B3) The recombinant vector may specifically be pCAMBIA super1300-IbNF-YA1-GFP. pCAMBIA super1300-IbNF-YA1-GFP is a recombinant vector obtained by replacing a small fragment between the restriction endonuclease Xba I and Pst I recognition sequences of the recombinant vector pCAMBIA super1300-GFP with the DNA molecule shown in positions 1 to 795 from the 5′ end of SEQ ID NO. 2. This recombinant vector can express the IbNF-YA1 protein shown in SEQ ID NO. 1.

[0053] In the above applications, the microorganisms may be yeast, bacteria, algae, or fungi. Among them, bacteria may be Agrobacterium.

[0054] In the above applications, the transgenic plant cell lines, transgenic plant tissues, and transgenic plant organs do not include propagation material.

[0055] In the above applications, regulating the content or activity of IbNF-YA1 protein can be done by reducing the content or activity of IbNF-YA1 protein; regulating the development of plant storage roots can be done by promoting or inhibiting the development of plant storage roots; regulating the yield of plant storage roots can be done by increasing the yield of plant storage roots; regulating the IAA content of plant storage roots can be done by reducing the IAA content of plant storage roots; regulating the JA content of plant storage roots can be done by increasing the JA content of plant storage roots; regulating the dry matter content of plant storage roots can be done by reducing the dry matter content of plant storage roots; regulating the length of plant roots can be done by increasing the length of plant roots; and regulating the size of plant leaves can be done by increasing the size of plant leaves.

[0056] The regulation of IbNF-YA1 protein content or activity can be achieved by increasing the content or activity of IbNF-YA1 protein; the regulation of plant storage root development can be achieved by inhibiting or promoting plant storage root development; the regulation of plant storage root yield can be achieved by reducing plant storage root yield; the regulation of plant storage root IAA content can be achieved by increasing plant storage root IAA content; the regulation of plant storage root JA content can be achieved by decreasing plant storage root JA content; the regulation of plant storage root dry matter content can be achieved by increasing plant storage root dry matter content; the regulation of plant root length can be achieved by decreasing plant root length; and the regulation of plant leaf size can be achieved by decreasing plant leaf size.

[0057] Any of the following applications of IbNF-YA1 protein or substances that regulate the content or activity of IbNF-YA1 protein:

[0058] E1) Cultivate plants with enhanced or weakened storage root development;

[0059] E2) Cultivating plants that increase or decrease the yield of storage roots;

[0060] E3) Cultivate plants with reduced or increased IAA content in their storage roots;

[0061] E4) Cultivate plants with increased or decreased JA content in storage roots;

[0062] E5) Cultivate plants with reduced or increased storage root dry matter content;

[0063] E6) Cultivate plants with increased or decreased root length;

[0064] E7) Cultivate plants with increased or decreased leaf size.

[0065] In the above applications, the plant can be any one of the following M1)-M7):

[0066] M1) Dicotyledons or monocotyledons;

[0067] M2) Convolvulaceae, Brassicaceae, Apiaceae, or Chenopodiaceae plants;

[0068] M3) Sweet potato plants;

[0069] M4) Sweet potato.

[0070] The present invention also provides the following method (X1) or (X2):

[0071] X1) A method for cultivating plants with reduced storage root yield, including: increasing the content or activity of IbNF-YA1 protein in the recipient plant, or increasing the expression level of the gene encoding IbNF-YA1 protein, to obtain a target plant with reduced storage root yield compared to the recipient plant;

[0072] X2) Methods for reducing the yield of plant storage roots include: increasing the content or activity of IbNF-YA1 protein in the recipient plant, or increasing the expression level of the gene encoding IbNF-YA1 protein, to obtain a target plant with reduced storage root yield compared to the recipient plant, thereby achieving a reduction in storage root yield.

[0073] In the above method, the encoding gene can be the nucleic acid molecule described in B1).

[0074] In the above method, the plant can be any one of the following M1)-M7):

[0075] M1) Dicotyledons or monocotyledons;

[0076] M2) Convolvulaceae, Brassicaceae, Apiaceae, or Chenopodiaceae plants;

[0077] M3) Sweet potato plants;

[0078] M4) Sweet potato.

[0079] The target plant is understood to include not only first-generation plants containing the IbNF-YA1 protein or its encoding gene that have been altered, but also their progeny. For the target plant, the gene can be propagated within the species, or it can be transferred into other varieties of the same species, particularly commercial varieties, using conventional breeding techniques. The target plant includes seeds, callus tissue, intact plants, and cells.

