Construction method of recombinant salmonella typhimurium as well as product and application of recombinant salmonella typhimurium

Abstract

The invention discloses a construction method of recombinant salmonella typhimurium as well as a product and application of the recombinant salmonella typhimurium. RSC0134 (pS-PlcC-NetB) can stimulate an organism to generate sufficient immune response in the early stage of immunization, shows programmed self-clearing in the later stage of immunization and has certain safety; after broiler chickens are immunized by rSC0134 (pS-PlcC-NetB), powerful humoral immunity, mucosal immunity and cellular immunity can be generated, and the broiler chickens are protected from being infected by necrotic enteritis; a recombinant attenuated salmonella typhimurium vaccine vector platform is constructed, a promising strategy is provided for developing a delivery platform for chicken infectious disease vaccines, and the recombinant attenuated salmonella typhimurium vaccine vector platform has great market application potential and potential economic benefits.

Description

Technical Field

[0001] The invention relates to a construction method of recombinant Salmonella typhimurium and a product and application thereof, belonging to the field of recombinant bacteria construction. Background Art

[0002] The ideal attenuated live vaccine is to achieve the best balance between safety and immunogenicity. Simple attenuation often leads to a reduction in the invasiveness and colonization ability of Salmonella, which will have an adverse effect on the effectiveness of the vaccine. Therefore, it is a very challenging proposition for the development of attenuated Salmonella vaccines to fully ensure safety while still achieving the immunogenicity and protective efficacy required for live vaccines. In order to explore the balance between the safety and immunogenicity of attenuated Salmonella vaccines, Levine MM et al. introduced the double gene deletion of ΔaroA and ΔpurA into the wild strain of Salmonella typhi. Subsequent experimental results showed that although the virulence of the double gene deletion strain was greatly weakened, its immunogenicity was also reduced, and it could not even induce specific antibody levels against LPS. When the double gene deletion of ΔphoP (a two-component environmental regulation system for the virulence of Salmonella) and ΔphoQ was introduced into the same wild strain, an attenuated strain with a balance of safety and immunogenicity was obtained. These studies indicate that different combinations of gene deletions will result in different attenuation properties and immunogenicity, and that it is necessary to implement attenuation strategies based on the understanding of gene function that combine different gene deletions.

[0003] As a vaccine that can replicate in the host, the amplification of attenuated Salmonella vectors in vivo may cause vaccine strains to be accidentally released into the environment along with the immunized animals. These accidentally released vaccine strains may bring unnecessary passive immunity and genetic material leakage. This release may lead to unintentional immunization and the transfer of cloned genes that may represent virulence properties in some cases. Therefore, it is necessary to apply a biocontainment system to attenuated Salmonella vectors to address the potential risks of these genetically modified organisms being accidentally released into the environment. At present, many mutations have been found in Salmonella typhimurium, including ΔshdA, ΔmisL and ΔratB, which can reduce the release of Salmonella vectors from immunized animals to the environment without negatively affecting the immunogenicity of the vectors. However, although the emission of vectors can be reduced, these vectors that exist in the environment in the form of live bacteria still have the risk of passive transmission. Therefore, simply reducing emissions cannot fundamentally solve the biosafety risks posed by Salmonella vectors.

[0004] From the perspective of immunogenicity: the exogenous antigens presented by Salmonella are difficult to break through their own membrane system and be released outside the cell, thereby reducing the degree of interaction between the exogenous antigens carried by them and the APCs (Antigen-presenting cells) in the host cells. In addition, after entering the host cell, Salmonella will recruit the host's membrane system to produce SCV (Salmonella-containing vacuole) to wrap itself in it to avoid host killing. The presence of SCV deepens the isolation between the exogenous antigens carried by Salmonella and APCs. Further weakening the immunogenicity of the Salmonella carrier.

