Application of RNA (Ribonucleic Acid) binding protein CsdA in regulation and control of fungus secondary metabolites

Abstract

The invention discloses application of RNA (Ribonucleic Acid) binding protein CsdA in regulation and control of secondary metabolites of fungi. The invention provides application of RNA (Ribonucleic Acid) binding protein CsdA or related biological materials thereof in regulation and control of fungus secondary metabolites. The RNA binding protein CsdA is a protein of which the amino acid sequence is as shown in SEQ ID No. 3 or SEQ ID No. 2 or a homologous protein of the protein of which the amino acid sequence is as shown in SEQ ID No. 3 or SEQ ID No. 2. The invention is helpful for excavating natural products with medicinal activity in fungi, is helpful for developing new anti-fungal infection drug targets, and reduces the probability of fungal infection.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to application of RNA binding protein CsdA in regulating fungal secondary metabolites. Background Art

[0002] Microbial secondary metabolites are a general term for low molecular weight compounds produced by microorganisms to adapt to complex and changing environments. They are not necessary for microbial growth, but usually have important pharmacological activities and are widely used in health, medicine, agriculture and other fields. For example, the widely used antibiotic penicillin, immunosuppressant cyclosporine and cholesterol-lowering compound lovastatin in clinical practice. However, as more and more secondary metabolites are discovered, it is becoming increasingly difficult to discover novel active secondary metabolites. Therefore, it is urgent to develop a new strategy to improve the current predicament.

[0003] Fungi are a group of eukaryotic organisms that are widely distributed in nature and have important potential for the development of secondary metabolites. However, under conventional laboratory conditions, fungal secondary metabolite biosynthesis genes are usually silent or lowly expressed, and so far less than 1% of secondary metabolites have been identified. Therefore, it is necessary to develop a method to regulate global gene expression to activate secondary metabolites.

[0004] With the development of genome sequencing technology, a variety of gene regulation strategies have been developed to mine secondary metabolites. For example, global regulation, epigenetic regulation, and pathway-specific regulation. Although these regulatory strategies have shown certain application value in the mining of secondary metabolites, they also have many defects. One is that the regulatory factors currently discovered are usually only applicable to specific microbial groups and are not universal; the other is that the regulatory range of these regulatory factors is limited, making it difficult to mine large quantities of secondary metabolites; in addition, the current research on fungal gene regulation mechanisms is not clear enough.

[0005] As we all know, gene transcription in eukaryotes usually begins with DNA transcription to form pre-mRNA, and then forms mature mRNA through the participation of post-transcriptional spliceosomes and auxiliary factors, and RNA-binding proteins play an important role in the splicing of pre-mRNA. Compared with other types of gene regulation, RNA-binding proteins exist in almost all eukaryotes and regulate the expression of a large number of genes, including genes that synthesize secondary metabolites. Therefore, RNA-binding proteins have shown great application potential in the exploration of secondary metabolites. So far, the global regulatory role of RNA-binding proteins in the biosynthesis of secondary metabolites has not been found. Summary of the invention

[0006] The purpose of the present invention is to provide application of RNA binding protein CsdA in regulating fungal secondary metabolites.

[0007] In the first aspect, the present invention claims the use of RNA binding protein CsdA or its related biological materials in regulating fungal secondary metabolites or preparing products for regulating fungal secondary metabolites;

[0008] The related biological material is selected from any of the following: a nucleic acid molecule capable of expressing the RNA binding protein CsdA, an expression cassette or a recombinant vector or a recombinant bacterium or a transgenic cell line containing the nucleic acid molecule, a substance capable of promoting the expression of the RNA binding protein CsdA, and a substance capable of inhibiting the expression of the RNA binding protein CsdA.

[0009] The expression cassette refers to a DNA capable of expressing the RNA binding protein CsdA in a host cell, and the DNA may include not only a promoter for initiating transcription of the coding sequence of the RNA binding protein CsdA, but also a terminator for terminating transcription. Further, the expression cassette may also include an enhancer sequence.

[0010] The RNA binding protein CsdA is any of the following proteins:

[0011] (A1) a protein with an amino acid sequence as shown in SEQ ID No. 3;

[0012] (A2) a protein with an amino acid sequence as shown in SEQ ID No. 2;

[0013] (A3) a protein having the same function as that of fungi or Aspergillus fumigatus or Pestalotiopsis fici, wherein one or more amino acid residues of the amino acid sequence defined in (A1) or (A2) are substituted and / or deleted and / or added;

[0014] Wherein, the fungus is an Ascomycota fungus, and can further be a fungus selected from the following classes: Sordariomycetes, Leotiomycetes, Dothideomycetes, Eurotiomycetes, Pezizomycetes.

[0015] (A4) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more identity with the amino acid sequence defined in any one of (A1) to (A3) and derived from a fungus or Aspergillus fumigatus or Pestalotiopsis fici and having the same function;

[0016] (A5) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein defined in any one of (A1) to (A4).

[0017] In the above protein, the tag refers to a polypeptide or protein that is fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The tag can be a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag and / or a SUMO tag, etc.

[0018] In the above proteins, the identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage website.

[0019] In the above proteins, the homology of more than 95% may be at least 96%, 97%, 98% identity. The homology of more than 90% may be at least 91%, 92%, 93%, 94% identity. The homology of more than 85% may be at least 86%, 87%, 88%, 89% identity. The homology of more than 80% may be at least 81%, 82%, 83%, 84% identity.

[0020] Wherein, the regulation of fungal secondary metabolites is global regulation of fungal secondary metabolites. Further, the global regulation can be specifically embodied in reducing or increasing the expression level and / or activity of the RNA binding protein CsdA in the recipient fungus, and more than 50% of the secondary metabolites have significant changes in content. The same below.

[0021] In a specific embodiment of the present invention, the fungal secondary metabolites can be selected from the following: DHN-melanin, pesteic acid, asperpentyn, iso-A82775C, siccayne, Pestalofone A, Pestaloficid M, RES1214-1 (corresponding to P.fici), fumigaclavine A, fumigaclavine C, fumiquinazoline A, fumiquinazoline C, fumiquinazoline D, pyripyropene A, tryprostatin B, pseurotinA, gliotoxin (corresponding to A.fumigatus).

[0022] In a second aspect, the present invention claims to protect the use of RNA binding protein CsdA or its related biological materials in regulating fungal growth and development or in preparing products for regulating fungal growth and development.

