Application of MAFG in preparation of CAR-NK cells
By overexpressing the MAFG gene or its protein in CAR-NK cells, MAFG-CAR NK cells were prepared, which solved the problem of exhaustion and difficulty in infiltration of immune cells into the tumor in existing CAR-NK cell therapy, and achieved stronger The proliferation and lethality ability significantly improves the anti-tumor efficacy.
Patent Information
- Application Number
- CN202411708892.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-26
- Publication Date
- 2025-02-21
AI Technical Summary
In existing CAR-NK cell therapy, the modified immune cells are easily depleted and difficult to survive and infiltrate into the tumor for a long time, affecting the therapeutic effect.
MAFG-CAR NK cells were prepared by overexpressing the MAFG gene or its protein on the plasmid for preparing CAR-NK cells and infecting NK cells through lentiviral transduction.
MAFG-CAR NK cells show stronger proliferation, durability and killing ability in vitro and in vivo, which can better infiltrate the tumor, prolong survival time, and significantly improve anti-tumor efficacy.
Smart Images
Figure HDA0005156177710000011 
Figure HDA0005156177710000012 
Figure HDA0005156177710000021
Abstract
Description
Technical Field
[0001] The present disclosure relates to the field of tumor prevention and treatment, and in particular, to the use of MAFG in the preparation of CAR-NK cells. Background Art
[0002] Immune cell therapy is a type of immunotherapy that injects immune cells into patients to treat cancer. The main types include chimeric antigen receptor T cell (CAR-T) therapy, engineered T cell receptor (TCR-engineered T cell, TCR-T) therapy, tumor infiltrating lymphocyte (TIL) therapy and chimeric antigen receptor NK cell (CAR-NK) therapy.
[0003] CAR-NK cell therapy refers to modifying NK cells with chimeric antigen receptor (CAR) genes, giving NK cells the ability to target and recognize tumor cells, and then injecting them into the human body after in vitro expansion to achieve the effect of tumor treatment. Due to the lack of MHC restriction and immune characteristics, CAR-NK is expected to achieve allogeneic adoption, greatly shortening the treatment cycle and price, and has more advantages in fighting solid tumors.
[0004] At present, although various therapies including CAR-NK have shown excellent therapeutic prospects, the immune cells used for modification are mostly terminally differentiated NK cells, which are prone to exhaustion, disability and aging, and are difficult to survive in the body for a long time, resulting in the prepared immune cells being in a terminal exhaustion state, which greatly affects the clinical effect of adoptive cell therapy products. In addition, limited by the complex microenvironment of solid tumors, it is difficult for modified immunotherapy cells to infiltrate into the tumor. Even if a small number of cells infiltrate into the tumor, the immunosuppressive environment inside the tumor will induce the modified immunotherapy cells to enter an exhaustion state and fail to exert anti-tumor effects.
[0005] MAFG protein belongs to the small Maf protein of the Maf family. It is a type of transcription factor containing a basic domain and a basic leucine zipper (b-ZIP). It is abundantly expressed in embryonic cells and stem cells.
[0006] Currently, there are no reports on the use of MAFG in CAR-NK cell therapy. Summary of the invention
[0007] In order to enhance the efficacy of existing CAR-NK cell therapy in tumor killing and infiltration, the present disclosure is proposed.
[0008] The inventors found that MAFG is involved in stem-like memory T cells (T SCM ) and acts as a transcription factor to activate the expression of stemness-related genes TCF7, SOX2, and NANOG. Compared with other known memory cells, T cells that highly express MAFG SCM The cells have a higher proliferation capacity and can be maintained in the body for a long time. Under the stimulation of antigens, they can quickly produce a large number of cytokines and exert stronger anti-tumor and anti-inflammatory immune functions.
[0009] The present invention discloses that MAFG-CAR NK is prepared by overexpressing the MAFG gene (and / or its protein) on the corresponding plasmid for preparing CAR-NK, and infecting NK cells by lentiviral transduction. CAR-NK cells overexpressing the MAFG gene (and / or its protein) have stronger proliferation ability, show stronger persistence and killing ability both in vivo and in vitro, and have more tumor infiltration and longer survival time.
