CRISPR-Cas12b temperature-controlled one-step pathogen nucleic acid detection kit and its use method and application

The CRISPR-Cas12b temperature-controlled one-step pathogen nucleic acid detection kit utilizes temperature control and component optimization to achieve rapid and accurate pathogen nucleic acid detection, solving the problems of long time consumption, high equipment requirements and large errors in existing technologies, and improving detection efficiency and sensitivity.

CN119464574BActive Publication Date: 2025-09-05TIANJIN UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411748394.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-29
Publication Date
2025-09-05
Estimated Expiration
2044-11-29

AI Technical Summary

Technical Problem

Existing pathogen detection methods are time-consuming, require high equipment, are prone to errors in operation, and have high false positive rates, making them difficult to meet the needs, especially in rapid diagnosis and on-site testing.

Method used

The CRISPR-Cas12b temperature-controlled one-step pathogen nucleic acid detection kit contains sgRNA, AapCas12b nuclease, nucleic acid detection probe, upstream and downstream primers, and nucleic acid amplification reagents. One-step detection is achieved through temperature control at 37°C and 60°C. The temperature characteristics of AapCas12b and the compatibility of ERA amplification reagents are utilized to simplify the operation steps and improve detection efficiency.

Benefits of technology

It achieves rapid and accurate pathogen nucleic acid detection with high sensitivity and a minimum detection limit of 1 copy. The test results are consistent with qPCR, which simplifies the operation steps, reduces the requirements for equipment, and eliminates the error risks of step-by-step operations.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119464574B_ABST
    Figure CN119464574B_ABST
Patent Text Reader

Abstract

The present invention discloses a CRISPR-Cas12b temperature-controlled one-step pathogen nucleic acid detection kit and its use method and application, which belongs to the field of pathogen detection technology. The kit provided by the present invention can achieve rapid detection of pathogen nucleic acid with high sensitivity, a minimum detection limit of 1 copy, and the test results are consistent with the test results of qPCR. The detection accuracy is high, the equipment requirements are low, the operation steps required for detection are simpler, and the time required for detection is shorter. The provided kit optimizes the components and ratios, makes full use of the temperature characteristics of AapCas12b and the characteristics of the ERA amplification kit, greatly improves the compatibility of the two systems, and realizes one-step detection of pathogen nucleic acid. Under the premise of ensuring the high sensitivity and specificity of the detection method, the risk of errors that may be introduced by the step-by-step operation is eliminated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of pathogen detection technology, and in particular to a CRISPR-Cas12b temperature-controlled one-step pathogen nucleic acid detection kit, and a use method and application thereof. Background Art

[0002] Pathogen infection is a major cause of many diseases, particularly infections with microorganisms such as viruses, bacteria, and fungi, which can lead to a range of clinical symptoms and health risks. Pathogen infection typically presents with mild symptoms such as fever, cough, sore throat, and fatigue, but in severe cases, it can lead to pneumonia, sepsis, respiratory failure, and even death. Rapid and accurate pathogen detection is crucial for early diagnosis, timely treatment, and the development of prevention and control measures. For example, the primary clinical manifestations of SFTSV infection include fever, gastrointestinal symptoms, thrombocytopenia, leukopenia, liver and kidney damage, and some patients experience bleeding. SFTSV primarily occurs in hilly and mountainous areas, primarily affecting adult farmers engaged in agricultural production, with some cases developing the disease after being bitten by ticks. Common diagnostic methods are often based on empirical judgment or the detection of individual pathogens, and syndromic detection of common pathogens is scarce. To achieve early detection of SFTSV, the development of low-cost, accurate, efficient, and rapid diagnostic methods for the SFTSV pathogen is crucial.

[0003] Currently, commonly used pathogen diagnosis methods in clinical practice include culture, immunological testing, and molecular biological testing. Culture is a traditional method for detecting bacteria and fungi. It has high specificity, but it is time-consuming, usually requiring several days to obtain results, and some pathogens, such as viruses, are difficult to detect through culture. Immunological testing (such as enzyme-linked immunosorbent assay (ELISA)) identifies pathogen infection by detecting antigens or antibodies. It is simple to operate, but its sensitivity and specificity are low, and it is prone to false positive or false negative results. Molecular biological detection methods (such as PCR) have become the mainstream method for pathogen diagnosis due to their high sensitivity and specificity, especially in viral detection. Taking SFTS pathogen detection as an example, real-time fluorescence quantitative PCR is still the most recognized accurate method. However, real-time fluorescence PCR requires complex equipment and strict experimental conditions, such as a thermal cycler and high-quality DNA / RNA extraction steps. The entire detection process also includes steps such as sampling and sample processing, and usually takes more than two hours in total, which greatly limits its application in on-site point-of-care diagnosis.