[0023] The related biological material is selected from any of the following: a nucleic acid molecule capable of expressing the RNA binding protein CsdA, an expression cassette or a recombinant vector or a recombinant bacterium or a transgenic cell line containing the nucleic acid molecule, a substance capable of promoting the expression of the RNA binding protein CsdA, and a substance capable of inhibiting the expression of the RNA binding protein CsdA.

[0024] The RNA binding protein CsdA is any one of the proteins (A1)-(A5) in the first aspect above.

[0025] In a third aspect, the present invention claims to protect the use of RNA binding protein CsdA or related biological materials in regulating the virulence of pathogenic fungi or in preparing products for regulating the virulence of pathogenic fungi.

[0026] The related biological material is selected from any of the following: a nucleic acid molecule capable of expressing the RNA binding protein CsdA, an expression cassette or a recombinant vector or a recombinant bacterium or a transgenic cell line containing the nucleic acid molecule, a substance capable of promoting the expression of the RNA binding protein CsdA, and a substance capable of inhibiting the expression of the RNA binding protein CsdA.

[0027] The RNA binding protein CsdA is any one of the proteins (A1)-(A5) in the first aspect above.

[0028] In a fourth aspect, the present invention claims protection for the use of RNA binding protein CsdA or related biological materials in regulating the drug resistance of pathogenic fungi or in preparing products for regulating the drug resistance of pathogenic fungi.

[0029] The related biological material is selected from any of the following: a nucleic acid molecule capable of expressing the RNA binding protein CsdA, an expression cassette or a recombinant vector or a recombinant bacterium or a transgenic cell line containing the nucleic acid molecule, a substance capable of promoting the expression of the RNA binding protein CsdA, and a substance capable of inhibiting the expression of the RNA binding protein CsdA.

[0030] The RNA binding protein CsdA is any one of the proteins (A1)-(A5) in the first aspect above.

[0031] Furthermore, in the application described in the first aspect above, the expression level and / or activity of the RNA binding protein CsdA in the fungus is reduced, and the content of more than 50% of the secondary metabolites of the fungus is changed.

[0032] Furthermore, in the application described in the first aspect above, the expression level and / or activity of the RNA binding protein CsdA in the fungus is reduced, and the content of the fungal secondary metabolites melanin and / or pesteic acid is increased.

[0033] Furthermore, in the application described in the second aspect above, the expression level and / or activity of the RNA binding protein CsdA in the fungus is reduced, and the growth rate of the fungus is slowed down.

[0034] Furthermore, in the application described in the second aspect above, the expression level and / or activity of the RNA binding protein CsdA in the fungus is reduced, and the conidia germination rate of the fungus is reduced.

[0035] Furthermore, in the application described in the third aspect above, the expression level and / or activity of the RNA binding protein CsdA in the pathogenic fungus is reduced, and the virulence of the pathogenic fungus is enhanced.

[0036] Furthermore, in the application described in the fourth aspect above, the expression level and / or activity of the RNA binding protein CsdA in the pathogenic fungus is reduced, and the drug resistance of the pathogenic fungus is weakened.

[0037] In the application, the RNA binding protein CsdA can be used as a target to prepare a product for resisting the infection of the pathogenic fungus.

[0038] In a fifth aspect, the present invention claims protection for any of the following methods:

[0039] Method I: A method for regulating fungal secondary metabolites, comprising the step of reducing or increasing the expression level and / or activity of RNA binding protein CsdA in a recipient fungus.

[0040] Method II: A method for preparing fungal melanin and / or pesteic acid, comprising the step of reducing the expression level and / or activity of RNA binding protein CsdA in a recipient fungus, thereby preparing fungal melanin and / or pesteic acid.

[0041] Method III: A method for delaying fungal growth, comprising the step of reducing the expression level and / or activity of RNA binding protein CsdA in a recipient fungus.

[0042] Method IV: A method for reducing the conidia germination rate of fungi, comprising the step of reducing the expression level and / or activity of RNA binding protein CsdA in a recipient fungus.

[0043] Method V: A method for improving the virulence of pathogenic fungi, comprising the step of reducing the expression level and / or activity of RNA binding protein CsdA in the recipient pathogenic fungi.

[0044] Method VI: A method for reducing drug resistance of pathogenic fungi, comprising the step of reducing the expression level and / or activity of RNA binding protein CsdA in the recipient pathogenic fungi.

[0045] The RNA binding protein CsdA is any one of the proteins (A1)-(A5) in the first aspect above.

[0046] In a sixth aspect, the present invention claims protection for any of the following methods:

[0047] Method I': A method for regulating fungal secondary metabolites, comprising the following steps: inhibiting the expression of a nucleic acid molecule capable of expressing RNA binding protein CsdA in a receptor fungus to obtain a transgenic fungus; the transgenic fungus has a secondary metabolite content that is more than 50% different from that of the receptor fungus.

[0048] Method II': A method for preparing fungal melanin and / or pesteic acid, comprising the following steps: inhibiting the expression of a nucleic acid molecule capable of expressing RNA binding protein CsdA in a recipient fungus to obtain a transgenic fungus; the transgenic fungus has a significantly increased content of melanin and / or pesteic acid compared to the recipient fungus; and then preparing fungal melanin and / or pesteic acid from the transgenic fungus.

[0049] Method III': A method for delaying fungal growth, comprising the following steps: inhibiting the expression of a nucleic acid molecule capable of expressing RNA binding protein CsdA in a recipient fungus to obtain a transgenic fungus; the transgenic fungus grows slower than the recipient fungus.

[0050] Method IV': A method for reducing the conidia germination rate of fungi, comprising the following steps: inhibiting the expression of a nucleic acid molecule capable of expressing RNA binding protein CsdA in a recipient fungus to obtain a transgenic fungus; the transgenic fungus has a lower conidia germination rate than the recipient fungus.

[0051] Method V': A method for improving the virulence of pathogenic fungi, comprising the following steps: inhibiting the expression of a nucleic acid molecule capable of expressing RNA binding protein CsdA in a recipient pathogenic fungus to obtain a transgenic pathogenic fungus; the transgenic pathogenic fungus has improved virulence compared to the recipient pathogenic fungus.

[0052] Method VI': A method for reducing the drug resistance of pathogenic fungi, comprising the following steps: inhibiting the expression of a nucleic acid molecule capable of expressing RNA binding protein CsdA in a recipient pathogenic fungus to obtain a transgenic pathogenic fungus; the transgenic pathogenic fungus has reduced drug resistance compared to the recipient pathogenic fungus.

[0053] In each of the above methods, the RNA binding protein CsdA is any one of the proteins (A1)-(A5) in the first aspect above.

