Application of SlPIN8 gene and protein coded by SlPIN8 gene in regulation and control of salt tolerance of tomato

Abstract

The invention is suitable for the technical field of molecular biology, and provides an application of an SlPIN8 gene and a protein coded by the SlPIN8 gene in regulating and controlling the salt tolerance of tomatoes. Overexpression and knockout transgenic plants of the gene are respectively obtained by cloning the tomato SlPIN8 gene and utilizing an agrobacterium tumefaciens mediated genetic transformation mode. Under the condition of salt stress, the phenotypic difference between a transgenic plant and a wild plant is observed and compared, and physiological indexes are measured at the same time, so that the influence of the SlPIN8 gene on the salt tolerance of the plant is researched. Results show that the SlPIN8, as a positive regulation gene responding to salt stress, can positively regulate the salt tolerance of the tomato and enhance expression without influencing the growth and development of the tomato, so that the SlPIN8 can be used as an excellent gene for stress-resistant breeding of the tomato. The research not only provides important information for analyzing the salt-tolerant signal pathway of the tomato, but also provides a new germplasm and gene resource basis for salt-tolerant breeding and variety improvement of the tomato.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to the application of SlPIN8 gene and protein encoded by it in regulating the salt tolerance of tomatoes. Background Art

[0002] Due to improper agricultural management, excessive use of fertilizers and certain natural factors, soil salinization is becoming increasingly serious, which not only has a serious impact on land resources and crop yields, but also restricts the sustainable development of agriculture. In salinized soil, the ability of plant roots to absorb water is inhibited, and cell water loss occurs frequently, which interferes with the normal growth and development of plants and causes significant losses in agricultural production. Among them, salt stress has become one of the severe challenges facing global crop production.

[0003] The growth and development of tomato (Solanum lycopersicum) are often adversely affected by soil salinization. Soil salinization leads to high pH and high concentration of sodium ions (Na + ) accumulates in the environment around the tomato roots, causing multiple stresses such as oxidative stress, osmotic stress, ion toxicity and nutrient deficiency, which not only affects the normal growth of tomatoes, but also significantly reduces their yield and fruit quality. Therefore, in-depth research on the genes and their mechanisms of action that regulate tomato salt resistance, the use of biobreeding technology to develop salt-tolerant genes, and the targeted rapid cultivation of salt-tolerant tomato varieties have important theoretical value for improving tomato stress resistance and cultivation efficiency.

[0004] Auxin export carrier PIN-FORMED (PIN) proteins are key regulators of polar auxin transport in plants. They play a key role in plant growth and development and environmental response. PIN proteins are divided into two categories: long PIN proteins and short PIN proteins according to the length of the hydrophilic region. Arabidopsis PIN1-PIN4 and PIN7 belong to long PIN proteins; PIN5, PIN6 and PIN8 belong to short PIN proteins. The tomato SlPIN family contains 10 members, of which SlPIN1, SlPIN2, SlPIN3, SlPIN4, SlPIN7 and SlPIN9 have long hydrophilic loops and belong to the "long PIN" type; SlPIN5, SlPIN6, SlPIN8 and SlPIN10 have short hydrophilic loops and belong to the "short PIN" type.

[0005] Plants are constantly facing biological and abiotic stresses in their life cycle, and they must find a balance between growth and development and stress response to maximize survival efficiency. However, there are some genes in plants that simultaneously regulate growth and development and response to environmental stress, and while regulating the response to stress, they often come at the expense of reducing plant growth and development. Therefore, it is very important to find resistance genes that can improve plant resistance without reducing its growth and development. Based on this, the present invention proposes the use of the SlPIN8 gene and the protein it encodes in regulating tomato salt tolerance. Summary of the invention

[0006] The purpose of the present invention is to provide the application of the SlPIN8 gene and the protein encoded by it in regulating the salt tolerance of tomatoes, aiming to solve the problems raised in the above background technology.

[0007] The purpose of the present invention is achieved through the following technical solutions:

[0008] The application of the SlPIN8 gene or the protein encoded by it in regulating the salt tolerance of tomatoes, the nucleotide sequence of the SlPIN8 gene is shown in SEQ ID No.1, and the amino acid sequence of the protein encoded by the SlPIN8 gene is shown in SEQ ID No.2.

[0009] Furthermore, overexpression of the SlPIN8 gene can improve the salt tolerance of tomatoes.