[0005] Based on the above major defects of Salmonella vectors, it is urgent to design a new type of Salmonella that can fundamentally solve the biosafety risks brought by Salmonella vectors and will not weaken the immunogenicity of Salmonella vectors. This is of great significance to the development of Salmonella vector platforms. Summary of the invention

[0006] Purpose of the invention: The technical problem to be solved by the present invention is to provide a method for constructing Salmonella typhimurium and its products and applications, which provides a promising strategy for developing a delivery platform for vaccines against chicken-derived infectious diseases.

[0007] Technical solution: To solve the above technical problems, the present invention provides a method for constructing a recombinant Salmonella typhimurium, comprising the following steps:

[0008] (1) The highly virulent strain of Salmonella typhimurium UK-1 was used as the recipient bacterium and the pRE112-ΔrelA198::araCP BAD The recombinant bacteria carrying the lacI TT suicide plasmid were used as donor bacteria, and ΔrelA198::araC P was introduced BAD lacI TT gene, resulting in a suicide vector strain;

[0009] (2) Introduce ΔendA::araC P into the suicide vector strain in step (1) in sequence according to the above method BAD mazE TT, Δpmi-2426, ΔcysG:P lac mazF, ΔsifA, ΔwaaL, ΔpagL64::TT rhaRs P rhaBAD waaL, ΔasdA, to obtain the recombinant Salmonella typhimurium.

[0010] Among them, the method for introducing genes includes: culturing the recipient bacteria and donor bacteria in the logarithmic phase on LB agar medium containing arabinose and diaminopimelic acid and LB agar medium containing arabinose and chloramphenicol, respectively, and then purifying, picking a single colony and shaking it in LB liquid culture medium to the logarithmic growth phase, diluting it in multiple ratios, and culturing it on LB agar medium containing sucrose to obtain the recombinant Salmonella typhimurium.

[0011] Further, the method for introducing a gene comprises the following steps:

[0012] (1) dropping the bacterial liquid of the recipient bacteria and the donor bacteria in the logarithmic phase onto LB agar medium containing arabinose and diaminopimelic acid for culturing, then streaking the bacterial lawn on the medium onto LB agar medium containing arabinose and chloramphenicol and culturing overnight;

[0013] (2) picking a single colony grown on an LB agar medium containing arabinose and chloramphenicol and purifying it once on an LB agar medium containing arabinose and chloramphenicol; after the above-mentioned colony grows, picking a single colony and shaking it in an LB liquid medium to culture it until the logarithmic growth phase; diluting the obtained bacterial solution in multiple ratios, and applying it on an LB agar medium containing sucrose, and culturing it, and the obtained single colony is the recombinant Salmonella typhimurium.

[0014] The present invention also provides a recombinant Salmonella typhimurium obtained by the construction method.

[0015] The invention also provides application of the Salmonella typhimurium in preparing vaccines.

[0016] The invention also provides a vaccine, which contains the recombinant Salmonella typhimurium.

[0017] The present invention also provides the use of the recombinant Salmonella typhimurium or the vaccine in preparing a drug for delivering PlcC and NetB proteins.

[0018] The present invention also provides application of the recombinant Salmonella typhimurium or the vaccine in preparing medicine for preventing and / or treating damage to the chicken intestine.

[0019] The present invention also provides the use of the recombinant Salmonella typhimurium or the vaccine in preparing a medicine for preventing and / or treating necrotic enteritis.

[0020] In the present invention, the non-toxic antigens plcC (carboxyl terminal fragment of PlcC toxin) and NetB are candidate antigens for developing Clostridium perfringens vaccine. Therefore, the Salmonella typhimurium vector rSC0134 was used to deliver the Clostridium perfringens antigen plasmid pS-PlcC-NetB to construct the rSC0134 (pS-PlcC-NetB) candidate vaccine and evaluate its immune response level against broilers and immune protection efficacy against broilers, aiming to explore the application potential of the Salmonella typhimurium vector rSC0134 as a pathogen delivery platform.