[0054] Furthermore, inhibiting the expression of the nucleic acid molecule capable of expressing the RNA binding protein CsdA in the recipient fungus (or the recipient pathogenic fungus) can be achieved by homologous recombination technology.

[0055] In one specific embodiment of the present invention, the recipient fungus is Pestalotiopsis fici, and the corresponding fragment introduced into the recipient fungus during the homologous recombination is the DNA fragment shown in SEQ ID No. 5. In another specific embodiment of the present invention, the recipient fungus (or the recipient pathogenic fungus) is Aspergillus fumigatus, and the corresponding fragment introduced into the recipient fungus (or the recipient pathogenic fungus) during the homologous recombination is the DNA fragment shown in SEQ ID No. 6.

[0056] In the above aspects, the nucleic acid molecule capable of expressing the RNA binding protein CsdA may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or pre-mRNA.

[0057] Furthermore, the nucleic acid molecule capable of expressing the RNA binding protein CsdA may specifically be any of the following:

[0058] (B1) DNA molecule shown in SEQ ID No.4;

[0059] (B2) DNA molecule shown in SEQ ID No. 1;

[0060] (B3) A DNA molecule that has a homology of more than 99%, more than 95%, more than 90%, more than 85% or more than 80% with any of the DNA sequences defined in (B1) to (B2) and encodes the RNA binding protein CsdA.

[0061] In the above nucleic acid molecules, homology refers to the identity of nucleotide sequences. The identity of nucleotide sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage website.

[0062] In the above nucleic acid molecules, the homology of more than 95% may be at least 96%, 97%, 98% identity. The homology of more than 90% may be at least 91%, 92%, 93%, 94% identity. The homology of more than 85% may be at least 86%, 87%, 88%, 89% identity. The homology of more than 80% may be at least 81%, 82%, 83%, 84% identity.

[0063] In each of the above related aspects, the drug may be an azole drug.

[0064] In a specific embodiment of the present invention, the azole drug is itraconazole, posaconazole or voriconazole.

[0065] In each of the above related aspects, the fungus may be Aspergillus fumigatus or Pestalotiopsis fici.

[0066] In each of the above related aspects, the pathogenic fungus is Aspergillus fumigatus.

[0067] In a specific embodiment of the present invention, the Aspergillus fumigatus is specifically Aspergillus fumigatus Cea17-1 or Cea17-2, and the Pestalotiopsis fici is specifically Pestalotiopsis fici CGMCC3.15140.

[0068] The beneficial effects of the present invention are as follows: on the one hand, it helps to explore natural products with medicinal activity in fungi, and on the other hand, it helps to develop new drug targets for anti-fungal infection and reduce the chance of fungal infection.

[0069] The invention has important significance for the development of new drugs and antifungal infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0070] Figure 1 The 12% polyacrylamide gel electrophoresis result of the GST-CsdA recombinant protein of P.fici. The total RNA of P.fici was extracted and reverse transcribed into cDNA, from which the coding sequence of csdA was amplified, and then fused with pGEX-4T with a GST tag and expressed and purified in E. coli BL21. The target band was detected by 12% polyacrylamide gel, and the band size was 93.6kDa, which was consistent with the expected size. The target band was further cut out for protein spectrum identification, which further confirmed that the protein was GST-CsdA protein.

[0071] Figure 2 The 12% polyacrylamide gel electrophoresis result of the GST-CsdA recombinant protein of A. fumigatus. The total RNA of A. fumigatus was extracted and reverse transcribed into cDNA, from which the coding sequence of csdA was amplified, and then fused with pGEX-4T with a GST tag and expressed and purified in E. coli BL21. The target band was detected by 12% polyacrylamide gel, and the band size was 92.4kDa, indicating that the protein was the GST-CsdA protein of A. fumigatus.

[0072] Figure 3 1535 fungi containing CsdA homologous proteins in the NCBI genome database. By performing BlastP on the RNA binding protein CsdA in P. fici, a total of 1535 fungi containing CsdA homologous proteins with a homology of more than 40% were retrieved. These homologous fungi are widely distributed in the Sordariomycetes, Leotiomycetes, Dothideomycetes, Eurotiomycetes, and Pezizomycetes of the Ascomycota.

[0073] Figure 4The principle and strain verification of csdA gene knockout in P.fici. A is a schematic diagram of csdA gene knockout. B is PCR verification of csdA gene knockout strain. C is the phenotype of csdA gene knockout strain. First, three different gene fragments were fused to form a knockout fragment by PCR, and then the fragment was introduced into the control strain of P.fici by polyethylene glycol-mediated protoplast transformation. The first round of antibiotic screening was performed by adding G418 to the culture medium. The positive transformants grown in the culture medium were further verified by PCR. P1 (PfcsdA_RTF and PfcsdA_RTR), P2 (PfcsdA_5FF and G418_scr_R), and P3 (G418_scr_F and PfcsdA_3FR) in the schematic diagram represent the primer pairs used to screen positive transformants. As shown in the figure on the left below, there are 3 positive transformants (i.e., TYZS63.1, TYZS63.2, and TYZS63.3 in the figure), P1 can amplify a target band of 1385bp in the control strain, but no target band in the positive transformants; P2 and P3 cannot amplify target bands in the control strain, but can amplify target bands in the positive transformants, with sizes of 1820bp and 1826bp, respectively. As shown in the figure on the right below, one of the positive transformants was inoculated into PDA medium and cultured at 25°C for 5 days. The results showed that the strain grew slower than the control and had a certain degree of melanin accumulation phenotype.

[0074] Figure 5The principle and strain verification of csdA gene knockout in A. fumigatus. A is a schematic diagram of csdA gene knockout. B is PCR verification of csdA gene knockout strain. C is the phenotype of csdA gene knockout strain. First, three different gene fragments were fused to form a knockout fragment by PCR, and then the fragment was introduced into the control strain of A. fumigatus by polyethylene glycol-mediated protoplast transformation. The first round of nutritional screening was performed by lacking uracil and uridine in the culture medium (transformants containing pyrG gene can grow on the culture medium lacking uracil and uridine). The positive transformants grown in the culture medium were further verified by PCR. P4 (AfcsdA_RTF and AfcsdA_RTR), P5 (AfcsdA_5FF and pyrG_scr_R), and P6 (pyrG_scr_F and AfcsdA_3FR) in the schematic diagram represent the primer pairs used to screen positive transformants. As shown in the left figure below, there are 3 positive transformants (i.e., TYSZL12.1, TYSZL12.2, and TYSZL12.3 in the figure), P4 can amplify a target band of 543bp in the control strain, but no target band in the positive transformants; P5 and P6 cannot amplify target bands in the control strain, but can amplify target bands in the positive transformants, with sizes of 1348bp and 1140bp, respectively. As shown in the right figure below, one of the positive transformants was inoculated into GMM medium and cultured at 37°C for 5 days. The results showed that the growth rate of the strain was significantly slower than that of the control.

