Tissue mycobacterium tuberculosis 16S rRNA detection kit and application thereof

Abstract

The invention relates to the technical field of biological detection, in particular to a kit for tissue mycobacterium tuberculosis 16S rRNA (ribosomal Ribonucleic Acid) detection and application thereof. According to the invention, 16 probes are designed by taking 16S rRNA (ribosomal Ribonucleic Acid) of mycobacterium tuberculosis as a target spot, and an in-situ hybridization method for detecting the mycobacterium tuberculosis is established according to the probes. Compared with a clinical detection method, the method has higher positive rate, sensitivity and specificity, can realize early detection of infected patients, and provides reference for effective treatment.

Description

Technical Field

[0001] The invention relates to the technical field of biological detection, and in particular to a detection kit for Mycobacterium tuberculosis 16S rRNA and application thereof. Background Art

[0002] Tuberculosis is a chronic infectious disease caused by Mycobacterium tuberculosis (TB), and it remains a major public health problem that threatens the world. Accurate and continuous detection of TB is essential for the diagnosis and treatment of TB. Currently, the most commonly used method for TB diagnosis is sputum etiology detection. Tuberculosis culture remains the gold standard for TB diagnosis, but culture takes a long time. Molecular detection methods such as GeneXpert and TB-DNA are highly sensitive and suitable for paucibacillary specimens. Interferon-γ release assay (IGRA) is widely used in whole blood, but it cannot distinguish between active tuberculosis and latent infection. Although the above methods have important diagnostic utility, the lack of technology that can continuously detect live, dead and residual TB bacteria in tissues has limited the study of the physiology caused by TB infection in vivo and the spatial distribution of TB bacteria in host cells and TB lesions. In addition, due to the impact of different epidemics and the popularity and resolution of imaging, unexplained pulmonary nodules are common in the post-epidemic era. How to identify the cause of pulmonary nodules is an important problem that confuses clinicians.

[0003] For clinical diagnosis and research purposes, the identification of tuberculosis in sputum, puncture biopsy, resection specimens or autopsy tissues relies on microscopic observation after Ziehl-Neelsen (ZN) acid-fast staining. However, the acid resistance of tuberculosis varies greatly, and the acid-fast property is not unique to tuberculosis. In addition, tuberculosis exists in complete, partial and non-acid-fast states. Therefore, acid-fastness cannot indicate its dead or alive state, which can easily cause false negatives and delay treatment intervention. In addition, studies have shown that tuberculosis can control the decay rate of mRNA released into cells and tissues during its growth, and tuberculosis mRNA has been detected in tissues 6-9 months after treatment. Therefore, the development of new diagnostic and identification technologies for active tuberculosis is crucial to reduce diagnostic delays, mitigate the spread of the disease and minimize the prevalence of tuberculosis. Summary of the invention

[0004] In view of the technical problems existing in the prior art, the present invention provides a kit for detecting 16SrRNA of Mycobacterium tuberculosis and its application. The present invention designs 16 probes based on the 16S rRNA of Mycobacterium tuberculosis as a target, and establishes an in situ hybridization method for detecting Mycobacterium tuberculosis based on the probes. Compared with clinical detection methods, this method has a higher positive rate, sensitivity and specificity, can achieve early detection of infected patients, and provide reference for effective treatment.

[0005] One of the purposes of the present invention is to provide a probe set for detecting 16S rRNA of Mycobacterium tuberculosis. The probe set comprises 16 probes, and the sequences thereof are shown in SEQ ID NO.1-16.

[0006] Preferably, the probe is designed with Mycobacterium tuberculosis 16S rRNA (KY084558.1) as the target.

[0007] Preferably, the 5' end of each probe is modified by a labeling molecule, and the labeling molecule includes at least one of digoxigenin, biotin, and horseradish peroxidase.

[0008] On the other hand, the present invention also provides a kit for detecting Mycobacterium tuberculosis 16S rRNA, the kit comprising the detection probe set.

[0009] Preferably, the kit further comprises: one or more of an endogenous enzyme inhibitor, a 10× repair solution, a hybridization solution, a substrate and a substrate diluent, a 100× digestion solution and / or a 50× washing buffer.

[0010] Preferably, the components of the endogenous enzyme inhibitor in the kit include 3% hydrogen peroxide and 0.5 M phosphate.

[0011] Preferably, the components of the 10× repair solution in the kit include 0.1 M sodium citrate buffer solution.