[0021] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: 1. The expression of Clostridium perfringens protective antigen PlcC and NetB in the rSC0134 vector can be detected in the cytoplasm, periplasm and supernatant of Salmonella, and the pS-PlcC-NetB recombinant plasmid does not affect the growth of the rSC0134 strain and can be stably replicated in the rSC0134 strain; 2. rSC0134 (pS-PlcC-NetB) can stimulate the body to produce a sufficient immune response in the early stage of immunization, and exhibits programmed self-clearance in the later stage of immunization, and has a certain safety; 3. After immunizing broilers with rSC0134 (pS-PlcC-NetB), strong humoral immunity, mucosal immunity and cellular immunity can be generated, protecting broilers from infection with necrotic enteritis; 4. The present invention constructs a recombinant attenuated Salmonella typhimurium vaccine vector platform, which provides a promising strategy for the development of a delivery platform for vaccines against chicken-borne infectious diseases, and has great market application potential and potential economic benefits. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 To introduce ΔrelA198::araC P BAD PCR identification of deletion strains after lacI TT mutation;

[0023] Figure 2 To introduce ΔendA::araC P BAD PCR identification of deletion strains after mazE TT mutation;

[0024] Figure 3 PCR identification of the deletion strain after the introduction of Δpmi-2426 mutation;

[0025] Figure 4 To introduce ΔcysG:P lac PCR identification of deletion strains after mazF mutation;

[0026] Figure 5 PCR identification of the deletion strain after the introduction of the ΔsifA mutation;

[0027] Figure 6PCR identification of the deletion strain after the introduction of the ΔwaaL mutation;

[0028] Figure 7 To introduce ΔpagL64::TT rhaRs P rhaBAD PCR identification of deletion strains after waaL mutation;

[0029] Figure 8 PCR identification of the deletion strain after the introduction of ΔasdA mutation;

[0030] Fig. 9 The specific serum IgY and intestinal mucosal IgA levels induced by the vaccine candidate strains: A: The vaccine candidate strains induce a high level of specific serum IgY level against PlcC; B: The vaccine candidate strains induce a high level of specific serum IgY level against NetB; C: The vaccine candidate strains induce a high level of intestinal mucosal IgA level against PlcC; D: The vaccine candidate strains induce a high level of intestinal mucosal IgA level against NetB;

[0031] Fig.10 The mRNA transcription levels of IFN-γ, IL-4 and IL-17A in immunized chicken lymphocytes stimulated by recombinant proteins of Clostridium perfringens antigens PlcC (A) and NetB (B);

[0032] Fig.11 To examine the gross lesions of the chicken intestine;

[0033] Fig.12 To score the gross intestinal lesions;

[0034] Fig.13 It is a microscopic pathological lesion of the small intestine;

[0035] Fig.14 Scoring of intestinal microscopic pathology. DETAILED DESCRIPTION

[0036] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0037] Example 1 Construction of Salmonella Typhimurium vector rSC0134 and delivery of Clostridium perfringens antigen candidate vaccine strain rSC0134 (pS-PlcC-NetB)