[0080] The IbNF-YA1 protein is also within the scope of protection of this invention.

[0081] The substances that regulate the content or activity of IbNF-YA1 protein are also within the scope of protection of this invention.

[0082] The IbNF-YA1 protein and its encoding gene derived from sweet potato of this invention can regulate the development of storage roots in plants: compared with wild-type plants, lines overexpressing the IbNF-YA1 gene have reduced storage root weight. Therefore, the IbNF-YA1 protein and its encoding gene of this invention play an important role in regulating the yield of plant storage roots, and can regulate the yield of plant storage roots through the IbNF-YA1 protein and its encoding gene, which has broad application prospects and market potential in the agricultural field.

[0083] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way. Attached Figure Description

[0084] Figure 1 The results show the identification of transgenic sweet potato plants using the pCAMBIA super1300-IbNF-YA1 vector. In this diagram, M represents the DNA marker, WT represents the wild-type sweet potato plant Chestnut Fragrance, P represents the positive control (pCAMBIA super1300-IbNF-YA1-GFP), W represents the negative control water, and OE1-OE31 represent the overexpression positive transgenic plants obtained from pCAMBIA super1300-IbNF-YA1-GFP.

[0085] Figure 2 for IbNF-YA1 Gene expression level detection. WT is a wild-type sweet potato with chestnut flavor.

[0086] Figure 3 The results show the phenotypic identification of in vitro transgenic sweet potato plants. The AD diagrams show the identification results for root length, root number, leaf length, and leaf width, respectively.

[0087] Figure 4 The results show the phenotype of transgenic sweet potato plants in pots. A represents the plant appearance; B represents the weight of stored roots from a single plant.

[0088] Figure 5 The field phenotypes of transgenic sweet potato plants are shown. AF represents the root growth status of sweet potato at 20 d, 40 d, 60 d, 80 d, 100 d, and 120 d, respectively, and G represents the storage root weight of a single plant.

[0089] Figure 6 The results show the determination of IAA and JA content in the tuberous roots of transgenic and wild-type plants. In this table, A represents the IAA content determination result, and B represents the JA content determination result.

[0090] Figure 7The results show the dry matter content in the tubers of transgenic and wild-type plants. Detailed Implementation

[0091] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials, reagents, instruments, etc., used in the following embodiments are commercially available. All quantitative experiments in the following embodiments were performed in at least three replicates, and the results were averaged.

[0092] The sweet potato strain 'XT1' is described in the following literature: Jia Licong. Characteristic identification and genetic composition analysis of intercellular hybrids of sweet potato and its closely related wild species, Doctoral dissertation, China Agricultural University, 2016. With the applicant's consent, the public may obtain it from the Sweet Potato Genetics and Breeding Research Laboratory of China Agricultural University for the purpose of replicating this experiment, but it may not be used for other purposes.

[0093] The vector pCAMBIAsuper1300-GFP is a product of Wuhan Miaoling Biotechnology Co., Ltd., with product catalog number L3080.

[0094] Example 1 IbNF-YA1 Acquisition of genes

[0095] 1. Obtaining cDNA template

[0096] Total RNA was extracted from test-tube seedlings of sweet potato variety 'XT1' using a plant total RNA extraction kit and then reverse transcribed into cDNA.

[0097] 2. Using the cDNA obtained in step 1 as a template, and employing primers... IbNF-YA1 -F and IbNF-YA1 PCR amplification was performed using primer -R, yielding a PCR amplification product of approximately 795 bp, which was then sequenced. The primer sequences are as follows:

[0098] IbNF-YA1 -F:5′-ATGCAATCGAAGTCTGGAACT -3′;

[0099] IbNF-YA1 -R: 5′- TTAGTTGCAACTAACACTCCCC-3′.

[0100] The results showed that the nucleotide sequence of the PCR amplification product was as shown in SEQ ID NO.2 from position 1 to 795 from the 5′ end. The gene represented by this sequence was named... IbNF-YA1 The gene encodes a protein named IbNF-YA1 protein or protein IbNF-YA1, with the amino acid sequence shown in SEQ ID NO.1.