[0004] Currently, step-by-step detection methods based on amplification and CRISPR are becoming increasingly popular for pathogen detection. They do not require expensive equipment and are relatively low-cost. They also offer advantages such as high sensitivity, strong specificity, and significantly shorter detection times than real-time fluorescence quantitative PCR. However, the operation of step-by-step detection methods based on amplification and CRISPR is prone to errors, resulting in false positives. Therefore, a highly sensitive test kit that can rapidly and accurately detect pathogen nucleic acids in a single step is urgently needed. Summary of the Invention

[0005] The purpose of the present invention is to provide a CRISPR-Cas12b temperature-controlled one-step pathogen nucleic acid detection kit and its use method and application, so as to simplify the pathogen detection steps, eliminate false positives caused by errors, improve detection efficiency, and reduce the requirements for instruments and equipment while ensuring high sensitivity and accuracy of the detection results.

[0006] To achieve the above objectives, the present invention provides a CRISPR-Cas12b temperature-controlled one-step pathogen nucleic acid detection kit, comprising the following components:

[0007] (1) sgRNA that detects pathogen nucleic acids;

[0008] (2) AapCas12b nuclease;

[0009] (3) Nucleic acid detection probes;

[0010] (4) upstream and downstream primers that amplify pathogen-specific regions;

[0011] (5) Commercially available Xinda Gene Basic Nucleic Acid Amplification Kit;

[0012] (6) Sterile ddH2O after DEPC treatment.

[0013] Preferably, the system for detection using the CRISPR-Cas12b temperature-controlled one-step pathogen nucleic acid detection kit is: sgRNA 3 μM for detecting pathogen nucleic acid, AapCas12b nuclease 5 μM, nucleic acid detection probe 10 μM, upstream primers and downstream primers for amplifying pathogen-specific regions 10 μM each, and DPEC sterile and enzyme-free sterilized ddH2O is used to make up the required reaction system volume.

[0014] Preferably, the nucleic acid detection probe sequence is shown as SEQ ID NO.2.

[0015] A method for using the CRISPR-Cas12b temperature-controlled one-step pathogen nucleic acid detection kit as described above is as follows: after adding the test liquid to the prepared detection reaction system, placing it in a GS8 real-time fluorescence reader, reacting at 37°C for 20 minutes, and then reacting at 60°C for 5-20 minutes, and interpreting the fluorescence value.

[0016] Preferably, the fluorescence value interpretation standard is: after removing the background fluorescence of the sample, a fluorescence value of 3 times or more of the negative control sample is defined as positive, and a fluorescence value of less than 3 times the negative control sample is defined as negative; the negative control is sterilized ddH2O after DEPC treatment.

[0017] A method for detecting SFTS using the above-mentioned CRISPR-Cas12b temperature-controlled one-step pathogen nucleic acid detection kit, wherein the sgRNA sequence for detecting SFTS pathogen nucleic acid is shown in SEQ ID NO.1; the upstream primer sequence for amplifying the SFTS pathogen-specific region is shown in SEQ ID NO.3, and the downstream primer sequence is shown in SEQ ID NO.4.

[0018] A method for detecting pathogen nucleic acids using a CRISPR-Cas12b temperature-controlled one-step kit is provided for use in pathogen detection.

[0019] A method for detecting SFTS using a CRISPR-Cas12b temperature-controlled one-step pathogen nucleic acid detection kit as described above is used in the detection of SFTS for non-medical purposes.