[0012] Preferably, the hybridization solution in the kit includes: hybridization solution 1, hybridization solution 2, hybridization solution 3, hybridization solution 4 and hybridization solution 5; wherein hybridization solution 1 contains 6× sodium citrate buffer (SSC), 40wt% formamide, 50mg / μL heparin, 1mg / mL tRNA, and 0.2wt% sodium dodecyl sulfate (SDS);

[0013] Hybridization solution 2 contained 5× SSC, 40 wt% formamide, and 0.2 wt% SDS;

[0014] Hybridization solution 3 contained 4× SSC, 40 wt % formamide, and 0.3 wt % SDS;

[0015] Hybridization solution 4 contained 3× SSC, 40 wt % formamide, and 0.2 wt % SDS;

[0016] Hybridization solution 5 contains 2×SSC, 40 wt % formamide, and 0.3 wt % SDS.

[0017] Preferably, the substrate in the kit is DAB (3,3-diaminobenzidine) or AEC (3-amino-9-ethylcarbazole), and the substrate diluent includes 3% hydrogen peroxide.

[0018] Preferably, the 100× digestive solution in the kit is 250 g / L of gastric enzyme;

[0019] Preferably, the 50× washing buffer in the kit is TBST buffer, which is prepared from Tris-HCl, NaCl and Tween 20.

[0020] Preferably, the test subjects of the kit include people with lung nodules and people who are suspected of being infected with bacteria (tuberculosis bacteria, non-tuberculous mycobacteria) or fungi and cannot be clinically diagnosed with tuberculosis.

[0021] Preferably, the test sample of the kit is a tissue obtained by surgery or lung puncture.

[0022] On the other hand, the present invention also provides use of the probe set in preparing a kit for detecting Mycobacterium tuberculosis 16SrRNA.

[0023] The advantages of the present invention are as follows: the present invention designs 16 probes based on the 16S rRNA of Mycobacterium tuberculosis as a target, and establishes an in situ hybridization method for detecting Mycobacterium tuberculosis based on the probes. Compared with clinical detection methods, this method has a higher positive rate, sensitivity and specificity, can achieve early detection of infected patients, and provide a reference for effective treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 .RNA in situ hybridization pre-test analysis;

[0025] Figure 2 .RNA in situ hybridization expansion analysis;

[0026] Figure 3 .ROC curve analysis. DETAILED DESCRIPTION

[0027] The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand the present invention more clearly.

[0028] The following embodiments are only used to illustrate the present invention and are not intended to limit the scope of the present invention. Based on the specific embodiments of the present invention, all other embodiments obtained by ordinary technicians in the field without creative work belong to the protection scope of the present invention.

[0029] In the examples of the present invention, unless otherwise specified, all raw material components are commercially available products well known to those skilled in the art; in the examples of the present invention, unless otherwise specified, the technical means used are conventional means well known to those skilled in the art.

[0030] Example 1

[0031] A probe set for detecting Mycobacterium tuberculosis 16S rRNA, the probe set includes 16 probes, and the sequences are shown in Table 1. The probe is designed with Mycobacterium tuberculosis 16S rRNA (KY084558.1) as the target, and the 5' end of each probe is modified by a labeling molecule, and the labeling molecule includes at least one of digoxigenin, biotin, and horseradish peroxidase.

[0032] Table 1. Probe sets for detecting 16S rRNA of Mycobacterium tuberculosis

[0033] Probe sequence number Sequence (5’→3’) SEQ ID NO.1 ccacaagacatgcatcccgtggtcc SEQ ID NO.2 aacaagctgataggccgcgggctca SEQ ID NO.3 cttcgtcgatggtgaaagaggttta SEQ ID NO.4 accgtcaatccgagagaacccggac SEQ ID NO.5 gttggccggtgcttcttctccacct SEQ ID NO.6 gatttcacgaacaacgcgacaaacc SEQ ID NO.7 ccgcacgctcacagttaagccgtga SEQ ID NO.8 cagtactctagtctgcccgtatcgc SEQ ID NO.9 cccacacctagtacccaccgtttac SEQ ID NO.10 acggcacggatcccaaggaaggaaa SEQ ID NO.11 ttttagccttgcggccgtactcccc SEQ ID NO.12 ttaatccacatgctccgccgcttgt SEQ ID NO.13 gtaaggttcttcgcgttgcatcgaa SEQ ID NO.14 ccacaagggaacgcctatctctaga SEQ ID NO.15 ttcgggtgttaccgactttcatgac SEQ ID NO.16 ccctcccgagggttaggccactggc

[0034] Example 2

[0035] A kit for detecting Mycobacterium tuberculosis 16S rRNA, the kit comprising:

[0036] 1) The probe set provided in Example 1;

[0037] 2) endogenous enzyme inhibitors, the components of which include 3% hydrogen peroxide and 0.5M phosphate;

[0038] 3) 10× repair solution, the components of which include 0.1 M sodium citrate buffer solution;

[0039] A hybridization solution, comprising: hybridization solution 1, hybridization solution 2, hybridization solution 3, hybridization solution 4 and hybridization solution 5; wherein hybridization solution 1 contains 6× sodium citrate buffer (SSC), 40 wt% formamide, 50 mg / μL heparin, 1 mg / mL tRNA, and 0.2 wt% sodium dodecyl sulfate (SDS);