[0101] SEQ ID No.1 (IbNF-YA1 protein, Ipomoea batatas):

[0102] MQSKSGTVNRVEARSYNLPGSAVYADPWWTAAGCNPINPRSKRASVSDSSSLEQSVDDQSQSDGDDDTAKKSQNSAPSDQDGNYGQVDQSLQHAKSTISARTDESLIQPPQLELVGHSIACAPNLYTDPYFMGMMASYGQPLVPPQFLDLQQARMPLPLEMTQEPVYVNAKQYHGILRRRESRAKAESQKKLIKARKPYLHESRHQHALRRARSTGGRFAKKSETAASKETGSGAAADPQLPSINGGSSYVGGSSGGRGSVSCN。

[0103] SEQ ID No.2 ( IbNF-YA1 gene, Ipomoea batatas):

[0104] ATGCAATCGAAGTCTGGAACTGTAAATCGGGTAGAAGCTCGTTCATACAATCTTCCAGGTTCAGCAGTATATGCTGATCCCTGGTGGACTGCTGCTGGCTGTAATCCAATTAACCCTCGCTCGAAGCGGGCAAGTGTATCTGATTCATCTTCACTGGAGCAATCTGTTGATGATCAATCACAGTCGGATGGTGATGATGATACTGCTAAAAAGTCACAAAATTCTGCACCTTCAGATCAAGATGGAAATTATGGACAAGTGGATCAGAGTCTTCAGCACGCCAAATCAACAATATCTGCAAGAACTGATGAGAGCCTTATACAGCCGCCACAGCTTGAACTTGTTGGGCATTCAATTGCTTGCGCTCCAAATCTGTACACAGACCCATATTTTATGGGGATGATGGCCTCTTATGGCCAGCCATTGGTTCCTCCTCAGTTTCTTGATCTGCAACAAGCTAGGATGCCTTTGCCACTTGAAATGACTCAAGAGCCCGTTTACGTGAATGCCAAGCAGTATCATGGGATCCTCCGGAGGAGAGAGTCACGTGCTAAAGCAGAATCTCAAAAGAAGCTAATAAAAGCAAGAAAGCCGTATCTTCACGAGTCTCGACATCAGCATGCTTTGAGGAGGGCTAGGAGTACTGGAGGGCGTTTCGCAAAGAAATCCGAGACAGCTGCTTCAAAAGAAACAGGCTCGGGTGCAGCTGCCGATCCCCAACTTCCATCGATAAATGGAGGCAGCAGTTACGTTGGAGGTTCATCAGGTGGACGGGGGAGTGTTAGTTGCAACTAA。

[0105] Example 2. Application of IbNF-YA1 protein in increasing the yield of storage roots of plants.

[0106] I. Construction of recombinant vector pCAMBIA super1300 - IbNF-YA1-GFP

[0107] 1. A double-stranded DNA molecule as shown in SEQ ID NO.2, from position 1 to 795 starting from the 5' end, was artificially synthesized. Using this double-stranded DNA molecule as a template, OE-F-Xba I:5'-GC was used. TCTAGA ATGCAATCGAAGTCTGGAACT-3' (underlined is the recognition sequence of restriction endonuclease Xba I) and OE-R-Pst I: 5'-AA CTGCAG PCR amplification was performed using primers TTAGTTGCAACTAACACTCCCC -3' (the underlined sequence is the recognition sequence of restriction endonuclease Pst I) to obtain a double-stranded DNA molecule containing restriction endonuclease XbaI at the 5' end and restriction endonuclease Pst I at the 3' end.

[0108] 2. The vector pCAMBIAsuper1300-GFP was digested with restriction endonucleases Xba I and Pst I to recover the vector backbone of approximately 10783 bp.

[0109] 3. The PCR product obtained in step 1 was digested with restriction endonucleases Xba I and Pst I, and fragment 2 containing approximately 807 bp was recovered.

[0110] 4. Link fragment 2 with vector backbone 1 to obtain the recombinant vector pCAMBIA super1300-IbNF-YA1-GFP.

[0111] Based on the sequencing results, the structure of the recombinant vector pCAMBIA super1300-IbNF-YA1-GFP is described as follows: The small fragment between the restriction endonuclease Xba I and Pst I recognition sequences of the recombinant vector pCAMBIA super1300-GFP is replaced with the DNA molecule shown in positions 1 to 795 from the 5′ end of SEQ ID NO.2. This recombinant vector can express the IbNF-YA1 protein shown in SEQ ID NO.1.