[0010] Compared with the prior art, the present invention has the following beneficial effects:

[0011] The present invention cloned the tomato SlPIN8 gene and used Agrobacterium tumefaciens-mediated genetic transformation to obtain overexpression and knockout transgenic plants of the gene, respectively. Under salt stress conditions, the phenotypic differences between transgenic plants and wild-type plants were observed and compared, and physiological indicators were measured to study the effect of the SlPIN8 gene on plant salt tolerance. The results showed that SlPIN8, as a positive regulatory gene that responds to salt stress, can positively regulate the salt tolerance of tomatoes, enhance expression and do not affect its growth and development, so it can be used as an excellent gene for tomato stress resistance breeding. This study not only provides important information for the analysis of tomato salt tolerance signaling pathways, but also provides a new germplasm and gene resource basis for tomato salt resistance breeding and variety improvement. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 Expression analysis of tomato PIN family genes under salt stress.

[0013] Figure 2 Phenotypic and expression analysis of SlPIN8 overexpressing tomato plants.

[0014] Figure 3Shown are the phenotypes of SlPIN8 overexpressing plants under salt stress and the changes in dry weight and fresh weight of individual plants.

[0015] Figure 4 Shown are the changes in MDA content and the activities of SOD, POD and CAT in SlPIN8 overexpressing plants under salt stress.

[0016] Figure 5 Identification and phenotype of SlPIN8 gene knockout plants.

[0017] Figure 6 The phenotypes of SlPIN8 gene knockout plants under salt stress and the changes in dry weight and fresh weight of the CR-6 knockout line.

[0018] Figure 7 Shown are the changes in MDA content and the activities of SOD, POD and CAT in the CR-6 knockout strain under salt stress. DETAILED DESCRIPTION

[0019] In order to have a clearer understanding of the technical features, purposes and beneficial effects of the present invention, the technical solution of the present invention is now described in detail below, but it should not be construed as limiting the applicable scope of the present invention.

[0020] The specific implementation of the present invention is described in detail below in conjunction with specific embodiments.

[0021] Example 1: Expression analysis of tomato SlPIN gene family under salt stress and study on the induction response of SlPIN8;

[0022] 1. Material cultivation and salt stress treatment;

[0023] In this study, the tomato variety MM (Solanum lycopersicum cv. Moneymaker) was used as the experimental material, and the material was stored in the laboratory. After germination for 10 days in the seedling medium (peat soil: vermiculite = 3:1), the tomato seeds were cultured in the seedling medium; after 1 month of culture, the tomato plants were subjected to salt stress. The conditions in the culture room were set as follows: 16 h of light / 8 h of dark culture, and a light intensity of 250 μmol×m -2 ×s -1 , the culture temperature is 25℃ and the relative humidity is maintained at around 75%.

[0024] 2. Gene expression analysis;

[0025] In order to explore the expression of the SlPIN gene family under salt stress, we selected wild-type MM tomato plants and took samples (leaves) after treatment with 200 mM NaCl for 0 h, 6 h and 24 h for RNA extraction and fluorescence quantitative RT-PCR analysis.

[0026] Total RNA was extracted from tomato leaves using Universal Plant Total RNA Kit. Reverse transcription was performed using GenStar's StarScriptⅢAll-in-one RT Mix with gDNARemover Kit. The specific reaction is as follows:

[0027] Prepare the following reaction system in an RNase-Free (200 μL) centrifuge tube:

[0028] Table 1 Reaction system

[0029]

[0030]

[0031] Mix thoroughly by pipetting gently and centrifuge briefly.

[0032] Reverse transcription was performed according to the reaction conditions shown in Table 2;

[0033] Table 2 Reaction conditions

[0034]

[0035] After the reaction, add 20 μL RNase Free ddH2O to each reaction system to dilute the obtained cDNA and place it on ice for subsequent experiments or cryopreservation.

[0036] Real-time quantitative PCR (qPCR): qRT-PCR was used to analyze the expression of the target gene at the RNA level, with SlActin (Solyc03g078400) as the internal reference gene. Each gene was repeated 3 times, and the qRT-PCR reaction was prepared using 2×M5HiPer SYBR EsTaq (with Tli RNaseH) quantitative reagent from PolyMei.

[0037] The reaction system is as follows:

[0038] Table 3 qRT-PCR reaction system

[0039]

[0040] The reaction conditions were set as follows: 95°C for 30 s, 95°C for 5 s, 60°C for 30 s, 40 cycles, and melting curve: 65°C for 15 s, 95°C for 0.5 s.

[0041] Data analysis: Data were obtained using a Bio-Rad 96-well real-time quantitative PCR instrument and were initially organized using Bio-Rad CFXManager. -ΔΔct The relative expression values ​​were obtained by GraphPad Prism 8, and the significant differences were calculated by Student t-test.