[0075] Figure 6 The changes in metabolite ion products between the csdA gene knockout strain and the control strain of P. fici. The metabolite ion products that changed between the csdA gene mutant and the control strain were analyzed by high-resolution mass spectrometry LC-HRMS. A total of 5570 metabolite ion products were detected. Among them, 3063 (55%) metabolite ion products changed significantly in the csdA gene mutant (|Log2foldchange|>1), 1615 (29%) ion product abundances were significantly upregulated (red), and 1448 (26%) ion product abundances were significantly downregulated (green). These results show that more than half of the metabolites are regulated by csdA. As shown in the figure on the right, typical secondary metabolites in P. fici such as DHN-melanin, pesteic acid, asperpentyn, iso-A82775C, siccayne, pestalofone A and pestaloficid M were significantly regulated. Therefore, the csdA gene can be applied to the regulation of secondary metabolites of P. fici, especially showing great application potential in the discovery of novel active secondary metabolites.

[0076] Figure 7 The changes in metabolic ion products between the csdA gene knockout strain and the control strain of A. fumigatus. The metabolic ion products that changed between the csdA gene mutant and the control strain were analyzed by high-resolution mass spectrometry LC-HRMS. A total of 5081 metabolic ion products were detected. Among them, 1321 (26%) metabolic ion products changed significantly in the csdA gene mutant (|Log2foldchange|>1), 406 (8%) ion product abundances were significantly upregulated, and 915 (18%) ion product abundances were significantly downregulated. As shown in the figure on the right, typical secondary metabolites in A. fumigatus such as fumigaclavine A, fumigaclavine C, fumiquinazoline A, fumiquinazoline C, fumiquinazoline D, pyripyropene A, tryprostatin B, pseurotin A and gliotoxin were significantly regulated. Therefore, the csdA gene can be widely used in the regulation of fungal secondary metabolites to control the synthesis of fungal secondary metabolites.

[0077] Figure 8 The figure shows the survival curve of mice infected with the csdA knockout strain and the control strain of A. fumigatus. First, the csdA knockout mutant of A. fumigatus and the control strain were inoculated into SMM medium and cultured at 37°C for 3-4 days. The spores were washed with PBS solution and filtered. The number of spores was counted by hemocytometer and the spore concentration was adjusted to 1×10 8 Each immunosuppressed BalB / C mouse was intranasally fed with 20 μL of A. fumigatus spores, and the control group was fed with an equal volume of PBS solution instead. The weight changes of the mice were observed and recorded every day. After 12 days of infection, the survival curve of the mice was statistically analyzed and plotted. The results showed that the csdA knockout mutant had stronger virulence than the control strain, indicating that CsdA negatively regulates the virulence of A. fumigatus. Therefore, CsdA can be used as an important target for regulating the virulence of A. fumigatus, and genetic modification can be used to slow down the infection of A. fumigatus.

[0078] Fig. 9 The sensitivity of csdA knockout strains and control strains of A. fumigatus to azole drugs was determined. First, the csdA knockout mutant of A. fumigatus and the control strain were inoculated into SMM medium and cultured at 37°C for 3-4 days. The spores were washed with 0.1% Tween aqueous solution and filtered. The number of spores was counted by hemocytometer and the spore concentration was adjusted to 1×106 / mL. Take 1μL of the spore liquid and inoculate it into GMM medium containing different working concentrations of azole drugs, culture at 37℃ for 3-4 days, measure the colony diameters of different strains, and use GMM medium containing an equal volume of DMSO as a control. The relative growth of different strains was calculated by the formula (colony diameter at different concentrations / colony diameter of the control group). The results showed that compared with the control strain of A. fumigatus, the csdA gene knockout strain showed stronger drug sensitivity. This result indicates that the csdA gene is related to the tolerance of A. fumigatus to azole drugs, and has important application potential in improving the drug resistance of A. fumigatus.

[0079] Fig.10 Comparison of the growth and development of the csdA gene knockout strain and the control strain of P. fici. A is a comparison of growth rates. B is a comparison of the number of conidia. C is a comparison of conidia morphology. As shown in A, the csdA mutant and its control strain were first inoculated on PDA medium and cultured at 25°C for 5 days. The colony diameter was recorded every day, and 5 replicates were set for each strain. The results showed that the colony diameter of the csdA mutant was significantly lower than that of the control strain on days 1-5. As shown in B, the csdA mutant and its control strain were inoculated on PDA medium and cultured at 25°C for 14 days. The conidia were washed with 0.1% Tween 80 solution (volume / volume) and their number was counted using a hemocytometer. The results showed that the number of conidia of the csdA mutant was nearly 60 times higher than that of the control strain. As shown in C, the morphology of the conidia was continued to be observed under a microscope, and the results showed that the conidia morphology of the csdA mutant was no longer a regular morphology consisting of 5 specialized cells. These results suggest an important role for csdA in regulating the growth and development of P. fici.

[0080] Fig.11Comparison of the growth and development of the csdA knockout strain and the control strain of A. fumigatus. A is a comparison of growth rates. B is a comparison of the number of conidia. C is a comparison of conidia morphology. The first row is the microscopic morphological observation of the control strain of Aspergillus fumigatus, and the second row is the microscopic morphological observation of the csdA knockout strain. As shown in A, the csdA mutant and its control strain were first inoculated on GMM medium and cultured at 37°C for 5 days. The colony diameter was recorded every day, and 5 replicates were set for each strain. The results showed that the colony diameter of the csdA mutant was significantly lower than that of the control strain on days 1-5. As shown in B, the csdA mutant and its control strain were inoculated on GMM medium and cultured at 37°C for 5 days. The conidia were washed with 0.1% Tween 80 solution (volume / volume) and their number was counted using a hemocytometer. The results showed that the number of conidia of the csdA mutant was significantly lower than that of the control strain. As shown in C, the morphology of conidia was further observed under a microscope, and the results showed that the conidia of the csdA mutant were no longer regular. These results indicate that csdA plays an important role in regulating the growth and development of A. fumigatus.