[0112] II. Obtaining Transgenic Sweet Potato Plants

[0113] 1. Induction of embryogenic callus and establishment of embryogenic cell suspension system in sweet potato variety Chestnut Fragrance

[0114] The harvested sweet potato tubers were used to provide sweet potato shoot tips. The shoot tip meristems were peeled and inoculated onto MS solid medium containing 2.0 mg / L 2,4-D. The medium was cultured in the dark at room temperature (27±1℃) to induce callus. Then, the callus was propagated and subcultured to establish an embryogenic cell suspension line for transformation.

[0115] 2. Culture of Agrobacterium

[0116] After introducing pCAMBIA super1300-IbNF-YA1-GFP into Agrobacterium, the Agrobacterium culture was activated on an antibiotic-resistant plate. A single colony was picked and inoculated into 5 mL of LB broth containing the corresponding antibiotic. The culture was then incubated at 28°C with shaking at 200 rpm until OD500 was reached. 600 The value is in the range of 0.4 to 0.6.

[0117] 3. Preparation of suspension cell lines and infection with Agrobacterium tumefaciens.

[0118] Select the suspension cell lines obtained in step 1 that have grown for 8-12 weeks and are in good condition, grind them, and after subculture for 3 days, take the embryogenic suspension cell clusters with a diameter of about 0.7-1.4 mm and use the Agrobacterium tumefaciens solution obtained in step 2 for infection and transformation.

[0119] 4. Co-culture and delayed culture

[0120] The Agrobacterium suspension cell line obtained in step 3 was transferred to MS solid medium containing 30 mg / L acetosyringone (AS) and 2 mg / L 2,4-D for co-culture in the dark at 27±1℃. After 3 days of co-culture, the cell clusters were washed once with MS liquid medium containing 200 mg / L cephalosporin (CS) and 2 mg / L 2,4-D, then immersed in MS liquid medium containing 100 mg / L CS and 2 mg / L 2,4-D for 30 min, and finally cultured for 1 week with MS liquid medium containing 2 mg / L 2,4-D. The culture conditions were 27±1℃, 500 Lux light (13 h light per day), and shaking at 100 rpm.

[0121] 5. Screening and culture of resistant cell clusters

[0122] After delayed culture, the cell clusters were transferred to MS solid medium containing 5.0 mg / L hygromycin (Hyg), 100 mg / L CS, and 2 mg / L 2,4-D for dark culture at 27±1℃, with the medium replaced every 2 weeks. After 4 weeks, the resistant cell clusters were transferred to MS solid medium containing 10.0 mg / L Hyg, 100 mg / L CS, and 2 mg / L 2,4-D, and cultured for 4–8 weeks, with the medium replaced every 2 weeks.

[0123] 6. Induction of somatic embryos

[0124] The resistant cell clusters in good growth condition were transferred to MS medium containing 1.0 mg / L ABA and 100 mg / L CS to induce somatic embryo growth. The culture conditions were 27±1℃ and 3000 Lux light (13 h light per day).

[0125] 7. Regeneration and identification of transgenic plants

[0126] Mature somatic embryos that turned green on ABA-containing medium after 2–4 weeks of induction were transferred together with callus tissue to MS solid medium and cultured until complete plants were formed at a temperature of 27±1℃, with 13 h of light per day and a light intensity of 3000 Lux, to obtain transgenic sweet potato plants with the pCAMBIA super1300-IbNF-YA1-GFP vector.

[0127] 8. Identification of transgenic plants:

[0128] A method combining PCR detection and qRT-PCR detection was used.

[0129] 1) The PCR detection method is as follows:

[0130] DNA was extracted from wild-type sweet potato and the proposed transgenic sweet potato plants for PCR identification. The pCAMBIAsuper1300-IbNF-YA1-GFP vector was used as a positive control, and water and wild-type sweet potato were used as negative controls. The pCAMBIAsuper1300-F and pCAMBIA super1300-R vectors were used to detect the pCAMBIA super1300-IbNF-YA1-GFP transgenic sweet potato plants. The PCR product of positive plants contained a specific fragment of 795 bp. Primers are as follows:

[0131] pCAMBIA super1300-F: 5'- GACGCACAATCCCACTATCC -3';

[0132] pCAMBIA super1300-R: 5'-TTAGTTGCAACTAACACTCCCC-3'.

[0133] The amplified PCR products were separated by electrophoresis on a 1% (w / v) agarose gel, and the strain number of the PCR-positive plants was recorded.

