Application of transmembrane transport protein in increasing yield of microbial gibberellin

Abstract

The invention discloses an application of transmembrane transporters NPF and SWEET in increasing the yield of gibberellin of Fusarium fujikuroi, and the application comprises the following steps: performing heterologous expression on an exogenous transmembrane transporter NPF or SWEET in wild type Fusarium fujikuroi in a manner of constructing an integrated expression plasmid, so as to increase the yield of gibberellin GA4 + 7. A new thought is provided for increasing the yield of gibberellin, the yield of GA4 + 7 is effectively increased through heterologous overexpression of the transmembrane transporter NPF or SWEET, gibberellin which is more efficient, more stable, safer and higher in economic value is obtained, and the gibberellin has a positive promotion effect on industrial production of gibberellin.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to the application of transmembrane transport protein in improving the gibberellin yield of microorganisms. Background Art

[0002] When cash crops such as rice, corn, and sugarcane are infected with fungal pathogens such as Fusarium graminearum, Gibberella fuscata, and Fusarium moniliforme, they will experience a phenomenon of wild growth, namely "bad seedling disease". This disease will cause wild growth of plants, few or no fruits, and even cause the plants to fall off or die, which seriously endangers the development of my country's agricultural economy.

[0003] With the in-depth study of seedling blanching, people found that the main factor causing the crazy growth of plants is a type of plant growth hormone secreted by pathogenic bacteria - Gibberellins (GAs for short). Gibberellins are a type of tetracyclic diterpenoid compounds. Corresponding to the crazy growth of plants, the use of ppm levels of gibberellins will eliminate seed dormancy, accelerate seed germination, increase crop yields, promote fruit setting, overcome dwarfing and other beneficial phenomena for plant growth.

[0004] So far, 136 gibberellins have been found in various organisms. Currently, only a few free-type gibberellins such as GA1, GA3, GA4 and GA7 have strong physiological activity. Among them, GA3 has the highest activity and is the most widely used. It is currently the only commercially large-scale gibberellin product. However, GA3 is too active and excessive use can cause plants to grow wildly. In recent years, GA 4+7 Its application in flower and fruit preservation, dormancy breaking and other aspects has attracted attention. However, GA4 and GA7 have different or even counter-effect effects on each other. GA7 will strongly inhibit the formation of flower buds, while GA4 will not only not inhibit the formation of flower buds, but also promote them. Therefore, the mixed use of GA4 and GA7 can achieve complementary advantages. Common mixtures on the market currently have different proportions of GA4 and GA7, and the market price of formulations rich in GA7 is more than 20% higher than that of formulations with the same content of GA4. Therefore, compared with GA3, GA4 and GA7 are more efficient, more stable, safer, and have higher economic value.

[0005] However, the low yield and high production cost of GA4 and GA7 in industrial production currently limit their large-scale application. Therefore, new technologies are urgently needed to increase the yield of GA4 and GA7. Summary of the invention

[0006] In order to solve the problems of low GA4 and GA7 yield and high production cost in the prior art, the present invention provides the application of transmembrane transport proteins in increasing the gibberellin production of microorganisms, and increases the gibberellin efflux capacity by overexpressing transport proteins of the NPF and SWEET families, thereby increasing the GA4 and GA7 production.

[0007] In order to achieve the above object, the first aspect of the present invention provides the application of transmembrane transporter in improving the gibberellin production of microorganisms, wherein the transmembrane transporter is selected from at least one protein in the NPF and SWEET protein families. Transporter is a non-permeable biomembrane composed of a lipid bilayer, which can mediate processes such as the generation of electrochemical potential, the generation of energy, metabolism, and signal transduction. The NPF transporter present in Arabidopsis belongs to the Peptide Transporter (PTR) family. The co-existing SWEET protein was initially considered to be a new type of sugar transporter, which helps the transmembrane transport of sugars such as glucose, fructose, and sucrose.

[0008] Specifically, the microorganism includes Fusarium fujikuroi. The industrial production of gibberellins mainly depends on the liquid fermentation of Fusarium fujikuroi. In addition, some species belonging to the genus Fusarium, such as Fusarium moniliforme, and species of Aspergillus, such as Aspergillus niger, have also been confirmed to have the potential for industrial synthesis of gibberellins. Stable and high-yield strains are crucial for industrial production.