[0010] In a first aspect, some embodiments of the present disclosure relate to the use of the MAFG gene or its encoded protein in the preparation of CAR-NK cells, wherein:
[0011] The nucleotide sequence of the MAFG gene is SEQ ID NO: 1 shows: atgacgacccccaataaaggaaacaaggccttgaaggtgaagcggggagccgggtgagaatggcaccagcctgacggatgaggagctggtgaccatgtcggtgcggggagctgaaccag cacctgcggggcctgtccaaggaggagatcgtccagctgaagcagcgccggcgcacgctcaagaaccgcggctacgctgccagctgccgcgtgaagcgggtgacgcagaaggaggagctggaga agcagaaggcggagctgcagcaggaggtggagaagctggcctcagagaacgccagcatgaagctggagctcgacgcgctgcgctccaagtacgaggcgctgcagaccttcgcccggacggtggc ccgcagccccgtggcgccagcccggggcccccttgccgccggcctggggcccctcgtcccaggcaaggtggccgccaccagcgtcatcacaatagtaaagtccaagacggatgcccgatcg(SEQ ID NO:1)
[0012] The amino acid sequence of the encoded protein is shown in SEQ ID NO: 2: MTTPNKGNKALKVKREPGENGTSLTDEELVTMSVRELNQHLRGLSKEEIVQLKQRRRTLKNRGYAASCRVKRVTQKEELEKQKAELQQEVEKLASENASMKLELDALRSKYEALQTFARTVARSPVAPARGPLAAGLGPLVPGKVAATSVITIVKSKTDARS (SEQ ID NO: 2);
[0013] The MAFG gene or its encoded protein is overexpressed in CAR-NK cells.
[0014] According to the context of the present disclosure, when referring to "overexpression of MAFG", it means that the MAFG (nucleic acid and / or protein) level of its cells is statistically significantly increased compared to wild-type NK cells. For example, after exogenous introduction of MAFG gene or protein, the expression level of MAFG protein in NK cells is 1.2, 1.3, 1.4, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 100 times, or higher than the expression level of MAFG protein in NK cells without exogenous introduction of MAFG gene or protein.
[0015] In some embodiments, the NK cells are selected from: NK cells isolated from peripheral blood, NK cells derived from umbilical cord blood, NK cells derived from iPSC, NK cells derived from hESC, NK cells derived from HPC, and NK cells derived from NK-92 cell line.
[0016] In some embodiments, use of a MAFG expression vector in preparing CAR-NK cells is provided, wherein the MAFG expression vector is a viral vector into which the MAFG gene shown in SEQ ID NO: 1 is inserted.
[0017] The term "vector" used herein when referring to nucleic acid refers to a nucleic acid molecule that can propagate another nucleic acid connected thereto. The term includes vectors that are self-replicating nucleic acid structures and vectors that are incorporated into the genome of a host cell into which it has been introduced. Some vectors are capable of directing the expression of nucleic acids that are effectively connected thereto. Such vectors are referred to herein as "expression vectors."
[0018] In some embodiments, exemplary viral vectors are selected from: adenovirus, adeno-associated virus, retrovirus, lentivirus, oncolytic virus; preferably lentivirus.
[0019] The term "lentivirus" refers to a genus of the Retroviridae family. The uniqueness of lentiviruses among retroviruses is that they can infect non-dividing cells; they can deliver significant amounts of genetic information to host cells, so they are one of the most efficient methods of gene delivery vectors. HIV, SIV, and FIV are all common examples of lentiviruses. Other examples of lentiviral vectors that can be used clinically, for example, include but are not limited to gene delivery technology from Oxford BioMedica, LENTIMAXTM vector system from Lentigen, etc.
[0020] In some embodiments, a method for preparing a CAR-NK cell is provided, comprising the steps of:
[0021] 1) inserting the MAFG gene shown in SEQ ID NO: 1 into a viral vector to produce a MAFG expression vector,
[0022] 2) using the MAFG expression vector to perform virus packaging to prepare recombinant viruses,
[0023] 3) transfecting the separated NK cells with the recombinant virus to obtain the CAR-NK cells;
[0024] Wherein, the NK cells are selected from the following: NK cells separated from peripheral blood, NK cells derived from umbilical cord blood, NK cells derived from iPSC, NK cells derived from hESC, and NK cells derived from HPC.
[0025] In some embodiments, exemplary viral vectors are selected from: adenovirus, adeno-associated virus, retrovirus, lentivirus, oncolytic virus; preferably lentivirus. .