[0134] The results are as follows Figure 1As shown, no bands were observed in the wild-type chestnut sweet potato and the negative control water. In the transgenic sweet potato plants obtained by pCAMBIAsuper1300-IbNF-YA1-GFP, OE-1 to OE-31 and the positive control both showed specific electrophoretic bands around 795 bp, indicating that OE-1 to OE-31 were all positive transgenic plants. In the transgenic sweet potato plants obtained by pCAMBIA1300-35SI-X-IbNF-YA1, Ri-1 to Ri-12 and the positive control both showed specific electrophoretic bands around 790 bp, indicating that Ri-1 to Ri-12 were all positive transgenic plants.

[0135] 2) qRT-PCR

[0136] RNA was extracted from each positive sweet potato plant detected in step 1), and cDNA was obtained by reverse transcription. qRT-PCR was then performed, with the wild-type sweet potato plant Chestnut Fragrance as a control.

[0137] Ibactin The gene is used as an internal control, and the primers are as follows:

[0138] IbActin -F: 5′-AGCAGCATGAAGATTAAGGTTGTAGCAC-3′;

[0139] IbActin -R: 5′-TGGAAAATTAGAAGCACTTCCTGTGAAC-3′.

[0140] Detection IbNF-YA1 The gene primer sequences are as follows:

[0141] IbNF-YA1 -qRT-F: 5′-ATCAGAGTCTTCAGCACGCC -3′;

[0142] IbNF-YA1 -qRT-R: 5′-CAGATTTGGAGCGCAAGCAA-3′.

[0143] The results are as follows Figure 2 As shown, in OE-1 to OE-31 IbNF-YA1 Gene expression levels were significantly higher in the human body than in the wild type. IbNF- YA1 Significantly differentially expressed in transgenic sweet potato plants. Two overexpressing genes with upregulated expression levels were selected. IbNF-YA1 Transgenic sweet potato lines OE-29 and OE-31 were propagated and overexpressed. IbNF-YA1 Subsequent trials were conducted on the T1 generation transgenic sweet potato lines OE-29 and OE-31.

[0144] III. Phenotypic Identification of Transgenic Sweet Potato Plants

[0145] Test plant: Wild-type Chestnut Fragrance (WT), overexpression IbNF-YA1 T1 generation transgenic sweet potato lines OE-29 and OE-31.

[0146] 1. In vitro phenotypic identification of transgenic sweet potato plants

[0147] Specific steps: The plants to be tested were planted on MS solid medium and cultured at a temperature of 27±1℃, with 13 hours of light per day and a light intensity of 3000 Lux. After 4 weeks, the root length, number of roots, leaf width and leaf length of each line were counted to preliminarily identify their development. Each line was set up with 3 replicates and the results were averaged.

[0148] The results are as follows Figure 3 As shown, after culturing on MS solid medium for 4 weeks, there were significant differences in root length and leaf width between OE-29, OE-31 plants and wild-type Chestnut Fragrance, and the growth of overexpressed plants was significantly weaker than that of wild-type plants.

[0149] Preliminary explanation of in vitro identification results IbNF-YA1 Overexpression of the gene weakens the growth of sweet potato plants.

[0150] 2. Phenotypic identification of transgenic sweet potato plants in pots

[0151] After acclimatization, the test-tube seedlings were transplanted to an isolated field. After two months of growth, 20 cm stem segments were cut and planted in 35 x 35 cm round pots. Samples were taken and photographed at 15, 30, 60, 80, 120, and 150 days to observe their growth status, and the weight of stored roots of individual plants was measured. Three replicates were set up for each line.

[0152] The results are as follows Figure 4 As shown, the tuber weight of the overexpression line was significantly higher than that of the WT line in the early stage (before 60 days) and significantly lower than that of the WT line in the later stage (after 80 days).

[0153] The experimental results show that IbNF-YA1 Genes can significantly regulate the development of sweet potato storage roots.

[0154] 3. Field phenotypic identification of transgenic sweet potato plants

[0155] Stem segments of the plants to be tested were planted in the field, and five consecutive samples were taken at 20, 40, 60, 80, 100 and 120 days to observe their growth status and measure the weight of the stored roots of each plant.

[0156] The results are as follows Figure 5As shown, the tuber weight of the overexpression lines was significantly higher than that of the WT lines in the early stage (40 days), but significantly lower in the later stage (after 60 days). At 120 days of sweet potato harvest, the tuber weight of the overexpression lines was 29.15%–40.22% lower than that of the WT lines.