[0009] Specifically, the gibberellin includes at least one of GA4 and GA7. Figure 1 In Gibberellosis fujikura, the synthesis site of GA3, GA4, and GA7 is located in the cytoplasm. Its biosynthesis starts from acetyl-coenzyme A (Acetyl-CoA) synthesized by the TCA cycle, and synthesizes isopentenyl pyrophosphate (IPP) and its isomer dimethylallyl diphosphate (DMAPP) through the mevalonate pathway. Subsequently, the precursor dimethyl pyrophosphate (GGDP) is synthesized by synthase via pyrophosphate (GDP) and farnesyl pyrophosphate (FPP). Under the action of the gibberellin synthesis gene cluster, two molecules of GGDP are cyclized to synthesize copapyrophosphate (CDP), and then kaurene is produced. Kaurenoic acid is gradually oxidized by P450 monooxygenase at C-19, and GA12-semialdehyde is subsequently produced by oxidation at C-7α and C-6β. P450 monooxygenase produces GA at C-3β and C-7. 14 , G.A. 14 It is converted into GA4 through oxidation, GA7 is produced through desaturation, and GA3 is converted through hydroxylation.

[0010] Preferably, the transmembrane transport protein NPF is selected from at least one of NPF1.2, NPF2.5, NPF5.5 and NPF8.1; more preferably NPF8.1;

[0011] The amino acid sequence of NPF1.2 is shown in SEQ ID NO.1,

[0012] The amino acid sequence of NPF2.5 is shown in SEQ ID NO.2,

[0013] The amino acid sequence of NPF5.5 is shown in SEQ ID NO.3,

[0014] The amino acid sequence of NPF8.1 is shown in SEQ ID NO.4.

[0015] Preferably, the transmembrane transporter protein SWEET is selected from at least one of SWEET1 and SWEET5; more preferably SWEET1;

[0016] The amino acid sequence of SWEET1 is shown in SEQ ID NO.5,

[0017] The SWEET5 amino acid sequence is shown in SEQ ID NO.6.

[0018] Specifically, the application is to heterologously express the transmembrane transport protein in Fusarium fujikura by constructing an expression plasmid.

[0019] The second aspect of the present invention provides an engineered Gibberella fujikuraensis with high production of gibberellins GA4 and GA7, which is obtained by the following method: constructing a transmembrane transport protein NPF or SWEET gene fragment into an expression plasmid and transforming it into Gibberella fujikuraensis.

[0020] The third aspect of the present invention provides a method for increasing the gibberellin production of microorganisms by using transmembrane transport proteins NPF and SWEET, comprising the following steps:

[0021] The transmembrane transporter NPF or SWEET gene fragment was constructed into an expression plasmid;

[0022] The expression plasmid is transformed into the protoplasts of Gibberella fujikura to obtain transformants;

[0023] The transformant seed solution was prepared, and the seed solution was inoculated into the fermentation medium for culture to prepare GA4 and GA7.

[0024] Specifically, the gene fragment of the transmembrane transporter NPF or SWEET is reverse transcribed from Arabidopsis RNA.

[0025] Preferably, the method comprises the following steps:

[0026] (1) Arabidopsis RNA was extracted, reverse transcribed to obtain the corresponding cDNA, and PCR was performed using the cDNA as a template to obtain the transmembrane transport protein NPF or SWEET gene fragment; after linearizing the vector plasmid pUC-fFuCas9-HTBNLS-hph, the target transport protein NPF or SWEET gene fragment was connected to the vector by one-step cloning to construct an expression plasmid;

[0027] (2) using wild-type Gibberella fujikurai as the starting strain, collecting the bacterial solution and hydrolyzing it to prepare a protoplast suspension; transforming the expression plasmid constructed in step (1) into the protoplasts to obtain transformants;

[0028] (3) Spread the transformant obtained in step (2) on a MYG agar plate containing hygromycin, culture at 28° C. for 3 to 5 days, select a single colony and inoculate it into a seed culture medium, culture it at 28° C. and 250 rpm for 48 hours to obtain a seed solution; inoculate the seed solution into a fermentation medium, culture it at 28° C. and 250 rpm for 7 days, collect the supernatant of the bacterial solution, and determine the yield of GA4 and GA7 after dilution.