[0081] Fig.12 The conidia germination rate of the csdA gene knockout strain and the control strain of A. fumigatus was compared. First, the csdA mutant and its control strain were inoculated on GMM medium and cultured at 37°C for 5 days. The conidia were washed with 0.1% Tween 80 solution (vol / vol) and counted using a hemocytometer. The number of conidia of the csdA mutant and the control strain was adjusted to 1×10 8 / mL. 1mL of conidia of the csdA mutant and its control strain were inoculated into 100mL Erlenmeyer flasks containing 30mL LMM medium, with 3 replicates for each strain. The culture was carried out at 37℃ and 200rpm for 10 hours. The results showed that both the csdA mutant and its control strain began to germinate from the 4th hour. However, the germination rate of the control strain reached 100% at the 8th hour, and the germination rate of the csdA mutant at the 8th hour was 66%, indicating that the loss of csdA in A. fumigatus can significantly reduce the germination rate of conidia, and this gene can be used to control the conidial germination process of fungi.

[0082] In each figure, * indicates p﹤0.05; ** indicates p﹤0.01; *** indicates p﹤0.001; **** indicates p﹤0.0001; all indicate statistically significant differences compared with the control. DETAILED DESCRIPTION

[0083] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0084] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0085] Aspergillus fumigatus Cea17-1 and Cea17-2: Both are recorded in the article "Wen-Bing Yin, et al. A Nonribosomal Peptide Synthetase-derived Iron(III) Complex from the Pathogenic Fungus Aspergillus fumigatus. Journal of the American Chemical Society, Pub Date: 2013-02-01, DOI: 10.1021 / ja311145n", which can be obtained by the public from the applicant and can only be used to repeat the experiments of the present invention and cannot be used for other purposes.

[0086] pAG1-H3-G418 plasmid: recorded in the article "Lu Yang, et al. Combination Strategy of Genetic Dereplication and Manipulation of Epigenetic Regulators Reveals A Novel Compound from Plant Endophytic Fungus. Int J Mol Sci. 2022Mar 28; 23(7): 3686. doi: 10.3390 / ijms23073686.", which can be obtained by the public from the applicant and can only be used to repeat the experiments of the present invention and cannot be used for other purposes.

[0087] pYH-WA-pyrG plasmid: recorded in “Peng Zhang, et al. A cryptic pigment biosynthetic pathway uncovered by heterologous expression is essential for conidial development in Pestalotiopsis fici. Mol Microbiol. 2017Aug;105(3):469-483.doi:10.1111 / mmi.13711.Epub 2017Jun 6.”, which is available to the public from the applicant and can only be used to repeat the experiments of the present invention and cannot be used for other purposes.

[0088] Example 1: Identification of RNA-binding protein CsdA, a global regulator of secondary metabolite biosynthesis

[0089] 1. Cloning of cDNA of RNA binding protein CsdA gene from Pestalotiopsis fici CGMCC 3.15140 (available from China General Microbiological Culture Collection Center): (1) Extraction of total RNA from Pestalotiopsis fici CGMCC 3.15140. A small piece of mycelium was taken from the slant of a test tube stored at 4°C and placed on PDA medium (Beijing Xinkailong Biotechnology Co., Ltd., Catalog No. 213400) for activation at 25°C for 2-3 days. A small piece of mycelium was then picked out and transferred to fresh PDA medium covered with cellophane and grown at 25°C for 4-5 days. The entire mycelium was then scraped and fully ground in liquid nitrogen. Total RNA was immediately extracted using an RNA extraction kit (Beijing Boyu Biotechnology Co., Ltd., Catalog No. CW0581S). (2) Cloning of cDNA of RNA binding protein CsdA gene in Pestalotiopsis fici CGMCC 3.15140. The total RNA obtained was reverse transcribed into cDNA using a reverse transcription kit (Hunan Aikerui Biotechnology Co., Ltd., catalog number AG11615). The reverse transcription product was used as a template for PCR amplification of CsdA gene cDNA. The primer sequences are as follows: PfCsdA_cDNA_F: 5'-ATGTCTACTGTACCGCCTCAAC-3', PfCsdA_cDNA_R: 5'-GGCAGCAGGAGACTTGCTC-3'. The PCR reaction system is: 1 μL of the above cDNA, 1 μL of each primer (10 μM), 10 μL of Fastpfu buffer, 4 μL of dNTP (2.5 mM), 1 μL of Fastpfu polymerase, and water is added to 50 μL. The PCR amplification conditions were: 95°C, 2 minutes; (95°C, 20 seconds; 58°C, 20 seconds; 72°C, 1 minute) for 35 cycles; 72°C, 10 minutes. The PCR product was purified by gel recovery after 1% agarose gel electrophoresis to obtain the cDNA of the RNA binding protein CsdA gene in P. fici, the sequence of which was SEQ ID No. 1 and the length was 1902 bp.

[0090] 2. Construction of recombinant expression vector or expression cell of RNA binding protein CsdA in P. fici: The cDNA obtained above (SEQ ID No. 1) was connected to the GST tag of pGEX-4T-1 plasmid (Shenzhen Yibaishun Technology Co., Ltd., catalog number pGEX-4T-1) ( Figure 1 ), introduced into Escherichia coli DH5α, and verified by colony PCR and restriction digestion to obtain the correct CsdA recombinant expression vector, which was then introduced into Escherichia coli BL21 to obtain CsdA expression bacteria.

[0091] 3. Extraction and identification of RNA binding protein CsdA in P. fici: CsdA expressing bacteria were collected by centrifugation (4000 rpm, 20 min), and CsdA protein was extracted using a GST protein extraction kit (Hefei Huaxia Yuanyang Biotechnology Co., Ltd., catalog number P2262). Then, the target protein band was detected by 12% SDS polyacrylamide gel electrophoresis ( Figure 1 ), the significantly expressed protein band was cut out and identified by mass spectrometry, and its sequence was SEQ ID No.2, with a length of 634 amino acids, and the total protein size after fusion with the GST tag was 93.6 kDa.

[0092] 4. Identification of RNA binding protein CsdA in Aspergillus fumigatus Cea17-1: By BLAST comparison of SEQ ID No.2 in NCBI, we obtained the CsdA sequence of A. fumigatus Cea17-1 with a homology of 74.88%, which is SEQ ID No.3, with a length of 613 amino acids, and the total protein size after fusion with GST tag is 92.4 kDa ( Figure 2 ). The cDNA cloning, recombinant expression vector construction, and protein extraction of CsdA in A. fumigatus were the same as those described in P. fici. The primer sequences for cDNA amplification were as follows: AfCsdA_cDNA_F: 5'-ATGGCAACCGTCTCAGCAC-3', AfCsdA_cDNA_R: 5'-AGCAGGGGACTTGCTGGC-3'. The cDNA sequence was SEQ ID No. 4, with a length of 1839 bp.