[0020] The AapCas12b selected in the present invention has low activity at 37°C without the addition of cutting buffer, but can exhibit excellent cutting activity at 60°C; and the ERA amplification reaction can be carried out quickly at 37°C; at the same time, the compatibility of the CRISPR system and the ERA amplification system in a single tube without the addition of cutting buffer is also better. Therefore, the whole tube system of the present invention can achieve one-step detection by directly adding samples without the intervention of microfluidics, mainly using the temperature of 60°C as the switch for CRISPR-Cas12b cutting. The pre-incubation of the CRISPR system and the amplification of the target fragment are completed simultaneously in one tube at 37°C. At this time, the activity of AapCas12b is very low and hardly interferes with the amplification in the tube; and when entering the 60°C stage, the CRISPR-Cas12b cutting activity is quickly started, and the discrimination and reporting can be completed in a very short time.

[0021] Therefore, the CRISPR-Cas12b temperature-controlled one-step pathogen nucleic acid detection kit provided by the present invention, and its use method and application, have the following specific technical effects:

[0022] (1) The kit provided by the present invention can achieve rapid detection of pathogen nucleic acid with high sensitivity and a minimum detection limit of 1 copy. The detection results are consistent with those of qPCR, with high detection accuracy, low equipment requirements, simpler detection steps, and shorter detection time.

[0023] (2) The kit provided by the present invention optimizes the components and ratios, fully utilizes the temperature characteristics of AapCas12b and the characteristics of the ERA amplification kit, greatly improves the compatibility of the two systems, and realizes the one-step detection of pathogen nucleic acid. While ensuring the high sensitivity and specificity of the detection method, it eliminates the risk of errors introduced by the step-by-step operation. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments of the present invention. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative labor.

[0025] Figure 1 It is a schematic diagram of the detection process and principle of the kit provided by the present invention;

[0026] Figure 2 This is a structural diagram of a simulated sample (plasmid) containing the S segment of the SFTS pathogen nucleic acid in Example 3 of the present invention;

[0027] Figure 3 is the result of the test using the kit provided by the present invention in Example 3 of the present invention; wherein, mock is the test result of the negative control, 1copy is the test result of the test simulated sample aqueous solution containing 1 molecular copy number, and 10copy is the test result of the test simulated sample aqueous solution containing 10 molecular copies;

[0028] Figure 4 This is the qPCR test result in Example 4 of the present invention;

[0029] Figure 5 This is the result of testing using the kit provided by the present invention in Example 4 of the present invention; wherein, water is the negative control test result, N1 is the blank control test result; P1-P6 are the test results of 6 samples determined to be positive by the qPCR detection method. DETAILED DESCRIPTION

[0030] The present invention provides a CRISPR-Cas12b temperature-controlled one-step pathogen nucleic acid detection kit, the detection process and principle of pathogens are as follows Figure 1As shown in the figure, the method can simplify the pathogen detection steps, eliminate false positives caused by errors, improve detection efficiency, and reduce the requirements for instruments and equipment while ensuring high sensitivity and accuracy of the detection results.

[0031] The technical solution of the present invention is further described below with reference to the accompanying drawings and embodiments.

[0032] In order to make the objectives, technical solutions, and advantages of this application more clear, thorough, and complete, the following technical solutions of the present invention are clearly and completely described by way of the accompanying drawings and examples, taking the detection of SFTS pathogen nucleic acid as an example. The following detailed descriptions are all illustrations of the embodiments and are intended to provide further details of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those commonly understood by those skilled in the art to which this application belongs.

[0033] The instruments, equipment, reagents and materials used in the examples were obtained from commercial sources, and the methods and steps not described in detail are conventional methods and steps in the art.

[0034] Example 1

[0035] The sgRNA for detecting SFTS pathogen nucleic acid was designed as follows:

[0036] (1) Obtain the genome sequence of the SFTS pathogen and identify specific identification regions of the SFTS pathogen through bioinformatics analysis and comparison. The specific steps are as follows: Search the NCBI nucleic acid sequence library for the full genome sequence of the SFTS pathogen HB-29 owned by the inventor's laboratory to obtain its full genome sequence. Search for "TTN" sequences in the HB-29 full genome sequence and use these sequences as a candidate database for sgRNA targeting sequences.