[0029] Preferably, the MYG medium is composed of: 4-6 g / L maltose, 4-6 g / L yeast extract, 8-12 g / L glucose, 168-173 g / L sucrose, 19-21 g / L agar, and the solvent is water.

[0030] Preferably, the seed culture medium is composed of: 18-22 g / L corn starch, 14-16 g / L sucrose, 14-16 g / L peanut powder, 2-4 g / L soybean meal, 0.8-1.2 g / L KH2PO4, 0.8-1.2 g / L MgSO4, and the solvent is water.

[0031] Preferably, the fermentation medium is composed of: 60-90 g / L corn starch, 70-100 g / L rice flour, 3-7 g / L soybean meal, 3-7 g / L peanut powder, 0.3-0.7 g / L KH2PO4, 0.3-0.7 g / L K2SO4, 0.3-0.7 g / L MgSO 4` 7H2O 0.10~0.12g / L, the solvent is water.

[0032] Beneficial effects of the present invention: The present invention is based on heterologous expression of Arabidopsis transporter in Gibberella fujikura, and screens multiple NPF and SWEET family transporters based on the property of transporter capable of transporting gibberellins. The experiment found that heterologous expression of NPF in wild-type Gibberella fujikura reduced GA3 production by 20-80%, and GA 4+7 The yield increased by 30-120%. When SWEET was heterologously expressed in wild-type Gibberella fujikura, GA3 production decreased by 20-100%. 4+7 The yield is increased by 40-500%. The present invention provides a new idea for increasing the yield of gibberellins, and effectively increases the yield of GA by using heterologous overexpression of transmembrane transport proteins NPF or SWEET. 4+7 The yield has been increased, and more efficient, stable, safer gibberellins with higher economic value have been obtained, which has a positive effect on promoting its industrial production. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 It is the biosynthetic pathway of gibberellins GA3, GA4 and GA7.

[0034] Figure 2 The cDNA verification gel images of Examples 1 to 6 are NPF1.2, NPF2.5, NPF5.5, NPF8.1, SWEET1, and SWEET5.

[0035] Figure 3 pUC-fFuCas9-HTB in Example 1 NLS -Schematic diagram of the construction of hph-NPF8.1 expression plasmid.

[0036] Figure 4 This is a comparison of the microscope images of Gibberella fujikura before and after the protoplast preparation in Example 1.

[0037] Figure 5 The yields of GA3, GA4 and GA7 were determined by high performance liquid chromatography in Examples 1 to 6. DETAILED DESCRIPTION

[0038] The following is an explanation of the embodiments of the present invention by specific specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied by other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that, in the absence of conflict, the features in the following embodiments and embodiments can be combined with each other. In the embodiments of the present invention, the methods used are all conventional methods unless otherwise specified, and the reagents used can be obtained from commercial sources.

[0039] Embodiment 1:

[0040] This embodiment provides the application of transmembrane transport protein NPF8.1 in increasing the gibberellin production of microorganisms.

[0041] This embodiment also provides an engineered strain of Gibberella fujikuraensis that produces high levels of gibberellins GA4 and GA7.

[0042] This embodiment also provides a method for increasing the production of gibberellins in microorganisms by using the transmembrane transport protein NPF8.1. The specific experimental process is as follows:

[0043]

Constructing the transmembrane transporter NPF8.1 gene fragment into an expression plasmid