[0042] The primer sequences are as follows:

[0043] S1PIN1L: GCTGCAGGCTGGTCTAGATT (as shown in SEQ ID NO. 3)

[0044] SlPIN1R: AACAATGGCAACAAAGCACA (as shown in SEQ ID NO. 4)

[0045] S1PIN3L:TTCAAAATCAATTTAGCGTGTCA (as shown in SEQ ID NO. 5)

[0046] S1PIN3R: CTCAAAATCCCTCTTGTTTCG (as shown in SEQ ID NO. 6)

[0047] SlPIN4L: AAAGAGGGACCCACTGGACT (as shown in SEQ ID NO.7)

[0048] S1PIN4R: TCATAACACTAGCCGGAGGC (as shown in SEQ ID NO. 8)

[0049] S1PIN5L: ACATTGAGCTGGCATTTTGG (as shown in SEQ ID NO.9)

[0050] S1PIN5R:TCCACTACCAGCCTTTGACA (as shown in SEQ ID NO.10)

[0051] S1PIN6L: AGATGGCAGCAATAGGGATG (as shown in SEQ ID NO. 11)

[0052] S1PIN6R: GCGAAGACAAATGGAACGAT (as shown in SEQ ID NO. 12)

[0053] S1PIN7L:ATCGTTCCTTTCGTCTTTGC (as shown in SEQ ID NO. 13)

[0054] S1PIN7R: GCATAAAAAGCAGTGGCAAAAT (as shown in SEQ ID NO. 14)

[0055] S1PIN8L: GGTGGGGGAAACTCTTTTCA (as shown in SEQ ID NO. 15)

[0056] S1PIN8R:TTCCTTTGGGCTTCAGTTTG (as shown in SEQ ID NO. 16)

[0057] S1PIN9L:TCCTGAGGCATCACCATACA (as shown in SEQ ID NO.17)

[0058] S1PIN9R: TCATTGCTTCCAACAATCCA (as shown in SEQ ID NO. 18)

[0059] S1PIN10L: GACAGGTGGCATTTCGGACTGCC (as shown in SEQ ID NO. 19)

[0060] S1PIN10R: CCAGGGGGTAATGCTGCCTGAA (as shown in SEQ ID NO. 20)

[0061] The results showed that after 6h and 24h of salt stress treatment, the expression of SlPIN8 gene was significantly induced ( Figure 1 ), indicating that SlPIN8 is a gene induced by salt stress.

[0062] Example 2: Construction of SlPIN8 gene overexpression and knockout vectors and identification of transgenic plants;

[0063] 1. Construction of overexpression vector and knockout vector;

[0064] Using tomato leaf cDNA as a template, high-fidelity enzymes were used for PCR amplification to obtain the target band and recover it. Subsequently, the pCambia1300-YFP vector was cut with SmaI and seamless cloning technology was used. -BasicSeamless Cloning and Assembly Kit was used to connect the target gene fragment to the vector to complete the construction of the overexpression vector. At the same time, two target sites were designed in the first exon of the SlPIN8 gene, and the two target sites were constructed into the pYLCRISPR / Cas9-DH vector using seamless cloning technology and transformed into the GV3101 Agrobacterium strain. Two homozygous strains with mutations in the first target site and no mutations in the second target site were obtained, named CR-2 and CR-6.

[0065] The target sequences are as follows:

[0066] SlPIN8-gRNAL1: GTCAGTATAGTGGCTGCCACAACA (as shown in SEQ ID NO.21)

[0067] SlPIN8-gRNAR1: AAACTGTTGTGGCAGCCACTATAC (as shown in SEQ ID NO.22)

[0068] SlPIN8-gRNAL2: GTCATTGTCCTTCCAAGTGATATC (as shown in SEQ ID NO.23)

[0069] SlPIN8-gRNAR2: AAACGATATCACTTGGAAGGACAA (as shown in SEQ ID NO.24)

[0070] 2. Acquisition and identification of transgenic plants;

[0071] 1. Obtaining transgenic plants: Using the leaf disc method mediated by Agrobacterium tumefaciens, transgenic plants with hygromycin resistance were obtained.

[0072] 2. Identification of overexpression plants: The overexpression plants were detected by PCR, and the primer sequences included: 35SF: GACGCACAATCCCACTATCC (as shown in SEQ ID NO.25); SlPIN8R: TTCCTTTGGGCTTCAGTTTG (as shown in SEQID NO.26). The PCR test results showed that the five overexpression plants obtained were all positive, that is, the target gene had been successfully inserted into the plant genome. Subsequently, the expression level of the SlPIN8 gene in two of the overexpression lines was further detected using the qRT-PCR method, and the method was the same as in Example 1.