[0026] As an example of a method for preparing CAR-NK cells, by effectively connecting a nucleic acid encoding a CAR polypeptide to a promoter and incorporating the construct into an expression vector, expression of a nucleic acid encoding a CAR is achieved. The vector may be suitable for replication and integration in eukaryotes. Common vectors contain transcription and translation terminators, initiation sequences, and promoters for regulating the expression of the desired nucleic acid sequence. Numerous virus-based systems have been developed on the market for transferring genes to mammalian cells. For example, retroviruses provide a convenient platform for gene delivery systems. The disclosed nucleic acid construct (such as the MAFG gene shown in SEQ ID NO: 1) can be inserted into a vector and packaged in viral particles using techniques known in the art. The recombinant virus can then be isolated and delivered to the subject's cells in vivo or ex vivo. Numerous retroviral systems are known in the art. In some embodiments, a lentiviral vector is used.
[0027] Lentiviral vectors are suitable tools for achieving long-term gene transfer, as they allow long-term, stable integration of transgenes and their propagation in daughter cells. They also have the additional advantage of low immunogenicity.
[0028] Retroviral vectors can also be used in the methods of the present disclosure, such as γ retroviral vectors. For example, γ retroviral vectors include a promoter, a packaging signal ψ, a primer binding site PBS, one or more long terminal repeat sequences LTR, and a transgene of interest (e.g., a gene encoding a CAR). γ retroviral vectors can lack viral structural genes such as gag, pol, and env.
[0029] As an example, an example of a promoter capable of expressing a CAR transgene in mammalian T cells is the EF1a promoter. The native EF1a promoter drives the expression of the α subunit of the elongation factor-1 complex, which is responsible for enzymatic delivery of aminoacyl tRNA to the ribosome. The EF1a promoter has been widely used in mammalian expression plasmids and has been shown to effectively drive the expression of CAR from a transgene cloned into a lentiviral vector.
[0030] Another example of promoter is the immediate early cytomegalovirus CMV promoter sequence. This promoter sequence is a strong constitutive promoter sequence that can drive any polynucleotide sequence effectively connected thereto to express at a high level. However, other constitutive promoter sequences may also be used, including but not limited to SV40 early promoter, human immunodeficiency virus HIV long terminal repeat sequence LTR promoter, MoMuLV promoter, avian leukemia virus promoter, Epstein-Barr virus immediate early promoter, Rous sarcoma virus promoter, actin promoter, myosin promoter, hemoglobin promoter, creatine kinase promoter.
[0031] In another aspect, the present disclosure relates to a CAR-NK cell, wherein:
[0032] The CAR-NK cells overexpress the MAFG gene or its encoded protein;
[0033] The nucleotide sequence of the MAFG gene is shown in SEQ ID NO: 1,
[0034] The amino acid sequence of the encoded protein is shown in SEQ ID NO: 2.
[0035] In some embodiments, the CAR-NK cells of the present disclosure have one or more of the following characteristics:
[0036] 1) Enhanced in vitro proliferation capacity;
[0037] 2) Enhanced in vitro tumor cell killing ability;
[0038] 3) Enhanced in vitro cytokine release capacity;
[0039] 4) Enhanced tumor invasion ability in vivo;
[0040] 5) Enhanced anti-tumor ability in vivo.
[0041] In some embodiments, the CAR-NK cells of the present disclosure further express or comprise a chimeric antigen receptor comprising:
[0042] Specific scFv targeting Her2,
[0043] Human CD8 signal peptide,
[0044] Human CD8 hinge and transmembrane domains,
[0045] NKG2D co-stimulatory domain, and
[0046] CD3ζ intracellular domain.
[0047] There is no sequence limitation for the specific scFv targeting Her2, and any commercially available or published scFc specific for Her2 is applicable to the present disclosure.
[0048] In another aspect, the present disclosure relates to a kit comprising the CAR-NK cells of the present disclosure.
[0049] In another aspect, the present disclosure relates to the use of the aforementioned CAR-NK cells in the preparation of a medicament or a kit for treating cancer in a subject.
[0050] In a specific embodiment, the NK cells of the present disclosure comprise a CAR targeting HER2. Thus, the NK cells of the present disclosure can be used to treat HER2-related tumors.