[0044] Take fresh Arabidopsis thaliana plant root, stem, young leaf, bud and other tissue samples, immediately put them into liquid nitrogen for freezing, use a grinding pestle to fully grind the tissue, extract total RNA from the treated tissue according to the instructions of the Novagen RC101-01 kit, determine the concentration of the extracted RNA, and perform a reverse transcription experiment on the RNA sample according to the instructions of the Novagen R223-01 kit. Run a nucleic acid gel to verify the reverse transcription product, and the cDNA fragment of the target transport protein NPF8.1 can be obtained ( Figure 2 ), the reverse transcription sample can be frozen at -80°C for long-term storage. The cDNA fragment of NPF8.1 is amplified using the upstream and downstream primers F4 and R4 to obtain the gene fragment of NPF8.1. The amino acid sequence of NPF8.1 is shown in SEQ ID NO.4. The vector plasmid used is pUC-fFuCas9-HTB NLS -hph, design primers F7 and R7 to linearize the plasmid. One-step cloning: Connect the previously obtained NPF8.1 gene fragment to the linearized vector to obtain the expression plasmid pUC-fFuCas9-HTB NLS -hph-NPF8.1( Figure 3 ).

[0045] [Transform the expression plasmid into the protoplasts of Gibberella fujikura to obtain transformants]

[0046] Preparation of protoplasts:

[0047] The wild-type Fuzangura Gibberella strain was inoculated from the plate into liquid YEPD medium (YEPD: yeast powder 3g / L, peptone 10g / L, glucose 20g / L), and cultured at 28℃ and 250rpm for 2 days. Prepare 10mL of cell wall enzyme solution according to the formula of Snailase 5g / L, Driselase 5g / L, and Yatalase 10g / L, and pass the membrane for use. Pour the YEPD bacterial solution into a Buchner funnel with filter paper in the ultra-clean workbench, filter to dryness, rinse the bacteria with 0.8M NaCl solution twice, and filter again to dryness. Scrape about 1g of bacteria into a 50mL centrifuge tube, add the pre-prepared enzyme solution, and place it in a shaker at 30℃ and 180rpm for enzymatic hydrolysis for 4 hours, and shake it evenly every half an hour. Filter the completely enzymatically hydrolyzed bacterial solution with a double-layer magic filter cloth into a sterilized 50mL centrifuge tube to remove the remaining bacteria and insoluble matter, centrifuge at 900×g, 4℃ for 10min, and discard the supernatant; in this step and subsequent operations, the solution must be placed on ice. Add 10mL of 0.8M sodium chloride solution, resuspend on ice, centrifuge at 900×g, 4℃ for 10min, and discard the supernatant; repeat this step twice. Add 10mL of STC solution (STC solution: use an electronic balance to weigh 45.54g of sorbitol, 0.303g of Tris-base, and 1.378g of CaCl2 and dissolve in 250mL of ultrapure water, and adjust the pH to 7.5 with 1M HCl), resuspend on ice, centrifuge at 900×g, 4℃ for 10min, and discard the supernatant; repeat this step twice. Add 2mL of STC solution, resuspend on ice and dilute to 10 7 / mL, microscopic examination ( Figure 4 ) and placed in a 4℃ refrigerator for later use.

[0048] Transformation of protoplasts:

[0049] Transformation group: 150 μL protoplast resuspension, 90 μL expression plasmid, 60 μL 60% PEG6000 solution were taken in a 2 mL centrifuge tube and mixed evenly to obtain 10 μg of plasmid; control group: 150 μL protoplast resuspension, 90 μL STC solution and 60 μL 60% PEG6000 solution were taken in a 2 mL centrifuge tube and mixed evenly. The 2 mL centrifuge tubes mixed evenly were placed on ice, and mixed evenly by inverting every 10 minutes, and repeated 3 times. 1.5 mL 60% PEG6000 solution was added, and the mixture was mixed evenly by pipetting, and then allowed to stand at room temperature for 25 minutes. In a 50mL centrifuge tube, add 6mL of soft agar MYG liquid culture medium containing 100ng / μL hygromycin resistance (MYG: 5g / L maltose, 5g / L yeast extract, 10g / L glucose, 171g / L sucrose, 20g / L agar, and the solvent is water), 3mL of preheated STC solution and a transformation system, shake to mix, and then pour the plate onto MYG hard agar culture medium with the same hygromycin concentration; transfer the above plate to a 28°C incubator and culture it upright for 5 days to obtain an engineered Fujikura Gibberella bacteria with high production of gibberellins GA4 and GA7.