[0037] (2) According to the screening principles, such as the GC content, base uniformity, sequence conservation and other parameters of the sequence, a target site recognition sequence of 24 nt in size is finally screened from the alternative database obtained in step (1). Then, a direct repeat sequence of 91 nt in size is added to the target site recognition sequence of 24 nt in size obtained above, and finally an sgRNA for detecting SFTS pathogen nucleic acid is obtained, which is named sgRNA-1. The nucleotide sequence of sgRNA-1 is shown in SEQ ID NO. 1, wherein the last 24 nucleotides are a target site recognition sequence of 24 nt in size screened from the alternative database obtained in step (1).

[0038] SEQ ID NO.1:

[0039] GUCUAGAGGACAGAAUUUUUCACGGGGUGCCAAUGGCCACUUUCCA

[0040] GGUGGCAAAGCCCGUUGAGCUUCUCAAAUCUGAGAAGUGGCACCGCAG

[0041] AGCCUUCCCACUUGGACAU

[0042] Example 2

[0043] A CRISPR-Cas12b temperature-controlled one-step detection kit for SFTS pathogen nucleic acid was prepared, including the following components:

[0044] (1) sgRNA-1 for detecting nucleic acid of SFTS pathogen;

[0045] (2) AapCas12b nuclease (Aidygene AapCas12b nuclease (C2c1));

[0046] (3) Nucleic acid detection probes;

[0047] (4) a first upstream primer and a first downstream primer;

[0048] (5) Commercially available Xinda Gene Basic Nucleic Acid Amplification Kit (ERA method);

[0049] (6) Sterile ddH2O after DEPC treatment.

[0050] The sequence of the nucleic acid detection probe is FAM-TTTTTTTT-BHQ-1 (SEQ ID NO. 2); the nucleotide sequence of the first upstream primer is shown in SEQ ID NO. 3; and the nucleotide sequence of the first downstream primer is shown in SEQ ID NO. 4. The sequence information was sent to the company for synthesis of the required nucleic acid detection probe, first upstream primer, and first downstream primer.

[0051] SEQ ID NO.3:CAAGAGAAATATGGACTGGTTGAGA

[0052] SEQ ID NO.4:ACTGGGAGATACTCCTTTAGAGCTG

[0053] Example 3

[0054] The minimum detection limit of the CRISPR-Cas12b temperature-controlled one-step detection kit for SFTS pathogen nucleic acid prepared in Example 2 was investigated to test the detection of a simulated sample (plasmid) containing the S fragment of the SFTS pathogen nucleic acid. The preparation method of the simulated sample (plasmid) containing the S fragment of the SFTS pathogen nucleic acid is as follows: first, the S fragment gene is cloned by PCR using the cDNA of SFTSV as a template; then, the pHH21 vector and the S fragment are subjected to enzyme digestion and homologous recombination, and the structure is shown in the figure. Figure 2 The specific test steps are as follows:

[0055] (1) Thoroughly mix 3 μL of 10 μM first upstream primer aqueous solution, 3 μL of 10 μM first downstream primer aqueous solution, 20 μL of the dissolving agent in the ERA amplification kit, 10 μL of DEPC-treated sterilized ddH2O, and a tube of basic amplification reagent in the ERA amplification kit to prepare an ERA premix.

[0056] (2) 0.5 μL of 5 μM AapCas12b nuclease, 1 μL of 3 μM sgRNA-1 for detecting SFTS pathogen nucleic acid, 1 μL of 10 μM nucleic acid detection probe, 18 μL of the ERA premix prepared in step (1), 3 μL of an aqueous solution containing detection simulation samples with molecular copy numbers of 1 and 10, and 1 μL of the activator in the ERA amplification kit were thoroughly mixed to obtain a reaction system. DEPC-treated sterilized ddH2O was used as a negative control (referred to as mock).

[0057] The reaction system was placed in a GS8 real-time fluorescence reader and reacted at 37°C for 20 minutes and then at 60°C for 15 minutes. The results of the three repeated experiments are shown in Figure 2. Figure 3 As shown, mock is the test result of the negative control, 1copy is the test result of the test simulated sample aqueous solution containing 1 molecule copy number, and 10copy is the test result of the test simulated sample aqueous solution containing 10 molecule copies.

[0058] The fluorescence value of the test result is interpreted according to the following criteria: after removing the background fluorescence of the sample, a fluorescence value of 3 times or more of the fluorescence value of the negative control sample is defined as positive, and a fluorescence value of less than 3 times the fluorescence value of the negative control sample is defined as negative.