[0051] In some embodiments, the cancer is selected from the group consisting of gastric cancer, lung cancer, colon cancer, rectal cancer, hematological tumors, prostate cancer, liver cancer, gallbladder cancer, kidney cancer, head and neck cancer, ovarian cancer, and breast cancer.
[0052] In specific embodiments, the cancer is colon cancer.
[0053] In some embodiments, the subject is a human or a non-human mammal, preferably the subject is a human.
[0054] In this article, the terms "individual" or "subject" or "patient" are used interchangeably, including mammals. Mammals include, but are not limited to, cattle, sheep, cats, dogs, horses, primates (e.g., humans and non-human primates such as monkeys), rodents (e.g., rabbits, mice and rats). In particular, the individual or subject is a human.
[0055] The terms "tumor" and "cancer" are used interchangeably herein. The term "anti-tumor" or "cancer treatment" refers to a biological effect that can be presented in various ways, including but not limited to, for example, a reduction in tumor volume, a reduction in the number of cancer cells, a reduction in the number of metastases, an increase in the expected life span of a tumor-bearing individual, a reduction in cancer cell proliferation, a reduction in cancer cell survival, or an improvement in various physiological symptoms associated with cancerous conditions. In some embodiments, the CAR NK cells of the present disclosure are administered in patient treatment to provide an anti-tumor / anti-cancer therapeutic effect.
[0056] After a large number of experimental studies, the inventors found that compared with Con-CAR NK cells, the modified CAR-NK cells prepared by overexpressing MAFG protein have stronger expansion and killing abilities in in vitro experiments. In addition, in vivo studies have shown that CAR-NK cells prepared by overexpressing this gene have stronger tumor infiltration ability and more durable survival ability, thereby showing better anti-tumor effects. The CAR-NK cells and preparation methods disclosed herein can significantly increase the tumor treatment efficacy of CAR-NK cell therapy products, and have broad medical treatment prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0057] Figure 1A and Figure 1B Schematic diagrams of the plasmid vector used to construct CAR-NK cells overexpressing the MAFG gene and the overexpression effect are shown respectively.
[0058] Figure 2 It showed that overexpression of the MAFG gene could significantly enhance the proliferation ability of CAR-NK cells.
[0059] Figure 3 It was shown that overexpression of the MAFG gene could make CAR-NK cells have stronger tumor cell killing ability in in vitro experiments.
[0060] Figure 4 It was shown that overexpression of the MAFG gene could make CAR-NK cells have stronger cytokine release ability in in vitro experiments.
[0061] Figure 5A and Figure 5B The results showed that CAR-NK cells prepared by overexpressing the MAFG gene had stronger infiltration ability and cytokine release ability in in vivo experiments.
[0062] Fig. 6A and Figure 6B It was shown that CAR-NK cells prepared by overexpressing the MAFG gene had stronger anti-tumor ability in in vivo experiments. DETAILED DESCRIPTION
[0063] In order to make the purpose, technical solution and advantages of the present disclosure more clear, the present disclosure is further described in detail below in conjunction with specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present disclosure and are not used to limit the present disclosure.
[0064] Various cell lines and animals used in the examples:
[0065] Human peripheral blood was obtained from volunteers; human colorectal cancer cell line HCT116 was purchased from the Cell Resource Center of the Institute of Basic Medicine, Chinese Academy of Medical Sciences; and immunodeficient NSG mice were purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd.
[0066] Unless otherwise specified, the raw materials and reagents used in the present disclosure are commercially available.
[0067] Example 1: Successful overexpression of MAFG gene in CAR-NK cells
[0068] 1. Experimental Procedure
[0069] 1.1 Using molecular cloning technology, construct a MAFG-CAR NK plasmid that overexpresses the MAFG gene (SEQ ID NO: 1), and prepare the corresponding lentivirus. Specifically, the preparation of the lentivirus expressing CAR is as follows.
[0070] The lentiviral plasmids used in this experiment are:
[0071] Con-CAR NK plasmid overexpressing human Her2 and MAFG-CAR NK plasmid overexpressing MAFG based on this. The lentiviral packaging plasmids used in this experiment are pSPAX2 and PMD2G.