[0038] 1. Construction of Salmonella typhimurium vector rSC0134

[0039] Using the highly virulent strain UK-1 of Salmonella typhimurium as the recipient bacterium (Genbank ID: NC_016863.1, purchased from the China Veterinary Drug Administration), eight suicide vector strains containing suicide plasmids were introduced successively through suicide vector-mediated homologous recombination technology to construct the Salmonella typhimurium vector rSC0134. The suicide vector strains were χ7213 (pRE112-ΔrelA198::araC P BAD lacI TT), χ7213(pRE112-ΔendA::araC P BAD mazE TT), χ7213(pRE112-Δpmi-2426), χ7213(pRE112-ΔcysG:P lac mazF) (the article disclosing the four suicide vector strains: PMID: 39395372; article title: Enhancement of protective efficacy of recombinant attenuated Salmonella typhimurium delivering H9N2 avian influenza virus hemagglutinins (HA) antigen vaccine candidate strains by CC motif chemokineligand 5 in chickens (chCCL5)), χ7213 (pRE112-ΔsifA), χ7213 (pRE112-ΔwaaL), χ7213 (pRE112-ΔpagL64::TT rhaRs P rhaBAD waaL), χ7213(pRE112-ΔasdA) (the article that disclosed the four suicide vector strains: PMID: 34922043; article title: A triple-sugar regulated Salmonella vaccine protects against Clostridium perfringens-induced necrotic enteritis in broiler chickens). The specific operation is as follows: wild-type Salmonella typhimurium strain UK-1 is used as the recipient strain, and a vaccine containing pRE112-ΔrelA198::araC P BAD lacI TT suicide plasmid suicide vector strain χ7213 (pRE112-ΔrelA198::araC P BADlacI TT) is the donor bacteria. The above two bacterial strains were cultured to the logarithmic phase, and 50 microliters of each of the above two bacterial solutions were dripped onto LB agar medium containing arabinose (0.2% final concentration) and diaminopimelic acid (DAP, 50ng / mL) (hereinafter referred to as arabinose + DAP agar medium). The arabinose + DAP agar medium with the above two bacterial solutions was cultured at 37°C for 12h. Then, the bacterial moss on the arabinose + DAP agar medium was scraped, streaked on the LB agar medium containing arabinose (0.2% final concentration) and chloramphenicol (25μg / mL final concentration) (hereinafter referred to as arabinose + Cm agar medium), and cultured at 37°C overnight. On the 2nd day, single colonies grown on arabinose and Cm agar medium were picked and purified once on arabinose and Cm agar medium. After the above colonies grow, single colonies are picked and cultured in LB liquid culture medium by shaking until the logarithmic growth phase. The above bacterial solution is cultured for 10 -4 Up to 10 -8 The strain was diluted in multiples and spread on LB agar medium containing 5% sucrose (hereinafter referred to as sucrose agar medium), and placed in an incubator at 26°C for 2-3 days. Single colonies on the sucrose agar medium were picked and identified by PCR (primer sequence: upstream: SEQ ID NO.1: 5'-CGGGTACCGTGATATGGGGGCATGCAACAAT-3'; downstream: SEQ ID NO.2: 5'-CCCAAGCTTGAGCTCGAGGGCGTTCCGGCGCTGGTAGAA-3'). The positive strain C50041 (ΔrelA198::araC P BAD lacI TT) was frozen in a -70℃ refrigerator for later use. BAD lacI TT) mutant was used as the recipient strain, and C50041 (ΔrelA198::araC P BAD lacI TT) recipient bacteria, the suicide vector strain was used as the donor bacteria to introduce ΔendA::araC P BAD mazE TT, Δpmi-2426, ΔcysG:P lac mazF, ΔsifA, ΔwaaL, ΔpagL64::TT rhaRs P rhaBAD waaL, ΔasdA.

[0040] Among them, the introduction of χ7213 (ΔendA::araC P BADThe PCR identification primers after mazE TT) are: upstream: SEQ ID NO.3: 5'-GGCTCTCCCCAGTCGATATT-3'; downstream: SEQ ID NO.4: 5'-AAACCAA TTGTCCATATTGCA-3';

[0041] The primers for PCR identification after the introduction of χ7213 (Δpmi-2426) were as follows: upstream: SEQ ID NO.5: 5′-GGGGGTACCTTCGGCACGGAAACATGTTCGCT-3′; downstream: SEQ ID NO.6: 5′-GGGGAGCTCGCCGCGCTGGTAGTTTTGATAACTTAA-3′;

[0042] Introduced χ7213 (ΔcysG:P lac The PCR identification primers after mazF) are: upstream: SEQ ID NO.7: 5'-GGCGCGCTGTGTAACTGG-3'; downstream: SEQ ID NO.8: 5'-TGAGTTGTAATTCCTCTGG-3';

[0043] PCR identification primer sequences after the introduction of χ7213 (ΔsifA): upstream: SEQ ID NO.9: 5′-:TGATGAGCTCTTTCTCTTCTCCAAAATCTC-3′; downstream: SEQ ID NO.10: 5′-CTTAGGTACCGGTCGATTTAATCAATTATG-3′;