[0040] Hybridization solution 2 contained 5× SSC, 40 wt% formamide, and 0.2 wt% SDS;

[0041] Hybridization solution 3 contained 4× SSC, 40 wt % formamide, and 0.3 wt % SDS;

[0042] Hybridization solution 4 contained 3× SSC, 40 wt % formamide, and 0.2 wt % SDS;

[0043] Hybridization solution 5 contained 2× SSC, 40 wt % formamide, and 0.3 wt % SDS;

[0044] 4) substrate and substrate diluent, the substrate is DAB (3,3-diaminobenzidine) or AEC (3-amino-9-ethylcarbazole), and the substrate diluent includes 3% hydrogen peroxide;

[0045] 5) 100× digestive solution, the digestive solution is 250g / L gastric enzyme;

[0046] 6) 50× washing buffer, the washing buffer is TBST buffer prepared from Tris-HCl, NaCl and Tween 20.

[0047] Example 3

[0048] RNA in situ hybridization pre-test analysis:

[0049] 1) Tuberculosis tissues from 3 different patients and lung tissues from 3 non-tuberculosis infected people were obtained, fixed and embedded into paraffin specimens, and the paraffin specimens were cut into slices of about 5 μm. The obtained slices were baked at 60°C for 1.5 hours;

[0050] 2) Dewaxing: Soak the slices in fresh xylene for 8 minutes, take out the slices after xylene soaking and continue to soak in fresh xylene for another 8 minutes, then soak the slices in fresh anhydrous ethanol for 5 minutes, take out the slices after ethanol soaking and continue to soak in fresh anhydrous ethanol for 5 minutes;

[0051] 3) 50× washing buffer was prepared into 1× washing buffer with pure water, 10× repair solution was prepared into 1× repair solution with pure water, and 100× digestion enzyme was prepared into 1× digestion enzyme with PBS buffer;

[0052] 4) Add three drops of endogenous enzyme inhibitor to the slices treated above, incubate at room temperature for 45 minutes, and then wash the slices with distilled water three times, 5 minutes each time;

[0053] 5) Preheat a beaker containing 1× repair solution as the pretreatment solution. After the pretreatment solution boils, immerse the slide rack containing the slices in the 1× repair solution and slowly boil for 8 minutes. When the time is up, immediately move the slide rack to a staining jar filled with distilled water at room temperature and wash it with distilled water for 3 times, 5 minutes each time, then wash it with fresh anhydrous ethanol for 3 times, 5 minutes each time, and air dry;

[0054] 6) Use an immunohistochemistry pen to draw a water-blocking circle on the slice, and wash it with distilled water three times, 5 minutes each time;

[0055] 7) Add 3 drops of 1× digestion solution to each specimen in the section and incubate in a hybridization oven at 45°C for 15 minutes;

[0056] 8) Preheat the probe at 45°C for 15 minutes, shake well and place at room temperature;

[0057] 9) Wash the sections with distilled water three times for 5 minutes each time, add 3 drops of Mycobacterium tuberculosis 16S rRNA probe to each specimen in the sections, and incubate in a hybridization oven at 45°C for 5 hours;

[0058] 10) Rinse the sections twice with washing buffer at room temperature for 5 minutes each time, remove excess liquid, add 3 drops of hybridization solution 1 to each specimen in the section, and incubate in a hybridization oven at 45°C for 30 minutes;

[0059] 11) Rinse the sections twice with washing buffer at room temperature for 5 minutes each time, remove excess liquid, add 3 drops of hybridization solution 2 to each specimen in the section, and incubate in a hybridization oven at 45°C for 30 minutes;

[0060] 12) Rinse the sections twice with washing buffer at room temperature for 5 minutes each time, remove excess liquid, add 3 drops of hybridization solution 3 to each specimen in the sections, and incubate in a hybridization oven at 40°C for 30 minutes;

[0061] 13) Rinse the sections twice with washing buffer at room temperature for 5 minutes each time, remove excess liquid, add 3 drops of hybridization solution 4 to each specimen, and incubate at room temperature for 30 minutes;

[0062] 14) Rinse the sections twice with washing buffer at room temperature for 5 minutes each time, remove excess liquid, add 3 drops of hybridization solution 5 to each specimen, and incubate at room temperature for 30 minutes;

[0063] 15) Prepare the substrate and substrate diluent in proportion and use within 30 minutes after mixing.