[0157] The experimental results show that IbNF-YA1 Genes can significantly regulate the development of sweet potato storage roots.

[0158] 4. Determination of physiological and biochemical indicators

[0159] (1) Determination of IAA and JA content

[0160] Auxin (IAA) plays a crucial role in the root system. It influences primary root growth and development, gravitropism, root cap, lateral root and root hair formation, and the maintenance of stem cell characteristics in the root apical meristem through polar transport, concentration gradient distribution, and signal transduction. Studies have shown that the concentration of IAA in early-stage enlarged sweet potato storage roots gradually increases; however, its content gradually decreases after secondary growth begins. Therefore, IAA is significantly related to the secondary growth of sweet potato storage roots.

[0161] In addition to participating in plant resistance responses to mechanical damage and pests, jasmonic acid (JA) also regulates processes such as embryo differentiation, seed germination, senescence, and root development. Sweet potato storage roots have a high JA content, and exogenous JA can increase the probability and diameter of sweet potato storage roots.

[0162] The methods for determining IAA and JA content are based on the following reference: Xue Luyao. Sweet Potato IbbHLH118 , IbNF-YA1 and IbNF- YA10 Research on gene function and molecular regulatory mechanisms, Doctoral Dissertation, China Agricultural University, 2023.

[0163] The IAA and JA contents were determined by taking the stored roots of OE-29, OE-31 and wild-type chestnut fragrant plants harvested from the field 120 days after step 3.

[0164] The results are as follows Figure 6 As shown, IbNF-YA1 The IAA content in the tubers of overexpressing sweet potato plants was significantly higher than that in WT (increased by 21.45%–33.6%), while the JA content was significantly lower than that in WT (decreased by 46.97%–57.6%).

[0165] The above results indicate that IbNF-YA1 Genes can regulate the development of sweet potato storage roots through IAA and JA.

[0166] (2) Determination of dry matter content

[0167] Chop the field-harvested potato tubers from step 3 after 120 days, weigh 100 g and put them into paper bags (3 replicates), and dry the samples to constant weight (80℃ oven). The dry matter content is calculated by dividing the dried weight (g) by 100 (g) and multiplying by 100%.

[0168] The determination method is based on the reference: Xue Luyao. Sweet potato. IbbHLH118 , IbNF-YA1 and IbNF-YA10 Research on gene function and molecular regulatory mechanisms, Doctoral Dissertation, China Agricultural University, 2023.

[0169] Dry matter content was determined by taking stored roots from OE-29, OE-31 and wild-type Chestnut Fragrant plants harvested from the field at 120 days.

[0170] The results are as follows Figure 7 As shown, IbNF-YA1 The dry matter content of overexpressing plants was significantly higher than that of WT (increased by 33.08%–35.2%).

[0171] The above results indicate that IbNF-YA1 The dry matter content of the storage roots of genetically modified sweet potatoes changed.

[0172] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. Any of the following applications that increase the content of storage root development-related proteins: D1) Promotes the development of sweet potato storage roots; D2) Prepare products that promote the development of sweet potato storage roots; D3) Increase the yield of sweet potato storage roots; D4) Prepare products that increase the yield of sweet potato storage roots; D5) Increases the IAA content in sweet potato storage roots; D6) Prepare products that increase the IAA content in sweet potato storage roots; D7) Increases the dry matter content of sweet potato root storage; D8) Prepare products that increase the dry matter content of sweet potato root for storage; D9) Reduce the size of sweet potato leaves; D10) is used to prepare products that reduce the size of sweet potato leaves; The storage root development-related protein is a protein with the amino acid sequence shown in SEQ ID NO.

1.

2. The method described below, either X1) or X2): X1) Methods for increasing sweet potato yield by cultivating storage roots include: Increase the content of the storage root development-related protein as described in claim 1 in the recipient sweet potato, or increase the expression level of the gene encoding the storage root development-related protein as described in claim 1, to obtain a target sweet potato with increased storage root yield compared to the recipient sweet potato; X2) A method for increasing the yield of sweet potato storage roots includes: increasing the content of the storage root development-related protein as described in claim 1 in the recipient sweet potato, or increasing the expression level of the gene encoding the storage root development-related protein as described in claim 1, to obtain a target sweet potato with increased storage root yield compared with the recipient sweet potato, thereby achieving an increase in storage root yield.

Images