[0059] Depend on Figure 3 It can be seen that the detection limit can be as low as single copy, and it can basically be judged as positive within 10 minutes at 60°C; after increasing the sample content to 10 copies, it can basically be judged as positive within 5 minutes at 60°C.

[0060] Example 4

[0061] The qPCR method was used as a control to examine the detection accuracy of the CRISPR-Cas12b temperature-controlled one-step detection kit for SFTS pathogen nucleic acid prepared in Example 2. The test was conducted by detecting SFTS pathogen cDNA samples. The specific steps are as follows:

[0062] (1) SFTSV was cultured using VERO, and the supernatant was collected after 10 days; after centrifugation at 3000 rpm for 10 min, the supernatant was taken out with a needle, collected in a new centrifuge tube through a 0.22 μm filter membrane, and then divided into EP tubes; RNA in the collected supernatant was extracted using the RNA virus genome extraction kit with the product number R2000 of Solebo, and the concentration of the obtained RNA was directly measured using the NanoDrop method for measuring nucleic acid concentration. Six RNA solutions with good quality were selected and reverse transcribed using the Yisheng Biological Reverse Transcription Kit 11139ES60. The reverse transcription operation was as follows: 14 μL of RNA was first prepared with 2 μL of RNase-free H2O and 1 μL of Random Primers N6 (50 μM), and the mixture was gently shaken and placed in a PCR instrument set at 65°C for 5 min and 4°C for 3 min; after taking it out, 2 μL of 10× III Super Buffer and 1 μL Prepare III RT Enzyme Mix, shake gently to mix, place in a PCR instrument and set the program at 25℃ for 5 min, 55℃ for 15 min, 85℃ for 5 min, and 4℃ for reverse transcription to obtain cDNA solutions, which are recorded as P1, P2, P3, P4, P5, and P6 respectively.

[0063] (2) The upstream primer for amplifying the S fragment is shown in SEQ ID NO.5, and the downstream primer is shown in SEQ ID NO.6. The cDNA solution obtained was subjected to qPCR using the qPCR kit with the product number ZF501 of Zhuangmeng Bio. Sterile ddH2O after DEPC treatment was used as the negative control (denoted as water), and the solution obtained by the same RNA extraction and reverse transcription method using the culture supernatant of uninfected Vero cells was used as the blank control (denoted as N1). The sample addition method was to add 10 μL of 2×HQ SYBR qPCR Mix, 0.4 μL of SF, 0.4 μL of SR, 7.2 μL of ddH2O, and 2 μL of cDNA to each tube. The results are shown in Figure 2. Figure 4 shown.

[0064] SEQ ID NO.5:GGGTCCCTGAAGGAGTTGTAAA

[0065] SEQ ID NO.6: TGCCTTCACCAAGACTATCAATGT

[0066] All results are the average of three replicates, using the water-treated group as the negative standard. For qPCR results in other groups, Cq values ​​(also known as CT values) ≤ 35 are considered positive. Cq values ​​between 35 and 38 are considered positive after repeated testing, with values ​​≤ 37 and > 37 considered negative. Cq values ​​≥ 38 or no detection are considered negative. As can be seen from the results, group N1 also gave a negative result, while groups P1 to P6 all gave positive results. These results will be compared with the kit test results below.

[0067] (3) Thoroughly mix 3 μL of a 10 μM first upstream primer aqueous solution, 3 μL of a 10 μM first downstream primer aqueous solution, 20 μL of the dissolving agent in the ERA amplification kit, 10 μL of DEPC-treated sterilized ddH2O, and a tube of basic amplification reagent in the ERA amplification kit to prepare an ERA premix.

[0068] (4) 0.5 μL of 5 μM AapCas12b nuclease, 1 μL of 3 μM sgRNA-1 for detecting SFTS pathogen nucleic acid, 1 μL of 10 μM nucleic acid detection probe, 18 μL of ERA premix prepared in step (3), 3 μL of 6 cDNA solutions obtained in step (1), and 1 μL of activator in the ERA amplification kit were fully mixed to obtain a reaction system. The reaction system was placed in a GS8 real-time fluorescence reader, reacted at 37°C for 20 minutes, and then reacted at 60°C for 15 minutes, and the fluorescence value was taken for interpretation. Sterile ddH2O after DEPC treatment was used as a negative control (denoted as water), and the solution obtained by the same RNA extraction and reverse transcription method using the culture supernatant of uninfected Vero cells was used as a blank control (denoted as N1). The results are as follows. Figure 5 shown.

