SNP (Single Nucleotide Polymorphism) molecular marker related to sperm tail rolling after chicken sperm cryopreservation resuscitation, primer and application

Abstract

The invention relates to the technical field of genetic breeding, and particularly discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to sperm tail rolling after chicken sperm cryopreservation resuscitation, a primer and application, the nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO.1, the 262nd site in the SNP molecular marker is an SNP site, and the site has C / T polymorphism. An SNP site exists at the 262nd site of the SNP molecular marker provided by the invention, C / T polymorphism exists at the site, and the sperm tail rolling frequency after cryopreservation resuscitation of CC genotype individual sperm is lower than that after cryopreservation resuscitation of CT genotype individual sperm.

Description

Technical Field

[0001] The invention relates to the technical field of genetic breeding, and in particular to a SNP molecular marker, a primer and an application thereof related to sperm tail curling after frozen and thawed chicken semen. Background Art

[0002] Chicken semen is a carrier of genetic material for male chickens. Through artificial insemination or natural mating, sperm enters the reproductive system of the hen and fertilizes the hen's eggs. In this process, the rooster's excellent genes, such as fast growth rate, good meat quality, high egg production performance, strong disease resistance and many other excellent traits, will be passed on to the next generation with sperm. Accurate genetic selection is achieved by using chicken semen. Therefore, the quality and morphology of semen and other related traits directly affect the genetic selection of chickens. In the process of breed improvement, the role of chicken semen cannot be ignored. By hybridizing rooster semen with excellent traits with hens, the advantages of both can be combined to cultivate a more competitive new breed, among which the quality of semen affects the reproduction rate of hybridization.

[0003] Chicken semen cryopreservation is a common method in breeding practice and germplasm resource preservation. In the work of germplasm resource protection, chicken eggs are difficult to preserve for a long time, and the breakthrough in chicken semen cryopreservation technology provides an important guarantee for the long-term safety protection of chicken germplasm resources. For some rare and endangered chicken breeds, timely collection and cryopreservation of their semen can avoid the loss of excellent genes caused by the extinction of the breed, and lay the foundation for subsequent breed recovery and genetic improvement. In the artificial insemination technology of chickens, the dilution and preservation of semen are important links. By freezing and preserving chicken semen, the use time and scope of semen can be increased, the number of breeding roosters can be reduced, the breeding cost can be reduced, the utilization rate of breeding roosters can be increased, and the resource sharing of excellent breeding roosters can be facilitated. Cryopreserved chicken semen can be taken out and used at any time when needed, without being restricted by time and space, which provides greater flexibility and choice space for poultry breeding. Breeders can choose appropriate frozen semen for artificial insemination according to breeding goals and plans, accelerate the breeding process of excellent breeds, and improve the production performance and quality of poultry.

[0004] In the practice of artificial insemination of chickens, the quality of semen after cryopreservation and thawing is directly related to reproductive efficiency. Using sperm with good morphology for artificial insemination can reduce the amount of semen required for each insemination. Because these sperm have strong vitality and fertilization ability, they can achieve a higher fertilization rate at a lower sperm concentration. This is very important for the efficient use of semen from excellent breeders, especially for those rare breeds or chickens with high economic value, which can expand the breeding scale while reducing the cost of semen collection and processing. However, the morphological characteristics of sperm after frozen semen thawing directly affect its subsequent reproductive rate, so it is very important to genetically select the relevant characteristics of chicken semen after frozen semen thawing. Sperm tail curling refers to the curling of the tail of the sperm. The degree of curling can vary, from a slight bend to a severe spiral curling. This morphological change can have a significant effect on the motility of the sperm. Sperm tail curling can seriously hinder the movement of sperm. Normal linear movement is essential for sperm to reach the fertilization site in the hen's oviduct. Due to the change in the tail structure, the way and efficiency of the flagella of the sperm with a curly tail will be affected, and it will not be able to generate effective forward propulsion like normal sperm. This will cause the sperm to slow down or even be unable to swim in the hen's reproductive tract, greatly reducing the chance of the sperm meeting and fertilizing the egg. Even if the curly-tailed sperm can barely swim to the vicinity of the egg, its fertilization ability will be greatly reduced due to its abnormal morphology. The tail of the sperm not only provides the power for movement, but also plays a certain auxiliary role in the recognition of sperm and egg and penetration of the surrounding structures of the egg. The curly-tailed sperm may not be able to correctly recognize the signal molecules on the surface of the egg, or it may be difficult to penetrate the barriers around the egg such as the yolk membrane due to the failure of the tail to function normally, ultimately leading to fertilization failure. Therefore, it is of great significance to develop a molecular marker for chicken sperm morphology-related traits. Summary of the invention