[0093] 5. Homology of the global regulatory factor RNA binding protein CsdA in fungi: By performing BlastP on the RNA binding protein CsdA in P. fici, a total of 1535 fungi containing CsdA homologous proteins with a homology of more than 40% were retrieved. These homologous fungi are widely distributed in the Sordariomycetes, Leotiomycetes, Dothideomycetes, Eurotiomycetes, Pezizomycetes (Ascomycota) Figure 3 These results suggest that the global regulatory factor RNA-binding protein CsdA has important application potential in the regulation of secondary metabolites in ascomycetes.

[0094] Example 2: Construction of a knockout strain of the csdA gene encoding a global regulatory factor in fungi

[0095] 1. Construction of knockout fragment of csdA gene encoding global regulatory factor in P. fici

[0096] (1) Amplification of gene knockout fragments:

[0097] Using primers PfcsdA_5FF (5'-GACAAGCCAGTGCTACCTTC-3') and PfcsdA_5FR (5'-CTGAATGGCGAATGG AAATTGTA AGCGTTAATCTAGAGATGGGCAGCTTCAAT GTATAC-3') and genomic DNA of Pestalotiopsis fici CGMCC 3.15140 as a template, a fragment of about 1500 bp upstream of the csdA gene was amplified.

[0098] Using PfcsdA_3FF (5'-CGCTTTGAAGTTCCTATTCCGAAGTTCCTATTCTCTAGAGGACCT CTGAGGACCGCTC-3') and PfcsdA_3FR (5'-CGTGGCAACCTAAGCAGATAG-3') as primers and the genomic DNA of Pestalotiopsis fici CGMCC 3.15140 as template, a fragment of about 1500 bp downstream of the csdA gene was amplified.

[0099] Using G418_F (5'-TCTAGATTAACGCTTACAATTTCCATTCGC-3') and G418_R (5'-TCTAGAGAATAGGAACTTCGGAATAGGAAC-3') as primers and pAG1-H3-G418 plasmid as template, the G418 resistance gene of about 2000 bp was amplified.

[0100] The PCR reaction system and reaction conditions were the same as those described in Example 1.

[0101] (2) The three fragments are further fused into one fragment through a second round of PCR.

[0102] PCR reaction system: 1 μL (150 ng) of the upstream fragment of the csdA gene, 4 μL (600 ng) of the G418 resistance gene, 1 μL (150 ng) of the downstream fragment of the csdA gene, 5 μL of Fastpfu buffer, 2 μL of dNTP (2.5 mM), 1 μL of Fastpfu polymerase, and add deionized water to 25 μL.

[0103] PCR reaction conditions: 95°C, 3 minutes; (95°C, 30 seconds; 58°C, 10 seconds; 72°C, 2.5 minutes) for 11 cycles; 72°C, 10 minutes.

[0104] Note: This step relies on the spontaneous ligation of the overlapping regions at the junctions of the three fragments. Method article link https: / / www.sciencedirect.com / science / article / pii / S1087184504001185? via%3Dihub.

[0105] (3) Using the second round of PCR amplification product as a template, a third round of PCR amplification was performed to obtain the csdA gene knockout fragment.

[0106] The primer sequences are:

[0107] PfcsdA_nest_F: 5'-GAAGTTGGAGGAGCAGTGATC-3';

[0108] PfcsdA_nest_R: 5'-GTGACATTGCTTGCAGTGAC-3'.

[0109] The PCR reaction system and reaction conditions were the same as those described in Example 1.

[0110] The nucleotide sequence of the finally obtained csdA gene knockout fragment is shown in SEQ ID No. 5. Positions 1-1273 of SEQ ID No. 5 are the upstream sequence of the csdA gene, positions 1274-3332 are the G418 resistance gene sequence, and positions 3333-4677 are the downstream sequence of the csdA gene.

[0111] 2. Knockout of csdA, the gene encoding the global regulatory factor in P. fici

[0112] (1) Preparation of P. fici protoplasts: Mycelia of Pestalotiopsis fici CGMCC 3.15140 growing on PDA were scraped into PDB medium and cultured at 25°C for 2 days. The cells were then crushed using a high-throughput tissue grinder (70 Hz, 1 min). The crushed cells were pipetted into TG medium and cultured at 25°C for 12 hours. The cells were collected by filtration and placed in a Lysing Enzymes solution (30 mg / mL). The cells were enzymatically hydrolyzed at 25°C, 100 rpm for 4-6 hours. The protoplasts were collected by centrifugation (4°C, 5000 rpm, 8 minutes), and the protoplasts were resuspended in 0.6 M potassium chloride solution.

[0113] TG medium: 10 g glucose, 1 g tryptone, dissolved in 100 mL distilled water, sterilized by high pressure steam at 121°C for 20 min.

[0114] 0.6 M potassium chloride solution: Dissolve 50 mM calcium chloride and 0.6 M potassium chloride and sterilize by high pressure steam at 121°C for 20 minutes.

[0115] (2) Introduction of csdA gene knockout fragment into host cells: The csdA gene knockout fragment (SEQ ID No. 5) obtained in step 1 was added to the above 100 μL protoplasts, mixed with 50 μL 25% polyethylene glycol (mass / volume), and then placed on ice for 30 minutes. Then, 1 mL 25% polyethylene glycol was added, mixed, and then placed at room temperature for 30 minutes. The above mixture was mixed with 100 mL PDSSA medium, poured into a culture dish, and cultured at 25° C. for 24 hours. A layer of PDA medium with G418 resistance was covered on the medium, and cultured at 25° C. for 2-4 days.

[0116] PDSSA medium: 0.6 M sucrose, 1% honey (volume / volume), 3.9% PDA medium (mass / volume), sterilized by high pressure steam at 115°C for 30 minutes.

[0117] (3) Verification of csdA gene knockout strain: The hyphae grown in the above-mentioned PDA medium with G418 resistance were inoculated into PDB medium and cultured at 25°C for 2 days. DNA was extracted using a DNA extraction kit (Beijing Bomade Gene Technology Co., Ltd., catalog number DL116-01) for PCR verification.