[0044] PCR identification primer sequences after the introduction of χ7213 (ΔwaaL): upstream: SEQ ID NO.11: 5'-GCTGCTCACCAGAACAGAAC-3'; downstream: SEQ ID NO.12: 5'-AATGTAGCGCAGCGTTTC-3';

[0045] Introduced χ7213 (ΔpagL64::TT rhaRs P rhaBAD waaL) after PCR identification primer sequences: upstream: SEQ ID NO.13: 5'-GGGATTATGCCATTCATAAGCT-3'; downstream: SEQ ID NO.14: 5'-ATGCCTGCACTAAACCAGATG-3';

[0046] PCR identification primer sequences after introduction of χ7213 (ΔasdA): Primer sequences: Upstream: SEQ ID NO.15: 5′-TGCTCTAGATGTGCATGGCAATCGCCCAAC-3′; Downstream: SEQ ID NO.16: 5′-TCCCCCGGGTATCTGCGTCGTCCTACCTTC-3′;

[0047] The above PCR identification procedures are: pre-denaturation at 95℃ for 5 minutes, denaturation at 95℃ for 30 seconds, annealing at 55℃ for 30 seconds, extension at 72℃ for 2 minutes; PCR system: 10 μl of Norwegian Taq Master Mix enzyme (Cat. No.: P112-01); 1 μl of upstream and downstream primers, 1 μl of water. The PCR identification results are as follows Figure 1-8 (In the figure, + represents positive control, - represents blank control, and the remaining lanes are parallel experiments, all of which are positive single colonies identified after purification).

[0048] 2. Construction of the candidate vaccine strain rSC0134 (pS-PlcC-NetB) for delivering Clostridium perfringens antigens

[0049] Subsequently, according to the content of the article, the Clostridium perfringens antigen plasmid pS-PlcC-NetB (i.e., the pYA5112 plasmid in the original PMID: 26629620, abbreviated as: pS-PlcC-NetB in the present invention) (public article: PMID: 26629620; article title: Protection against necrotic enteritis in broiler chickens by regulated delayed lysis Salmonella vaccines) was transformed into rSC0134, and rSC0134 (pS-PlcC-NetB) was successfully constructed and sent to Nanjing GenScript Biotechnology Co., Ltd. for synthesis. At the same time, the pS0018 plasmid (laboratory preservation; public article: PMID: 37867213; article title: A bacterial mRNA-lysis-mediated cargo release vaccine system for regulated cytosolic surveillance and optimized antigen delivery) was introduced into the same strain rSC0134 to form rSC0134 (pS0018) as an empty plasmid control strain. The transformed clones were picked for PCR identification (primer sequence: upstream: SEQ ID NO.17: 5'-AACGCTGGTGAAAGTAAAAGATG-3'; primer sequence: downstream: SEQ ID NO.18: 5'-CAGACCGCTTCTGCGTTCT-3'; procedure: pre-denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds; extension at 72°C for 2 minutes; system: 10 μl of Norwegian Taq Master Mix enzyme (Cat. No.: P112-01); 1 μl of upstream and downstream primers, 1 μl of water), and the positive strains identified correctly by PCR were frozen in a -70°C refrigerator for future use ( Fig.10 ). The lanes in the figure are parallel experiments.

[0050] Example 2 Detection of immune response level of rSC0134 (pS-PlcC-NetB) against broiler chickens

[0051] 1. Detection of humoral and mucosal immune responses induced by candidate vaccine strains