[0072] Taking Con-CAR plasmid as an example, specifically, the plasmid is generated by fusing the human Her2 gene fragment into a lentiviral backbone plasmid containing an EF1a promoter. The plasmid consists of an antigen (Her2) specific scFv, a human CD8 signal peptide, a human CD8 hinge and transmembrane domain, a NKG2D costimulatory domain, and a CD3ζ intracellular domain.
[0073] Taking MAFG-CAR NK plasmid as an example, specifically, the plasmid is prepared by overexpressing the human MAFG gene fragment based on the Con-CAR plasmid and connecting it with T2A. The specific preparation steps of the lentivirus are as follows:
[0074] 1) Culture medium preparation
[0075] 293T cell complete culture medium: DMEM basal culture medium + 10% FBS + 33×Glutamax + 100× double antibody;
[0076] Virus packaging medium (prepared and used immediately): 293T cell complete medium + 500× sodium butyrate.
[0077] 2) Plasmid transfection
[0078] 293T cells were plated in a culture dish in advance, and plasmid transfection was performed when the cells grew to a density of 80-90%.
[0079] Preparation of transfection system for 10 cm culture dish: Add 250 μl of Jet buffer to each of two 1.5 ml EP tubes, gently add 40 μl of Jet liposomes to one tube and gently mix, add target plasmid: PSPAX2:PMD2G=10 μg:7 μg:3 μg to the other tube and mix.
[0080] 3) Virus Concentration
[0081] Pretreatment of virus centrifugal column (30 kD, Merck): add 6 ml PBS to rinse the column, centrifuge at 5000 g for 5-7 min, and discard the liquid.
[0082] After 48 hours of changing the medium of the transfected 293T cells, collect the supernatant of the 10 cm dish into a 50 ml centrifuge tube, centrifuge at 1000 g for 5 min, and use a 20 ml syringe to draw the supernatant after centrifugation and filter through a 0.45 μm filter membrane. Add 15 ml of the filtrate containing the virus after filtration to the pretreated virus concentration column, centrifuge at 5000 g for 25 min at 4 ° C, collect the virus concentrate on the concentration column and store it at -80 ° C. The titer of the concentrated virus is greater than 5×10 7 TU / ml, usually 1×10 8 TU / ml-5×10 8 TU / ml.
[0083] 1.2 Isolate and collect NK cells from peripheral blood;
[0084] 1.3 NK cells were cultured at an initial density of 1×10 6 100 μl / well of Con-CAR NK concentrated virus or MAFG-CAR NK concentrated virus without overexpressing MAFG was added to each well, centrifuged at 1200 g for 2 hours, and cultured in a 24-well plate to prepare Con-CAR NK cells and MAFG-CAR NK cells overexpressing MAFG protein.
[0085] 1.4 Three days after virus infection, Con-CAR NK cells and MAFG-CAR NK cells were collected, and the mRNA expression level of the MAFG gene was detected by qPCR.
[0086] 2. Experimental results
[0087] Figure 1A The schematic diagram of the CAR-NK plasmid overexpressing MAFG is shown; qPCR results showed that MAFG protein was successfully overexpressed in MAFG-CAR NK (p<0.0001) ( Figure 1B ).
[0088] Example 2: CAR-NK cells prepared by overexpressing the MAFG gene have stronger proliferation ability.
[0089] 1. Experimental Procedure
[0090] After 3 days of in vitro culture, the MAFG gene-overexpressing CAR-NK cells and the control Con-CAR NK cells were collected, and the total number of Con-CAR NK cells and MAFG-CAR NK cells was counted under a microscope using a cell counting plate.
[0091] 2. Experimental results
[0092] Overexpression of MAFG can significantly increase the proliferation rate of CAR-NK cells: Con-CAR NK cells increased from the initial 5×10 6 amplified to 1.83×10 7 The number of NK cells overexpressing MAFG-CAR increased to 3.53×10 7 significantly more than the control group (p<0.001) ( Figure 2 ).
[0093] Example 3: CAR-NK cells prepared by overexpressing the MAFG gene have stronger tumor cell killing ability in in vitro experiments.