[0005] In order to develop a molecular marker for chicken sperm morphology-related traits, the present invention provides a SNP molecular marker, primer and application related to sperm tail curling after frozen and thawed chicken semen. The SNP molecular marker provided by the present invention has a SNP site at position 262, recorded as g.52122232C / T site, and there is a C / T polymorphism in the site. The frequency of sperm tail curling after frozen and thawed semen of CC genotype individuals is lower than that of sperm tail curling after frozen and thawed semen of CT genotype individuals, indicating that the sperm motility of CC genotype individuals after frozen and thawed semen is significantly higher than that of CT genotype individuals, which is of great significance to the sub-breeding of Xiaoshan chicken.

[0006] The present invention provides a SNP molecular marker related to sperm tail curling after frozen and thawed chicken semen. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1. The 262nd position in the SNP molecular marker is a SNP site, and the site has a C / T polymorphism.

[0007] The SNP molecular marker related to sperm tail curling after cryopreservation and thawing of chicken semen provided by the present invention has C / T polymorphism at position 262, and the frequency of sperm tail curling of CC genotype individuals after cryopreservation and thawing of semen is lower than that of CT genotype individuals after cryopreservation and thawing of semen, and can be used for breeding individuals with high sperm motility after cryopreservation and thawing. The molecular marker is closely related to the freezing resistance of chicken sperm, and the sperm motility of CC genotype individuals after cryopreservation and thawing of semen is significantly higher than that of CT genotype individuals, which is of great significance to the successive breeding of Xiaoshan chicken.

[0008] The present invention also provides a pair of primers, including a forward primer shown in SEQ ID NO.2 and a reverse primer shown in SEQ ID NO.3, wherein the primers are used to amplify SNP molecular markers related to sperm tail curling after the chicken semen is frozen and thawed.

[0009] The invention also provides a kit containing the primer.

[0010] Furthermore, the kit also includes PCR Mix reagent and double distilled water.

[0011] The present invention also provides an early breeding selection method for sperm after freezing and thawing of chicken semen, and early breeding is performed based on the genotype of SNP molecular markers related to sperm tail curling after freezing and thawing of chicken semen, and genotype individuals with a genotype of CC at the chicken g.52122232C / T site are selected as succession breeding individuals.

[0012] Furthermore, the chicken breed is Xiaoshan chicken.

[0013] The present invention also provides an application of the SNP molecular marker related to sperm tail curling after frozen and thawed chicken semen or the primer in the heritage breeding of Xiaoshan chicken.

[0014] Furthermore, genomic DNA from in vitro venous blood of Xiaoshan chicken was extracted as a template, PCR amplification was performed using the forward primer shown in SEQ ID NO.2 and the reverse primer shown in SEQ ID NO.3, the amplified products were sequenced and analyzed, and individuals with the CC genotype at the g.52122232C / T site were selected as breeding individuals. Continuous subculture and selection were used to reduce the frequency of sperm tail curling after cryopreservation and thawing of Xiaoshan chicken semen, thereby improving the semen performance of Xiaoshan chicken.

[0015] Furthermore, Xiaoshan chickens were selected at 145 to 155 days of age.