[0052] To determine the humoral and mucosal immune responses induced by rSC0134 (pS-PlcC-NetB) and χ11802 (pS-PlcC-NetB) (public article: PMID: 26629620; article title: Protection against necrotic enteritis in broiler chickens by regulated delayed lysis Salmonella vaccines) at day 1, Ross 308 white broiler chickens were orally administered 1×10 9 One week after the administration of rSC0134(pS-PlcC-NetB), χ11802(pS-PlcC-NetB) and rSC0134(pS0018) strains at a dose of 100 CFU / mouse, serum and intestinal mucosal samples were collected from the immunized group and the blank control group, and the production of serum IgY and intestinal IgA against protective antigens of Clostridium perfringens induced by the immunized group was evaluated using indirect ELISA. The results showed that Fig. 9 As shown, compared with the rSC0134(pS0018) empty vector group and the blank control group, the rSC0134(pS-PlcC-NetB) and χ11802(pS-PlcC-NetB) immunization groups induced high levels of specific serum IgY and intestinal IgA against PlcC and NetB, and the specific serum IgY and intestinal specific IgA against PlcC and NetB induced by rSC0134(pS-PlcC-NetB) were significantly higher than those of the χ11802(pS-PlcC-NetB) immunization group. The above results indicate that the Salmonella vector vaccine candidate strain can induce a high level of specific humoral and mucosal immune response against the protective antigens of Clostridium perfringens.

[0053] 2. Detection of the cellular immune response induced by candidate vaccine strains

[0054] In order to test the ability of candidate vaccine strains to induce specific cellular immune responses, 1×10 9 One week after the rSC0134(pS-PlcC-NetB), χ11802(pS-PlcC-NetB) and rSC0134(pS0018) strains were inoculated with 1×10 7Each well was cultured in a 24-well plate at a density of 1.54 μg / mL and incubated with recombinant PlcC and NetB proteins (20 μg / mL). After 48 h, the cells were collected and total RNA was extracted. After reverse transcription into cDNA (reverse transcription system: 5× PrimeScript RT Master Mix 2 μL, Total RNA 500 ng, RNase Free ddH2O was added to make up the system to 10 μL; reverse transcription program: 37°C, 15 min; 85°C, 5 s, 4°C storage), real-time fluorescence quantitative PCR was used to detect the mRNA transcription levels of IFN-γ, IL-4 and IL-17A in the cells. The results are shown in Figure 2. Fig.10 As shown in the figure, compared with the peripheral blood lymphocytes of the rSC0134 (pS0018) empty vector control or blank control group, the mRNA transcription levels of IFN-γ, IL-4 and IL-17A were significantly increased after the two Clostridium perfringens antigens stimulated the immunized lymphocytes, indicating that both antigens can stimulate specific Th1, Th2, and Th17 cell immune responses. After PlcC and NetB stimulated the cells, the level of induced peripheral blood lymphocytes in the rSC0134 (pS-PlcC-NetB) immunized group was significantly higher than that in the χ11802 (pS-PlcC-NetB) immunized group.

[0055] Among them, the sources of recombinant PlcC and NetB proteins are as follows: the antigen plasmid of Clostridium perfringens antigen plasmid pS-PlcC-NetB synthesized by Nanjing GenScript Biotechnology Co., Ltd. was used as a template to amplify the target fragments of PlcC (primer sequence: upstream: SEQ ID NO.19: ATGGGTCGCGGATCCGAATTCAACGATCCGAGCGTGGGC; downstream: SEQ ID NO.20: GTGGTGGTGGTGGTGCTCGAGCTTGATATTATAGGTGCTATTGCC) and NetB (primer sequence: upstream: SEQ ID NO.21: CGCGGATCCGAATTCGAGCTCATGTCC CCTATACTAGGTTATTG; downstream: SEQ ID NO.22: GTGGTGGTGGTGGTGGTGCTCGA GTCAGGTAGTATTCGATTTTAT) (program: pre-denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds; extension at 72°C for 2 minutes; system: Novagen Taq Master Mix enzyme (catalog number: P112-01) 10 μl; upstream and downstream primers 1 μl each, water 8 μl), the PlcC and NetB target fragments were connected to the prokaryotic expression vector pET28a by homologous recombination and transformed into the expression vector BL21 (DE3) to construct BL21 (pET28a-PlcC) and BL21 (pET28a-GST-NetB), the expression of recombinant PlcC and NetB proteins was induced by isopropyl-β-D-thiogalactoside (IP TG), and purified by Ni-NTA affinity chromatography column method (GenScript Biotech).