[0118] Verify primer sequences:

[0119] PfcsdA_5FF: 5'-GACAAGCCAGTGCTACCTTC-3';

[0120] G418_scr_R: 5'-GGTGCTTGACTGGCACTG-3';

[0121] PfcsdA_RTF: 5'-CTCGGAGAATCGCGTCATTG-3';

[0122] PfcsdA_RTR: 5'-GGAACAACACCACTTCCACC-3';

[0123] G418_scr_F: 5'-GAGGAGTGGCAGCATATAGAACAG-3';

[0124] PfcsdA_3FR: 5'-CGTGGCAACCTAAGCAGATAG-3'.

[0125] PCR reaction system: 0.5 μL of the above genomic DNA, 0.2 μL of each primer (10 μM), 5 μL of 2×GS Taq mix, and water to make up to 10 μL. PCR amplification conditions: 94°C, 5 minutes; (94°C, 30 seconds; 58°C, 30 seconds; 72°C, 15 seconds) for 35 cycles; 72°C, 10 minutes. Detect PCR products by 1% agarose gel electrophoresis to obtain the correct csdA gene knockout strain ( Figure 4 One of the positive transformants was inoculated into PDA medium and cultured at 25°C for 5 days. The results showed that the strain grew slower than the control (untransformed P. fici) and had a certain degree of melanin accumulation phenotype (melanin is a secondary metabolite directly visible to the naked eye and is one of the typical examples of regulated secondary metabolites).

[0126] 3. Construction of knockout fragment of csdA gene encoding global regulatory factor in A. fumigatus:

[0127] (1) Amplification of gene knockout fragments: Amplify the csdA gene upstream and downstream fragments of about 1000 bp and the nutritional screening marker pyrG gene fragment of 1668 bp (used to screen positive transformants. Positive transformants contain this gene and can grow on a medium lacking uracil and uridine, while negative transformants do not contain this gene and cannot grow on this medium).

[0128] Using AfcsdA_5FF (5'-CTGGGCAAGAAGCATGGCTC-3') and AfcsdA_5FR (5'-CACAACA TATTTCGTCAGACACAGAATAACTCTCCGCTCAGATTGTTGTCTTCT TTTCC-3') as primers and genomic DNA of Aspergillus fumigatus Cea17-1 as template, a fragment of about 1000 bp upstream of the csdA gene was amplified.

[0129] Using AfcsdA_3FF (5'-GCTTGGCATCACGCATCAGTGCCTCCTCTCAGACAGAATGAGCGGGAACACCTCTTTGG-3') and AfcsdA_3FR (5'-GCAGTTGCCTCAGAGCTCTCAG-3') as primers and the genomic DNA of Aspergillus fumigatus Cea17-1 as a template, a fragment of about 1000 bp downstream of the csdA gene was amplified.

[0130] Using pyrG_F (5'-GAGAGTTATTCTGTGTCTGACGA-3') and pyrG_R (5'-ATTCTGTCTGAGAGGAGGCA-3') as primers and plasmid pYH-WA-pyrG as template, a 1668 bp fragment of the nutritional screening tag pyrG gene was amplified.

[0131] The PCR reaction system and reaction conditions were the same as those described in Example 1.

[0132] (2) The three fragments from the first round are fused into one fragment through a second round of PCR.

[0133] PCR reaction system: 1 μL (150 ng) of the upstream fragment of csdA gene, 4 μL (600 ng) of the pyrG gene, 1 μL (150 ng) of the downstream fragment of csdA gene, 5 μL of Fastpfu buffer, 2 μL of dNTP (2.5 mM), 1 μL of Fastpfu polymerase, and add deionized water to 25 μL.

[0134] PCR reaction conditions: 95°C, 3 minutes; (95°C, 30 seconds; 58°C, 10 seconds; 72°C, 2.5 minutes) for 11 cycles; 72°C, 10 minutes.

[0135] (3) Using the second-round PCR product as a template, a third-round PCR amplification was performed to obtain the csdA gene knockout fragment.

[0136] The primer sequences are:

[0137] AfcsdA_nest_F: 5'-CAGGAAGTGATGGACGTGGAATC-3';

[0138] AfcsdA_nest_R: 5'-CCATGGCAGGTATATGACAGTCC-3'.

[0139] The PCR reaction system and reaction conditions were the same as those described in Example 1.

[0140] The nucleotide sequence of the csdA gene knockout fragment finally obtained is shown in SEQ ID No. 6. The 1st to 1097bp positions of SEQ ID No. 6 are the upstream sequence of the csdA gene, the 1098-2765bp positions are the sequence of the pyrG gene, and the 2766-3771bp positions are the downstream sequence of the csdA gene.

[0141] 4. Knockout of csdA, a gene encoding a global regulatory factor in A. fumigatus:

[0142] (1) Preparation of A. fumigatus protoplasts: Inoculate 1 μL of A. fumigatus Cea17-1 glycerol stock stored in a -80°C refrigerator onto GMM medium (supplemented with 0.5 mg of uracil and 0.5 mg of uridine per mL of medium), activate at 37°C for 24 hours, collect spores with 0.1% Tween water (volume / volume), streak onto SMM medium (supplemented with 0.5 mg of uracil and 0.5 mg of uridine per mL of medium), culture at 37°C for 3 days, collect spores with 0.1% Tween water (volume / volume), and store at 4°C for later use. Take 1 mL of spore solution and inoculate it into 30 mL of LMM medium (supplemented with 0.5 mg of uracil and 0.5 mg of uridine per mL of medium), germinate at 37°C, 200 rpm for 6-8 hours, and collect germinated spores by centrifugation (4°C, 8000 rpm, 15 minutes). Pick the germinated spores onto Pro solution, 25 ℃, 100 rpm enzymolysis for 12 hours, after obtaining protoplasts, pour into 50 mL centrifuge tube, add 10 mL Trapping buffer, centrifuge (4 ℃, 5000 rpm, 15 minutes) to collect protoplasts, and resuspend the protoplasts with STC solution and store on ice.

[0143] GMM medium: 10 g glucose, 50 mL nitrogen salt, 1 mL trace elements, pH 6.5, 1.6% agar powder (mass / volume), dilute to 1 L with distilled water, and sterilize with high-pressure steam at 121°C for 20 minutes.

[0144] SMM medium: 10 g glucose, 50 mL nitrogen salt, 1 mL trace elements, 218.6 g sorbitol, pH 6.5, 1.6% agar powder (mass / volume), dilute to 1 L with deionized water, and sterilize with high pressure steam at 121°C for 20 minutes.