[0016] Furthermore, the PCR amplification program is: pre-denaturation at 97.5°C~98.5°C for 2min~2.5min; denaturation at 97.5°C~98.5°C for 10s~12s; annealing at 59.5°C~60.5°C for 30s~31s; extension at 72°C~72.5°C for 1min~1.5min; 33 cycles; then extension at 72°C~72.5°C for 5min~5.5min; storage at 4°C~6°C.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] The SNP molecular marker provided by the present invention has a SNP site at position 262, which is recorded as the g.52122232C / T site. There is a C / T polymorphism in the site. The frequency of sperm tail curling in individuals with CC genotype after cryopreservation and resuscitation of semen is lower than that in individuals with CT genotype after cryopreservation and resuscitation of semen. Through analysis, it was found that in the purebred Xiaoshan chicken population, the sperm tail curling of individuals with CC genotype at the g.52122232C / T site was reduced by an average of 1.25% compared with CT-type individuals after cryopreservation and resuscitation of semen. In Xiaoshan chickens, the CC type at the g.52122232C / T site can gradually reduce the sperm tail curling of Xiaoshan chickens after cryopreservation and resuscitation of semen, thereby achieving the purpose of improving the semen performance of Xiaoshan chickens. The sperm motility of individuals with CC genotype in Xiaoshan chickens after cryopreservation and resuscitation of semen is significantly higher than that of individuals with CT genotype, which is of great significance to the successive breeding of Xiaoshan chickens. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0020] Figure 1 The distribution of significance thresholds of the genome-wide association analysis of sperm tail trait after cryopreservation and thawing of Xiaoshan chicken semen. The blue points are above the chromosome significance level threshold, and the red points are above the genome-wide significance level threshold.

[0021] Figure 2 This is the electrophoresis diagram of the amplified products of the Xiaoshan chicken population.

[0022] Figure 3 This is the peak diagram of DNA sequencing results for different genotypes at the g.52122232C / T site. DETAILED DESCRIPTION

[0023] The specific embodiments of the present invention are described in detail below, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the scope of protection of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified, and the materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0024] Example 1: Development of a SNP molecular marker associated with sperm tail curling after sperm cryopreservation and thawing.

[0025] 1. Source of experimental animals and blood collection

[0026] The experiment selected 102 180-day-old Xiaoshan chickens as the research subjects. Xiaoshan chickens come from the Xiaoshan Chicken Breed Resource Farm in Zhejiang Province. The roosters were raised in three-tiered cages with air conditioning, independent ventilation, nipple drinking water, and feeding on time from 8:00 to 9:00 every morning. At about 150 days of age, 5 mL of blood was collected from the wing vein of the experimental rooster using an EDTA anticoagulant tube for DNA extraction.

[0027] 2. Extraction of Xiaoshan chicken genomic DNA

[0028] Extract DNA using high salt method:

[0029] (1) Digestion: 30 μL of anticoagulated blood was added to a 2 mL centrifuge tube, and 600 μL of lysis buffer was added and mixed. The lysis buffer was a mixture of 50 mM Tris-Cl and 10 mM EDTA, with a pH of 8.0. Then, 30 μL of 10 μg / μL proteinase K was added and mixed. The mixture was placed in a 56°C water bath for digestion for 12 hours.

[0030] (2) Salting out: Add 600 μL of 6M saturated sodium chloride and 600 μL of chloroform to the above mixed solution, shake well for 10 minutes, and centrifuge at 12,000 rpm for 5 minutes.

[0031] (3) Ice precipitation: Take the supernatant and place it in a new 2 mL centrifuge tube. Add 600 μL of 90% ethanol that has been pre-cooled on ice and mix well. Gently shake to allow the white precipitate to precipitate.

[0032] (4) Use a sterile pipette tip to pick up the white precipitate, add 600 μL of 70% ethanol to wash, pour off the ethanol, and dry naturally.

[0033] (5) After the ethanol has completely evaporated, add 500 μl of ddH20.

[0034] (6) Cover the tube and place it at 56°C for 2 hours. Then, store the DNA in a -4°C refrigerator.

[0035] 3. Semen collection and characterization

[0036] Semen was collected from roosters at 180 days of age. Semen was collected using abdominal massage, and semen was collected using sterile cryopreservation tubes. Then diluents and protective agents were added and stored in liquid nitrogen. After 7 days of cryopreservation, the semen was thawed and revived at 4°C. After resuscitation, sperm morphology indicators were measured using a sperm analyzer.

[0037] 4. Chicken whole genome SNP genotype detection

[0038] The above individual DNA was genotyped by the chicken genome "Jingxin No. 1" 55K chip on the Illumina sequencing platform according to the company's standard process. The chip genotype data was quality controlled using Plink (V1.90b) software, and the parameters --geno0.1 --maf 0.01 --mind 0.1 were used for quality control. 45262 SNPs were obtained. The single-trait mixed linear model (LMM) of GEMMA (V0.98.5) software (https: / / github.com / genetics-statistics / GEMMA / releases) was used to perform a genome-wide association analysis on the sperm tail trait after semen cryopreservation and thawing. In this model, SNP was used as a fixed factor and additive effect as a random effect. The significance thresholds at the genome-wide level and chromosome level were 1.10×10 -6 (0.05 / 45262) ​​and 2.21×10 -5 (1 / 45262).