[0056] Example 3 Detection of the immune protection efficacy of candidate vaccines against broiler chickens

[0057] 1. Damage of Clostridium perfringens infection to chicken intestines

[0058] To test the protective effect of vaccine strains against intestinal damage caused by Clostridium perfringens infection, 1-day-old Ross 308 white-feathered broiler chickens were orally administered 1×10 9 After 3 days of oral gavage with 1 mL of rSC0134(pS-PlcC-NetB) and χ11802(pS-PlcC-NetB) at a dose of 10 CFU / mouse, the 8CFU / mL), and all experimental chickens were killed and autopsied after the challenge, and the small intestinal segments were scored for necrotic enteritis. According to the content of the article, the intestinal lesions were scored on a scale of 0-6 (0: no lesions in the intestine; 1: thin or brittle intestinal wall, or diffuse superficial but removable fibrin; 2: focal necrosis or ulceration, or irremovable fibrin deposition, 1-5 lesions; 3: focal necrosis or ulceration, or irremovable fibrin deposition, 6-15 lesions; 4: focal necrosis or ulceration, or irremovable fibrin deposition, 16 or more; 5: 2 to 3 cm long necrotic plaques; 6: diffuse necrosis is typical of field cases). The average score of gross pathological changes in the intestine greater than 2 points was judged as positive for necrotic enteritis in chickens (public article: PMID: 30753181; article title: Salmonella-vectored vaccine delivering three Clostridium perfringensantigens protects poultry against necrotic enteritis). The results are as follows Fig.11 As shown, the intestinal tract of the control group, rSC0134 (pS0018) and χ11802 (pS-PlcC-NetB) immunization groups became thinner, a large number of necrotic foci appeared in the intestinal mucosa, and the average score of gross pathological changes in the intestine was greater than 2 points (2.77 points); while the lesions in the rSC0134 (pS-PlcC-NetB) immunization group were significantly lighter, and the average score of gross pathological changes in the intestine was less than 2 points (1.55 points); the number of necrotic foci was significantly less than that of χ11802 (pS-PlcC-NetB). Fig.12 As shown, the lesion score of the χ11802 (pS-PlcC-NetB) immunization group was slightly higher than that of the rSC0134 (pS-PlcC-NetB) immunization group. The above results show that the rSC0134 (pS-PlcC-NetB) immunization group has a better protective effect against intestinal damage than the χ11802 (pS-PlcC-NetB) immunization group. The above results show that the rSC0134 strain delivering the chicken Clostridium perfringens antigen PlcC-NetB can provide protection against chicken Clostridium perfringens infection, while χ11802 cannot.

[0059] 2. Histopathological changes caused by Clostridium perfringens infection

[0060] After autopsy, the duodenum of each group was collected and histopathological sections were prepared to evaluate the improvement of the tissue pathological damage caused by Clostridium perfringens infection after immunization with the candidate vaccine strain. Fig.13As shown, the intestinal mucosal damage in the drug-challenged control group was severe, with villus necrosis and disintegration, glandular hyperplasia, and the complete intestinal villus structure could no longer be seen; compared with the drug-challenged control group, the lesions in the rSC0134 (pS-PlcC-NetB) immunization group were milder, with a complete villus structure visible, and the lesions were mainly villous interstitial edema; the villus arrangement was disordered, the glands were hyperplastic, and the normal villus structure was destroyed in the χ11802 (pS-PlcC-NetB) and rSC0134 (pS0018) empty vector immunization groups. The 4-point scoring standard was used to score intestinal pathological damage (0 points, no inflammation, intact villi; 1 point, a small amount of inflammatory cell infiltration, relatively intact intestinal villi; 2 points, a large number of lymphocyte infiltration, villous interstitial edema; 3 points, a large number of lymphocyte infiltration, intestinal villus necrosis or glandular hyperplasia; 4 points, a large number of lymphocyte infiltration, diffuse necrosis and shedding of intestinal villi). Fig.14 As shown in the figure, similar to the intestinal injury score, the intestinal tissue pathology score of the rSC0134 (pS-PlcC-NetB) immunization group was significantly reduced compared with the lesion scores of the challenge group, rSC0134 (pS0018) empty vector and χ11802 (pS-PlcC-NetB) immunization group. The above results show that the rSC0134 (pS-PlcC-NetB) candidate vaccine strain can significantly reduce the damage of Clostridium perfringens infection to the chicken intestine after immunization.