[0064] 16) Rinse the sections twice with washing buffer at room temperature for 5 minutes each time, remove excess liquid, add 3 drops of prepared reaction substrate to each specimen in the section, and incubate at room temperature for 15 minutes;

[0065] 17) Counterstaining: Counterstain the sections with hematoxylin for 30 seconds, then rinse the sections under running water for 5 minutes;

[0066] 18) Blueing: Soak the sections in saturated lithium carbonate for 1 minute, then rinse the sections under running water for 10 minutes;

[0067] 19) Use an appropriate amount of sealing glue to seal the slices;

[0068] 20) Observe the colored granular precipitates in the tissue sections under an ordinary optical microscope and calculate the detection rate of the tissue Mycobacterium tuberculosis 16S rRNA probe.

[0069] The results are as follows Figure 1 As shown, the results of RNA in situ hybridization testing of paraffin tissue sections of 3 patients were all positive, while the results of RNA in situ hybridization testing of paraffin tissue sections of 3 non-tuberculosis infected people were all negative. The test results confirmed that the method of the present invention has a high detection rate and can effectively distinguish patients infected with Mycobacterium tuberculosis from non-tuberculosis infected people.

[0070] Example 4

[0071] In order to further analyze the detection sensitivity and specificity of the probe group, 30 patients clinically diagnosed with Mycobacterium tuberculosis infection and 30 people without tuberculosis infection were collected, and paraffin tissue sections of the above cases were collected for in situ hybridization experimental analysis, and the sensitivity and specificity were analyzed based on the test results.

[0072] The results are as follows Figure 2 As shown, the lung tissues of 30 patients who were clinically diagnosed with Mycobacterium tuberculosis infection were analyzed by in situ hybridization, and the results showed that 27 cases were positive and 3 cases were negative; and 2 of the patients who were clinically identified as uninfected were identified as positive by the detection method of the present invention, and the rest were negative. The two positive patients were followed up later, and it was found that they clinically showed symptoms of Mycobacterium tuberculosis infection. By comparing with the clinical detection method, it can be seen that the method of the present invention can achieve early detection of infected patients and provide a reference for effective treatment. At the same time, according to the ROC curve analysis results, it is also shown that the area under the line AUC of the method of the present invention is 0.92, 95% CI: 0.84-1.00, the sensitivity is 90%, and the specificity is 93%, which further confirms that the method of the present invention has excellent diagnostic value.

[0073] The above embodiments are intended to illustrate the essential content of the present invention, but are not intended to limit the protection scope of the present invention. Those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and protection scope of the technical solution of the present invention.

Claims

1. A probe set for detecting 16S rRNA of Mycobacterium tuberculosis, characterized in that: The probe set includes 16 probes, and the sequences thereof are shown as SEQ ID NO.1-16.

2. The probe set according to claim 1, characterized in that: The probe is designed with Mycobacterium tuberculosis 16S rRNA as the target.

3. A kit for detecting Mycobacterium tuberculosis 16S rRNA, characterized in that: The kit comprises the detection probe set according to any one of claims 1 to 2.

4. The kit according to claim 3, characterized in that The kit further comprises: one or more of an endogenous enzyme inhibitor, a 10× repair solution, a hybridization solution, a substrate and a substrate diluent, a 100× digestion solution and / or a 50× washing buffer solution; And / or, the components of the endogenous enzyme inhibitor in the kit include 3% hydrogen peroxide and 0.5M phosphate; And / or, the components of the 10× repair solution in the kit include 0.1 M sodium citrate buffer solution.

5. The kit according to claim 4, characterized in that The hybridization solutions in the kit include: hybridization solution 1, hybridization solution 2, hybridization solution 3, hybridization solution 4 and hybridization solution 5; wherein hybridization solution 1 contains 6× sodium citrate buffer, 40wt% formamide, 50mg / μL heparin, 1mg / mL tRNA and 0.2wt% sodium dodecyl sulfate; Hybridization solution 2 contained 5× SSC, 40 wt % formamide, and 0.2 wt % SDS; Hybridization solution 3 contained 4× SSC, 40 wt % formamide, and 0.3 wt % SDS; Hybridization solution 4 contained 3× SSC, 40 wt % formamide, and 0.2 wt % SDS; Hybridization solution 5 contained 2×SSC, 40 wt % formamide and 0.3 wt % SDS.

6. The kit according to claim 4, characterized in that The substrate in the kit is 3,3-diaminobenzidine or 3-amino-9-ethylcarbazole, and the substrate diluent includes 3% hydrogen peroxide.

7. The kit according to claim 4, characterized in that The 100× digestion solution in the kit is 250 g / L of gastric enzyme.

8. The kit according to claim 4, characterized in that The 50× washing buffer in the kit is TBST buffer, which is prepared from Tris-HCl, NaCl and Tween 20.

9. The kit according to claim 3, characterized in that The test subjects of the kit include people with lung nodules and people who are suspected of being infected with bacteria or fungi and cannot be clinically diagnosed with tuberculosis.

10. The kit according to claim 3, characterized in that The test sample of the kit is a tissue obtained by surgery or lung puncture.

Images