[0039] Finally, 6 SNPs were obtained that were significantly correlated with sperm tail curling after sperm cryopreservation and thawing. Figure 1 The P value of the SNP site at position 52122232bp on chromosome 4 (chicken reference genome version GRCg6a) was 6.87×10 -10 Exceeding the genome-wide significance threshold, it is recorded as g.52122232C / T. The average sperm tail of the CT genotype individuals after cryopreservation and thawing of the SNP site is 1.4%, while the average sperm tail of the CC genotype individuals after cryopreservation and thawing of the semen is 0.14%.

[0040] Example 2: SNP site verification and application.

[0041] The above g.52122232C / T site was verified in the Xiaoshan chicken population.

[0042] 1. Extraction of Xiaoshan Chicken Genomic DNA

[0043] Blood samples from 96 purebred Xiaoshan chickens were collected to accurately measure the sperm tail morphology phenotype after sperm cryopreservation and thawing, collected using EDTA anticoagulant tubes and stored in a 4°C refrigerator for later use. Blood genomic DNA was extracted using the above method, diluted to 30 ng / μL after quality and concentration testing, and stored in a -20°C refrigerator until use.

[0044] 2. PCR amplification and sequencing of target fragments

[0045] Using the reference sequence of 52121932bp to 52122532bp of chromosome 4 of the chicken GRCg6a reference genome as a template, the following primers were designed using NCBI Primer-BLAST.

[0046] Forward primer (5'-3'): AGCTGGTGAGTGAGTGAACCT (SEQ ID NO. 2).

[0047] Reverse primer (5'-3'): AACATTGTGAGCTTTCTGACACAG (SEQ ID NO. 3).

[0048] Using the extracted DNA as a template, PCR amplification was performed according to the designed primers, using a 20uL PCR reaction system: 1μL DNA template, 0.8μL forward primer and reverse primer each, 10μL PCR Mix reagent, and 7.4μL double distilled water. The PCR Mix reagent is produced by Servicebio, the product name is 2×Fast Pfus PCR Master Mix, item number: G3305-05. The PCR amplification program is: pre-denaturation at 98℃ for 2min; denaturation at 98℃ for 10s; annealing at 60℃ for 30s; extension at 72℃ for 1min; 33 cycles; then extension at 72℃ for 5min; storage at 4℃. The PCR product was detected by electrophoresis in 1.2% agarose gel. The size of the amplified target fragment was 504bp. The sequence of the target fragment is shown in SEQ ID NO.1, and the electrophoresis diagram is shown in Figure 2 .

[0049] SEQ ID NO.1:

[0050] AGCTGGTGAGTGAGTGAACCTTTAGCCATTTGCTTTTCCCTTGTATTGTACAATAAGAGGTCATTTACTTTTTTTGTGGCAAAATTTTGAAACTTCTTCCCAAAATTTTTTATGTGAATCAAAATTTGAA TTACCTGGAAAAAGACTCATTTTATCTTTCACTCTTCTCCTTTACAGATACAATCTTGTCTCTAGAAGTTAGTTACAGAAATAAGTTAGCTTTGTAAATCATTATCTTAAGATGCAGAGGAACTAATCAAA C GTTTACCACTAGGTACTCAGACACTGCAAGATAGATTTTCTGCACAATTTGAATATTCTTTTCTCTTGTACAGAGTCTGATTTTACAGTCGAATTGTAGAGGAAGAACATGGAAGCCTTATGGATTTACTGATTAAACACCATCTATCTTTCAAACATATCTTTCATGGTATTTATGAGAATCATTCTACTGTTGTTATACTGTTTCACATACAACAGCTGTGTCAGAAAGCTCACAATGTT.

[0051] The double underline in SEQ ID NO.1 is the g.52122232C / T site, which has C / T polymorphism. The frequency of sperm tail curling in individuals with CC genotype after cryopreservation and thawing of semen is lower than that in individuals with CT genotype after cryopreservation and thawing of semen.