[0061] In summary, the present invention uses Salmonella typhimurium UK-1 as the background, successfully constructs the attenuated Salmonella typhimurium delayed lysis vector rSC0134 through suicide vector-mediated homologous recombination technology, and presents the candidate vaccine rSC0134 (pS-PlcC-NetB) of recombinant chicken Clostridium perfringens antigen. Compared with the χ11802 (pS-PlcC-NetB) immune group, the rSC0134 (pS-PlcC-NetB) candidate vaccine strain can induce good humoral, mucosal and cellular immune responses, and can alleviate the lesions caused by Clostridium perfringens infection. The present invention constructs a Salmonella typhimurium vector that is safe, effective and biosafe, and provides a promising strategy for the development of a vaccine delivery platform for infectious diseases, with great market application potential and potential economic benefits.

Claims

1. A method for constructing a recombinant Salmonella typhimurium, characterized in that: The following steps are involved: (1) The highly virulent strain of Salmonella typhimurium UK-1 was used as the recipient bacterium and the pRE112-ΔrelA198::araCP BAD The recombinant bacteria carrying the lacI TT suicide plasmid were used as donor bacteria, and ΔrelA198::araC P was introduced BAD lacI TT gene, resulting in a suicide vector strain; (2) Introduce ΔendA::araC P into the suicide vector strain in step (1) according to the above method BAD mazETT,Δpmi-2426,ΔcysG:P lac mazF, ΔsifA, ΔwaaL, ΔpagL64::TT rhaRs P rhaBAD waaL, ΔasdA, to obtain the recombinant Salmonella typhimurium.

2. The construction method according to claim 1, characterized in that: The method for introducing the gene comprises: culturing the recipient bacteria and the donor bacteria in the logarithmic phase on an LB agar medium containing arabinose and diaminopimelic acid and an LB agar medium containing arabinose and chloramphenicol in sequence, and then purifying, picking a single colony and shaking it in an LB liquid culture medium to the logarithmic growth phase, diluting it in multiple ratios, and culturing it on an LB agar medium containing sucrose, so as to obtain the recombinant Salmonella typhimurium.

3. The construction method according to claim 2, characterized in that: The method of introducing a gene comprises the following steps: (1) dropping the bacterial liquid of the recipient bacteria and the donor bacteria in the logarithmic phase onto LB agar medium containing arabinose and diaminopimelic acid for culturing, then streaking the bacterial lawn on the medium onto LB agar medium containing arabinose and chloramphenicol and culturing overnight; (2) picking a single colony grown on an LB agar medium containing arabinose and chloramphenicol and purifying it once on an LB agar medium containing arabinose and chloramphenicol; after the above-mentioned colony grows, picking a single colony and shaking it in an LB liquid medium to culture it until the logarithmic growth phase; diluting the obtained bacterial solution in multiple ratios, and applying it on an LB agar medium containing sucrose, and culturing it, and the obtained single colony is the recombinant Salmonella typhimurium.

4. A recombinant Salmonella typhimurium obtained by the construction method according to any one of claims 1 to 3.

5. Use of the Salmonella typhimurium according to claim 4 in preparing a vaccine.

6. A vaccine, characterized in that It contains the recombinant Salmonella typhimurium according to claim 4.

7. Use of the recombinant Salmonella typhimurium according to claim 4 or the vaccine according to claim 6 in the preparation of a drug for delivering PlcC and NetB proteins.

8. Use of the recombinant Salmonella typhimurium according to claim 4 or the vaccine according to claim 6 in the preparation of a medicament for preventing and / or treating damage to the intestinal tract of chickens.

9. Use of the recombinant Salmonella typhimurium according to claim 4 or the vaccine according to claim 6 in the preparation of a medicament for preventing and / or treating necrotic enteritis.

Images