[0094] 1. Experimental Procedure
[0095] One day in advance, HCT116 cells were cultured at 5 × 10 4 The cells were plated in 24-well plates, and the MAFG-CAR NK cells overexpressing MAFG gene and the Con-CAR NK cells not overexpressing MAFG (both Her2 + Cells), flow cytometry sorting of HER2 + NK cells were co-cultured with tumor cells at a 1:1 effector-target ratio. Two days later, the tumor cell lysis rate was detected and the suspended cells in the supernatant were collected by centrifugation. + The NK cells were co-cultured with tumor cells at the same effector-target ratio for two days to perform the second round of killing. This process was repeated for a total of 7 rounds of killing. The killing efficiency of CAR-NK cells on tumor cells was tested in each round.
[0096] 2. Experimental results
[0097] The results showed that the killing efficiency of MAFG-CAR NK cells prepared by overexpressing the MAFG gene against tumor cells in the first to seventh rounds was significantly higher than that of Con-CAR NK cells that did not overexpress MAFG, showing a stronger killing ability ( Figure 3 ).
[0098] Example 4: CAR-NK cells prepared by overexpressing the MAFG gene have stronger cytokine release ability in in vitro experiments.
[0099] 1. Experimental Procedure
[0100] One day in advance, HCT116 cells were cultured at 5 × 10 4 The cells were plated in 24-well plates, and the MAFG-CAR NK cells overexpressing MAFG gene and the Con-CAR NK cells not overexpressing MAFG (both Her2 +NK cells) were co-cultured with tumor cells at a 1:1 effector-target ratio. Two days later, the suspended cells in the supernatant were collected by centrifugation. CAR + NK cells were co-cultured with tumor cells at the same effector-target ratio for two days for the second round of killing. The supernatant of the cells after the second round of killing and co-incubation was collected by centrifugation, stained with antibodies such as IFN-F, TNF-α, and IL-2 for 30 minutes, and data were collected using Invitrogen Attune NxT software. FlowJo software was used to analyze the data and detect the level of cytokine release in the co-culture.
[0101] 2. Experimental results
[0102] Flow cytometry analysis of the cytokine release levels of Con-CAR NK and MAFG-CAR NK cells co-cultured with tumor cells revealed that the production of IFN-γ, TNF--, and IL-2 by MAFG-CAR NK cells was increased (p<0.01)( Figure 4 ).
[0103] Example 5: CAR-NK cells prepared by overexpressing the MAFG gene have stronger tumor infiltration and cytokine release abilities in in vivo experiments
[0104] 1. Experimental Procedure
[0105] 1×10 6 HCT116 cells were inoculated into NSG mice. When the tumor grew to about 5×5 mm in size, 1×10 6 MAFG-CAR NK cells overexpressing MAFG gene and Con-CAR NK cells without overexpressing MAFG (both Her2 + The number of CAR-NK cells infiltrating into the tumor and the level of IFN-γ released by the infiltrating CAR-NK cells were detected on days 2, 7, and 14, respectively, to evaluate the infiltration ability of CAR-NK cells in each group on solid tumors and the level of cytokine release in vivo.
[0106] 2. Experimental results
[0107] Flow cytometry analysis results showed that MAFG-CAR NK cells prepared by overexpressing the MAFG gene could more easily infiltrate into tumor tissues ( Figure 5A ) and had a higher IFN-γ release level ( Figure 5B ).
[0108] Example 6: CAR-NK cells prepared by overexpressing the MAFG gene have stronger anti-tumor ability in in vivo experiments
[0109] 1. Experimental Procedure
[0110] 1×10 6 HCT116 cells were inoculated into NSG mice. When the tumor grew to about 5×5 mm in size, 1×10 6 MAFG-CAR NK cells overexpressing MAFG gene and Con-CAR NK cells without overexpressing MAFG (both Her2 + The tumor size was measured every two days until the tumor grew to 2 cm. 3 The animals were killed when the tumor volume and death time of tumor-bearing mice were recorded, and the tumor growth curve and survival period of tumor-bearing mice were drawn.
[0111] 2. Experimental results
[0112] The experimental results showed that compared with CAR-NK cells that did not overexpress the MAFG gene, MAFG-CAR NK cells prepared by overexpressing the MAFG gene could significantly inhibit the growth of HCT116 tumors ( Fig. 6A ) and prolonged the survival period of tumor-bearing mice ( Figure 6B ).
[0113] In summary, the solution disclosed in this disclosure has the following effects:
[0114] 1. The present disclosure unexpectedly discovered that high expression of MAFG can significantly improve the self-proliferation ability and in vivo survival ability of immune cells, and increasing the expression ratio of MAFG protein in immune cells will greatly improve the efficacy of CAR-NK therapy.