[0073] The results showed that the expression of SlPIN8 in the two overexpression lines OE1 and OE2 increased by about 500 and 1400 times, respectively. The phenotypes of the T3 homozygous lines OE1 and OE2 were not significantly different from those of the wild type ( Figure 2 ).

[0074] 3. Identification of knockout plants: PCR amplification was performed using the DNA of the transgenic plants as a template, and the amplification primer sequences included: SlPIN8-CRL: GTGGTACTTTCCCATCATATGCC (as shown in SEQ ID NO.27); SlPIN8-CRR: TAGTTCTGCTGCCGCATCTC (as shown in SEQ ID NO.28). The PCR products were sequenced and compared with the control sequences. The comparison results showed that the two knockout strains CR-2 and CR-6 had 2bp and 79bp deletion mutations in the first exon of the SlPIN8 gene, respectively. Compared with the wild type, the growth of the two knockout strains CR-2 and CR-6 was significantly inhibited ( Figure 5 ).

[0075] Example 3: Analysis of salt tolerance of SlPIN8 overexpression and knockout plants;

[0076] Wild-type MM and SlPIN8 transgenic plants were treated with 200 mM NaCl (experimental group) and water (control group), and phenotypic analysis and tomato leaf physiological indexes were performed 7 days after treatment. SOD, POD, CAT and MDA were measured using kits.

[0077] Table 4 SOD, POD, CAT and MDA activity detection kit

[0078]

[0079] The results showed that under salt stress, compared with the wild type, the plant height and root growth of OE1 and OE2 lines were better, and the dry weight and fresh weight of each plant were higher than those of the wild type ( Figure 3 ). This result suggests that overexpression of SlPIN8 may improve the salt tolerance of tomatoes. To further verify this conclusion, we measured physiological indicators related to salt tolerance, including MDA content and the activities of antioxidant-related enzymes SOD, POD, and CAT. The results showed that compared with the wild type, the MDA content of the overexpression strain was lower, while the activities of SOD, POD, and CAT were higher than those of the wild type ( Figure 4 ). This result further supports the conclusion that SlPIN8 overexpression improves salt tolerance in tomato.

[0080] On the other hand, we also subjected the SlPIN8 knockout plants to salt stress. The results showed that the two knockout lines, CR-2 and CR-6, showed obvious yellowing under salt stress, and the root growth inhibition was more obvious, among which the CR-2 knockout line was close to death. At the same time, their dry weight and fresh weight were significantly reduced ( Figure 6). In terms of physiological index determination, we found that the MDA content of the CR-6 knockout strain under salt stress was significantly higher than that of the wild type, while the activities of SOD, POD and CAT were lower than those of the wild type ( Figure 7 ). This result indicated that knockout of the SlPIN8 gene significantly reduced the salt tolerance of tomato.

[0081] In summary, the present invention aims to explore the biological function of the SlPIN8 gene in improving the stress resistance of tomatoes. By cloning the tomato SlPIN8 gene and using the genetic transformation mediated by Agrobacterium tumefaciens, the overexpression and knockout transgenic plants of the gene were obtained respectively. Under salt stress conditions, the phenotypic differences between transgenic plants and wild-type plants were observed and compared, and physiological indicators were measured to study the effect of the SlPIN8 gene on plant salt tolerance. The results showed that SlPIN8, as a positive regulatory gene that responds to salt stress, can positively regulate the salt tolerance of tomatoes, enhance expression and do not affect its growth and development, so it can be used as an excellent gene for tomato stress resistance breeding. This study not only provides important information for the analysis of tomato salt tolerance signaling pathways, but also provides a new germplasm and gene resource basis for tomato salt resistance breeding and variety improvement.

[0082] The above are only preferred embodiments of the present invention. It should be pointed out that, for those skilled in the art, several modifications and improvements can be made without departing from the concept of the present invention. These should also be regarded as the protection scope of the present invention. These will not affect the effect of the implementation of the present invention and the practicality of the patent.

Claims

1. Application of the SlPIN8 gene or the protein encoded by it in regulating salt tolerance of tomatoes, characterized in that: The nucleotide sequence of the SlPIN8 gene is shown in SEQ ID No.1, and the amino acid sequence of the protein encoded by the SlPIN8 gene is shown in SEQ ID No.

2.

2. The use according to claim 1, characterized in that: Overexpression of the SlPIN8 gene can improve the salt tolerance of tomatoes.

Images