[0050] Gibberellin metabolism

[0051] After the transformants of the engineered bacteria of Fujikura Gibberella with high production of gibberellins GA4 and GA7 were cultured on MYG hard agar medium for 5 days, the transformants were picked up with a toothpick and cultured in a seed medium. After culturing at 250rpm for 2 days, they were transferred to a fermentation medium with an inoculation amount of 6%. After 7 days of conditional culture at 28°C and 250rpm, the supernatant of the bacterial liquid was collected, diluted, and the production of GA3, GA4 and GA7 was determined by high performance liquid chromatography. The results are shown in Table 1 and Figure 5 .

[0052] The culture media used in the experiment include:

[0053] Seed culture medium: corn starch 20g / L, sucrose 15g / L, peanut powder 15g / L, soybean meal 3g / L, KH2PO41 g / L, MgSO41 g / L, the solvent is water.

[0054] Fermentation medium: corn starch 75g / L, rice flour 87.5g / L, soybean meal 5g / L, peanut powder 5g / L, KH2PO4 0.5g / L, K2SO4 0.5g / L, MgSO4·7H2O 0.11g / L, solvent is water.

[0055] Embodiment 2~6:

[0056] Compared with Example 1, Examples 2 to 6 respectively use NPF1.2, NPF2.5, NPF5.5, SWEET1, and SWEET5 gene fragments to replace NPF8.1, and the remaining operating steps are the same. The obtained transformants of the engineered bacteria of Fujikura gibberellin with high production of gibberellins GA4 and GA7 are fermented and cultured under the same conditions, and the supernatant of the bacterial liquid is collected, diluted, and the production of GA3, GA4, and GA7 is determined by high performance liquid chromatography. The results are shown in Table 1 and Figure 5 .

[0057] Examples 1 to 6 use the following primers:

[0058] NPF1.2 upstream and downstream primers F1, R1:

[0059] F1: ATGGAGAACCCTCCCAATGAAAC

[0060] R1: AAGATCTAAGTCCAGTTGTTAAAACCAATTAA

[0061] NPF2.5 upstream and downstream primers F2, R2:

[0062] F2: ATGGCTGATTCAAAATCTGGTGACACGG

[0063] R2: CAAGATCCTAAAGATGTTAAAACCTAG

[0064] NPF5.5 upstream and downstream primers F3, R3:

[0065] F3:ATGGCGTCTTTTCTCCGAGTCATCGTTC

[0066] R3: CTACACAGAAGCGATTATCCTTCGATC

[0067] NPF8.1 upstream and downstream primers F4, R4:

[0068] F4:ATGGAAGAAAAAGATGTGTATACGCA

[0069] R4:TCAATGTGCTCGACCAACAGCTT

[0070] SWEET1 upstream and downstream primers F5, R5:

[0071] F5: ATGAACATCGCTCACACTATC

[0072] R5: AACTTGAAGGTCTTGCTTTCCATT

[0073] SWEET5 upstream and downstream primers F6, R6:

[0074] F6:ATGACGGACCCCCACACCGCCCGGACGATCGTCG

[0075] R6: TGGAATCGAACTTGGCCAGGCTGA

[0076] Linearized primers F7, R7:

[0077] F7: GCAAGAGGGCAGGATCCAAT

[0078] R7: GGTGATGTCTGCTCAAGCGG

[0079] Comparative Example 1:

[0080] Wild-type Gibberella fujikura was fermented and cultured under the same conditions as in Example 1, and the supernatant of the bacterial solution was collected and diluted, and the production of GA3, GA4 and GA7 was determined by high performance liquid chromatography. The results are shown in Table 1 and Figure 5 .

[0081] Comparative Examples 2-3:

[0082] Compared with Example 1, Examples 2-3 respectively use NPF 4.1 and SWEET 10 gene fragments to replace NPF8.1, and the other operating steps are the same. The obtained transformants are fermented and cultured under the same conditions, and the supernatant of the bacterial solution is collected, diluted, and the yields of GA3, GA4 and GA7 are determined by high performance liquid chromatography. The results are shown in Table 1. Among them, the amino acid sequence of NPF 4.1 is shown in SEQ ID NO.7, and the amino acid sequence of SWEET 10 is shown in SEQ ID NO.8.