[0115] 2. The CAR-NK cells prepared by overexpressing the MAFG gene in the present invention can significantly increase the proliferation rate of immunotherapy products.
[0116] 3. CAR-NK cells prepared by overexpressing the MAFG gene showed stronger tumor cell killing ability, cytokine release ability and infiltration ability in in vivo and in vitro studies, aiming to solve many problems of current immunotherapy cell therapy, such as short survival time in vivo and difficulty infiltrating into the tumor, and have great clinical application prospects.
Claims
1. Use of the MAFG gene or its encoded protein in the preparation of CAR-NK cells, wherein: The nucleotide sequence of the MAFG gene is shown in SEQ ID NO: 1, The amino acid sequence of the encoded protein is shown in SEQ ID NO: 2, The MAFG gene or its encoded protein is overexpressed in or on the surface of CAR-NK cells.
2. The use according to claim 1, wherein: The NK cells are selected from: NK cells separated from peripheral blood, NK cells derived from umbilical cord blood, NK cells derived from iPSC, NK cells derived from hESC, NK cells derived from HPC, and NK cells of NK-92 cell line.
3. Use of MAFG expression vector in the preparation of CAR-NK cells, wherein: The MAFG expression vector is a viral vector into which the MAFG gene shown in SEQ ID NO: 1 is inserted; The NK cells are selected from: NK cells isolated from peripheral blood, NK cells derived from umbilical cord blood, NK cells derived from iPSC, NK cells derived from hESC, NK cells derived from HPC, and NK cells of NK-92 cell line; The viral vector is selected from: adenovirus, adeno-associated virus, retrovirus, lentivirus, oncolytic virus; preferably lentivirus.
4. A method for preparing CAR-NK cells, comprising the steps of: 1) inserting the MAFG gene shown in SEQ ID NO: 1 into a viral vector to produce a MAFG expression vector, 2) packaging the MAFG expression vector into virus to prepare recombinant virus, 3) transfecting the separated NK cells with the recombinant virus to obtain the CAR-NK cells; in, The viral vector is selected from: adenovirus, adeno-associated virus, retrovirus, lentivirus, oncolytic virus; preferably lentivirus; The NK cells are selected from: NK cells separated from peripheral blood, NK cells derived from umbilical cord blood, NK cells derived from iPSC, NK cells derived from hESC, NK cells derived from HPC, and NK cells of NK-92 cell line.
5. A CAR-NK cell, wherein: The CAR-NK cells overexpress the MAFG gene, or The CAR-NK cells overexpress MAFG protein; The nucleotide sequence of the MAFG gene is shown in SEQ ID NO: 1, The amino acid sequence of the MAFG protein is shown in SEQ ID NO: 2; Preferably, the MAFG protein is overexpressed on the surface of the CAR-NK cells; Wherein, the NK cells are selected from: NK cells isolated from peripheral blood, NK cells derived from umbilical cord blood, NK cells derived from iPSC, NK cells derived from hESC, NK cells derived from HPC, and NK cells of NK-92 cell line.
6. The CAR-NK cell according to claim 5, having one or more of the following characteristics: 1) Enhanced in vitro proliferation capacity; 2) Enhanced in vitro tumor cell killing ability; 3) Enhanced in vitro cytokine release capacity; 4) Enhanced tumor invasion ability in vivo; 5) Enhanced anti-tumor ability in vivo.
7. The CAR-NK cell according to claim 5, further comprising a chimeric antigen receptor; The chimeric antigen receptor comprises: Specific scFv targeting Her2, Human CD8 signal peptide, Human CD8 hinge and transmembrane domains, NKG2D co-stimulatory domain, and CD3ζ intracellular domain.
8. A kit comprising the CAR-NK cell according to any one of claims 5 to 7.
9. Use of the CAR-NK cell according to any one of claims 5 to 7 in the preparation of a drug for treating cancer in a subject; The cancer is selected from the group consisting of head and neck cancer, lung cancer, stomach cancer, liver cancer, gallbladder cancer, prostate cancer, kidney cancer, colon cancer, rectal cancer, ovarian cancer, breast cancer, and hematological tumors; preferably colon cancer; The subject is a human or a non-human mammal.