[0052] The remaining amplified products were sequenced, and the sequencing results were compared and analyzed with the relevant gene fragment sequences of chicken in GenBank using SnapGene software. The g.52122232C / T site was located at the 262nd position of the sequence, and there was a C / T polymorphism at this site. The genotype of the g.52122232C / T site was determined ( Figure 3 ), and then R (version 4.3.1) was used to analyze the effect of genotype on phenotype. The analysis model was Y = μ + P + G + e; where: Y is the sperm tail phenotype after Xiaoshan chicken semen was frozen and revived; G represents the genotype fixed effect of SNP; P is the random effect of the column; e is the residual. The significant P value was corrected by 10,000 random samplings.

[0053] Table 1 shows the effect of the g.52122232C / T mutation site on the sperm tail phenotype after semen cryopreservation and thawing in the purebred Xiaoshan chicken population. As shown in Table 1, in the purebred Xiaoshan chicken population, the sperm tail of the CC genotype individuals at the g.52122232C / T site was reduced by an average of 1.25% compared with the CT genotype individuals after semen cryopreservation and thawing. It can be seen that in Xiaoshan chickens, the CC type at the g.52122232C / T site can gradually reduce the sperm tail of Xiaoshan chickens after semen cryopreservation and thawing, thereby achieving the purpose of improving the semen performance of Xiaoshan chickens.

[0054] Table 1g. Analysis of the association between the 52122232C / T locus and sperm tail phenotype after cryopreservation and thawing of Xiaoshan chicken semen

[0055]

[0056] In summary, the SNP molecular markers provided by the present invention can be used to select sperm with high sperm activity after cryopreservation and thawing of Xiaoshan chicken semen, thereby improving breeding efficiency.

[0057] Although preferred embodiments of the present invention have been described, additional changes and modifications may occur to these embodiments once those skilled in the art are aware of the basic inventive concepts.

[0058] Obviously, those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A SNP molecular marker associated with sperm tail curling after cryopreservation and thawing of chicken semen, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.

1. The 262nd position in the SNP molecular marker is a SNP site, and there is a C / T polymorphism at this site.

2. A pair of primers, characterized in that: It comprises a forward primer shown in SEQ ID NO.2 and a reverse primer shown in SEQ ID NO.3, and the primers are used to amplify the SNP molecular marker related to sperm tail curling after the chicken semen is frozen and thawed as claimed in claim 1.

3. A kit comprising the primers according to claim 2.

4. The kit according to claim 3, characterized in that Also includes PCR Mix reagent and double distilled water.

5. A method for early breeding selection of sperm after cryopreservation and thawing of chicken semen, characterized in that: Early breeding is carried out based on the genotype of the SNP molecular marker related to sperm tail curling after the frozen and thawed chicken semen as described in claim 1, and the genotype individuals with the genotype of CC at the chicken g.52122232C / T locus are selected as the succession breeding individuals.

6. The method for early breeding selection of sperm after cryopreservation and thawing of chicken semen according to claim 5, characterized in that: The chicken breed is Xiaoshan chicken.

7. Use of the SNP molecular marker associated with sperm tail curling after cryopreservation and thawing of chicken semen as claimed in claim 1 or the primer as claimed in claim 2 in Xiaoshan chicken heritage breeding.

8. The use according to claim 7, characterized in that: The genomic DNA of in vitro venous blood of Xiaoshan chicken was extracted as a template, and PCR amplification was performed with the forward primer shown in SEQ ID NO.2 and the reverse primer shown in SEQ ID NO.

3. The amplified products were sequenced and analyzed, and the CC genotype individuals at the g.52122232C / T site were selected as breeding individuals. Continuous subgeneration and selection were carried out to reduce the sperm tail frequency after cryopreservation and thawing of Xiaoshan chicken semen, and to improve the semen performance of Xiaoshan chicken.

9. The use according to claim 8, characterized in that: Xiaoshan chickens are selected at 145 to 155 days of age.

10. The use according to claim 8, characterized in that: The PCR amplification program is: pre-denaturation at 97.5℃~98.5℃ for 2min~2.5min; denaturation at 97.5℃~98.5℃ for 10s~12s; annealing at 59.5℃~60.5℃ for 30s~31s; extension at 72℃~72.5℃ for 1min~1.5min; 33 cycles; then extension at 72℃~72.5℃ for 5min~5.5min; storage at 4℃~6℃.

Images