[0069] The test results were interpreted according to the following criteria: after removing the background fluorescence of the sample, a fluorescence value that was 3 times or more than that of the negative control sample was defined as positive, and a fluorescence value that was less than 3 times that of the negative control sample was defined as negative.

[0070] Depend on Figure 5 It can be seen that for the 6 samples (P1-P6) judged as positive by qPCR, the CRISPR-Cas12b temperature-controlled one-step method for detecting SFTS pathogen nucleic acid prepared in Example 2 was used, and all of them were judged as positive, while for the sample (N1) judged as negative by qPCR, the CRISPR-Cas12b temperature-controlled one-step method for detecting SFTS pathogen nucleic acid prepared in Example 2 was used, and it was still judged as negative.

[0071] Therefore, the application of the kit provided by the present invention can achieve rapid detection of pathogen nucleic acids with high sensitivity, a minimum detection limit of 1 copy, and the detection results are consistent with the detection results of qPCR. The detection accuracy is high, the equipment requirements are low, the operation steps required for detection are simpler, and the detection time is shorter. After optimizing the components and ratios, the provided kit makes full use of the temperature characteristics of AapCas12b and the characteristics of the ERA amplification kit, greatly improving the compatibility of the two systems, and realizing one-step detection of pathogen nucleic acids. While ensuring the high sensitivity and specificity of the detection method, the risk of errors that may be introduced by the step-by-step operation is eliminated.

[0072] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the same. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solutions of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. A CRISPR-Cas12b temperature-controlled one-step detection kit for pathogen nucleic acid, characterized in that: The pathogen is SFTS pathogen, and the kit includes the following components: (1) sgRNA for detecting pathogen nucleic acids; (2) AapCas12b nuclease; (3) Nucleic acid detection probes; (4) Upstream and downstream primers for amplifying pathogen-specific regions; (5) ERA basic nucleic acid amplification kit; (6) Sterile ddH2O after DEPC treatment; The nucleotide sequence of sgRNA is shown in SEQ ID NO. 1; The nucleic acid detection probe sequence is shown in SEQ ID NO.2; The upstream primer sequence is shown in SEQ ID NO.3, and the downstream primer sequence is shown in SEQ ID NO.4; The method of using the CRISPR-Cas12b temperature-controlled one-step pathogen nucleic acid detection kit is as follows: after adding the test liquid to the prepared detection reaction system, place it in a GS8 real-time fluorescence reader, react at 37°C for 20 minutes, and then react at 60°C for 5-20 minutes, and interpret the fluorescence value.

2. A CRISPR-Cas12b temperature-controlled one-step pathogen nucleic acid detection kit according to claim 1, characterized in that, The system for detection using the CRISPR-Cas12b temperature-controlled one-step pathogen nucleic acid detection kit is as follows: sgRNA 3 μM for detecting pathogen nucleic acid, AapCas12b nuclease 5 μM, nucleic acid detection probe 10 μM, upstream primers and downstream primers for amplifying pathogen-specific regions 10 μM each, and DPEC sterile and enzyme-free sterilized ddH2O is used to make up the required reaction system volume.

3. A CRISPR-Cas12b temperature-controlled one-step pathogen nucleic acid detection kit according to claim 1, characterized in that, The standard for interpreting fluorescence values ​​is: after removing the background fluorescence of the sample, a fluorescence value of 3 times or more of the negative control sample is defined as positive, and a fluorescence value of less than 3 times the negative control sample is defined as negative; the negative control is sterilized ddH2O after DEPC treatment.

4. An application of a CRISPR-Cas12b temperature-controlled one-step pathogen nucleic acid detection kit as described in any one of claims 1 to 3 in pathogen detection, characterized in that: Pathogen detection is not for the purpose of disease diagnosis and treatment; the pathogen is the SFTS pathogen.

Citation Information

Patent Citations

  • Kit for detecting fever with thrombocytopenia syndrome pathogen nucleic acid

    CN111733287A

  • Salmonella Indiana molecular detection method and kit

    CN117947194A