[0083] Comparative Examples 2 to 3 use the following primers:

[0084] NPF 4.1 upstream and downstream primers F8, R8:

[0085] F1:ATGCAGATCGAGATGGAGGAGAA

[0086] R1:TTAGTAGCGCTTGGCCCAGAAGA

[0087] SWEET 10 upstream and downstream primers F9, R9:

[0088] F2: ATGGCTATCAGCCAGGCCGTC

[0089] R2:TTAGTTCTTAGAGATGAGGAAGACCT

[0090] The experiment found that compared with comparative examples 1 to 3, transmembrane transport proteins NPF1.2, NPF2.5, NPF5.5, NPF8.1, SWEET1, and SWEET5 can effectively transport gibberellins GA4 and GA7, increasing GA 4+7 Among them, heterologous expression of NPF in wild-type Fuzura Gibberella resulted in a 20-80% decrease in GA3 production and a 20-80% decrease in GA 4+7 The yield increased by 30-120%. When SWEET was heterologously expressed in wild-type Gibberella fujikura, GA3 production decreased by 20-100%. 4+7 The yield was increased by 40-500%. Combined with Table 1, the transmembrane transporter SWEET1 in Example 5 accurately and efficiently transported GA7 with greater economic value before converting GA3, avoiding the production of GA3, making product separation simple and convenient, achieving the purpose of reducing costs and increasing efficiency, and having a positive role in promoting the industrial production of GA7.

[0091] Table 1. Gibberellic acid metabolism

[0092]

[0093] The embodiments described above are merely descriptions of preferred implementations of the present invention and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope of the present invention.

Claims

1. The application of transmembrane transporter in increasing the gibberellin production of microorganisms is characterized in that: The transmembrane transporter is selected from at least one protein in the NPF and SWEET protein families.

2. The use according to claim 1, characterized in that: The microorganisms include Gibberella fujikura.

3. The use according to claim 1, characterized in that: The gibberellin includes at least one of GA4 and GA7.

4. The use according to claim 1, characterized in that: The transmembrane transporter protein NPF is selected from at least one of NPF1.2, NPF2.5, NPF5.5, and NPF8.1; The amino acid sequence of NPF1.2 is shown in SEQ ID NO.1, The amino acid sequence of NPF2.5 is shown in SEQ ID NO.2, The amino acid sequence of NPF5.5 is shown in SEQ ID NO.3, The amino acid sequence of NPF8.1 is shown in SEQ ID NO.

4.

5. The use according to claim 1, characterized in that: The transmembrane transporter protein SWEET is selected from at least one of SWEET1 and SWEET5; The amino acid sequence of SWEET1 is shown in SEQ ID NO.5, The SWEET5 amino acid sequence is shown in SEQ ID NO.

6.

6. The use according to any one of claims 1 to 5, characterized in that: The application comprises: heterologously expressing the transmembrane transport protein in Fusarium fujikura by constructing an expression plasmid.

7. An engineered strain of Gibberellin fujikura for high production of gibberellins GA4 and GA7, characterized in that: The obtained construct is obtained by the following method: constructing the transmembrane transport protein NPF or SWEET gene fragment into an expression plasmid and transforming it into Gibberella fujikura.

8. A method for increasing the gibberellin production of microorganisms by using transmembrane transport proteins NPF and SWEET, characterized in that: The method comprises the following steps: constructing a transmembrane transport protein NPF or SWEET gene fragment into an expression plasmid; transforming the expression plasmid into a protoplast of Fusarium fujikura to obtain a transformant; preparing a transformant seed liquid, inoculating the seed liquid into a fermentation medium for culture, and preparing GA4 and GA7.

9. The method according to claim 8, characterized in that The transmembrane transporter NPF or SWEET gene fragment is reverse transcribed from Arabidopsis RNA.

10. The method according to claim 8, characterized in that The fermentation medium is composed of 60-90 g / L corn starch, 70-100 g / L rice flour, 3-7 g / L soybean meal, 3-7 g / L peanut powder, 0.3-0.7 g / L KH2PO4, 0.3-0.7 g / L K2SO4, 0.3-0.7 g / L MgSO 4` 7H2O 0.10~0.12g / L, the solvent is water.

Images