[0145] LMM medium: 10 g glucose, 50 mL nitrogen salt, 1 mL trace elements, 5 g yeast extract, pH 6.5, dilute to 1 L with distilled water, and sterilize with high-pressure steam at 121°C for 20 minutes.

[0146] Pro solution: 0.64g Pro was dissolved in 10 mL of osmatic solution.

[0147] Osmatic solution: 73.95 g magnesium sulfate heptahydrate, 0.115 g disodium hydrogen phosphate, 0.265 g sodium dihydrogen phosphate, pH 5.8, dissolved in 250 mL deionized water, and sterilized by filtration with a 0.22 μm filter membrane.

[0148] Trapping buffer: 109.3 g sorbitol, 100 mL Tris-HCl (pH 7.5), dilute to 1 L with deionized water, and sterilize with high pressure steam at 121° C. for 20 minutes.

[0149] STC solution: 218.6 g sorbitol, 1.47 g calcium chloride dihydrate, 10 mL Tris-HCl (pH 7.5), dilute to 1 L with deionized water, and sterilize with high-pressure steam at 121° C. for 20 minutes.

[0150] (2) Introduction of csdA gene knockout fragment into A. fumigatus host cells: The csdA gene knockout fragment (SEQ ID No. 6) obtained in step 3 was added to the above 100 μL protoplasts and placed on ice for 50 minutes. After adding 1.25 mL of 60% polyethylene glycol (mass / volume), the mixture was placed at room temperature for 20 minutes. Then, 5 mL of STC solution was added, mixed and added to SMM medium (containing no uracil and uridine). SMM medium (containing no uracil and uridine) with half the agar powder was poured into the protoplasts on the plate and mixed evenly. The mixture was cultured at 37° C. for 2-3 days.

[0151] (3) Verification of csdA gene knockout strain in A. fumigatus: Scrape the hyphae grown in the above SMM medium into GMM medium (which does not contain uracil and uridine at this time; positive transformants contain the pyrG gene and can grow on a medium without uracil and uridine). After spore production, take a small amount of spores into LMM medium and culture them at 37°C for 12 h. Extract DNA using a DNA extraction kit for PCR verification.

[0152] Verify primer sequences:

[0153] AfcsdA_5FF: 5'-CTGGGCAAGAAGCATGGCTC-3';

[0154] pyrG_scr_R: 5'-CTGTATTCCTCCGCCTCCGAC-3';

[0155] AfcsdA_RTF: 5'-CCTGCGAGGAGGTGGGTTC-3';

[0156] AfcsdA_RTR: 5'-CAGCTGCACTCGGAGATCCC-3';

[0157] pyrG_scr_F: 5'-CAGGACAAGTCGACCTGTGC-3';

[0158] AfcsdA_3FR: 5'-GCAGTTGCCTCAGAGCTCTCAG-3'.

[0159] The PCR reaction system and reaction conditions were the same as those described in step 2. The PCR products were detected by 1% agarose gel electrophoresis to obtain the correct csdA gene A. fumigatus knockout strain ( Figure 5 ). One of the positive transformants was inoculated into GMM medium and cultured at 37°C for 5 days. The results showed that the growth rate of the strain was significantly slower than that of the control (untransformed A. fumigatus).

[0160] Example 3: Application of csdA gene in the regulation of fungal secondary metabolites

[0161] 1. Application of csdA gene in the regulation of secondary metabolites of P. fici

[0162] (1) The csdA knockout mutant of P. fici obtained in Example 2 and the control strain (untransformed P. fici) were inoculated on PDA medium, with three replicates for each strain, and cultured at 25°C for 7 days to detect secondary metabolites. The cultured strains and the culture medium were then cut into 1 cm 2 The small pieces were placed in a 100 mL Erlenmeyer flask, and 40 mL of ethyl acetate / methanol (volume ratio 9 / 1) was added. Ultrasonic extraction was performed for 1 hour, and the extract was completely evaporated to dryness by rotary evaporation. The extraction was repeated 3 times for each strain. 3 mL of chromatographic methanol was used to dissolve the extract, and 1 mL was taken for metabolome determination by LC-HRMS after filtering with a 0.22 μm filter membrane.

[0163] LC-HRMS conditions: ODS column ( MS, C18, 5 μm, 4.6×250 mm), column temperature 40°C, injection 10 μL, mobile phase methanol and water (containing 0.1% formic acid), gradient elution, flow rate 1 mL / min.

[0164] Mass spectrometry conditions: electrospray ionization (ESI) positive ion mode detection was used; the mass scan range was 80-2000 m / z.

[0165] Mobile phase elution conditions: 10%-30% methanol (0-10 minutes), 30%-70% methanol (10-40 minutes), 70%-90% methanol (40-50 minutes), 100% methanol (50.1-60 minutes), 10% methanol (60.1-65 minutes). % indicates volume percentage.

[0166] (2) Data processing and analysis: All the above LC-HRMS data were extracted by Agilent Mass hunter software and converted into a format containing retention time, m / z and ion peak density by XCMS software. By comparing the relative changes in ion products between the csdA gene mutant and the control strain, a total of 5570 metabolite ion products were detected. Among them, 3063 (55%) metabolite ion products changed in the csdA gene mutant (|Log2foldchange|>1), 1615 (29%) ion product abundances were significantly upregulated, and 1448 (26%) ion product abundances were significantly downregulated ( Figure 6 ). For example, the representative secondary metabolites with significant changes include pestheic acid (Log2foldchange=1.2), asperpentyn (Log2foldchange=-3.1), iso-A82775C (Log2foldchange=-4.7), siccayne (Log2foldchange=-2.9), Pestalofone A (Log2foldchange=-3.1), Pestaloficid M (Log2foldchange=-1.8), RES1214-1 (Log2foldchange=3.7), etc. Therefore, the csdA gene can be applied to the regulation of secondary metabolites of P. fici, especially in the mining of novel active secondary metabolites, showing great application potential.

[0167] 2. Application of csdA gene in the regulation of secondary metabolites in A. fumigatus

[0168] (1) The csdA knockout mutant of A. fumigatus obtained in Example 2 and a control strain (A. fumigatus Cea17-1, which was based on A. fumigatus Cea17-2 and only complemented with the pyrG gene to eliminate the interference caused by the introduction of the pyrG gene) were inoculated into SMM medium and cultured at 37° C. for 3-4 days. The spores were washed with 0.1% Tween water and filtered. The number of spores was counted by a hemocytometer. Each strain was inoculated with 1×10 7 The spores were added to 100 mL of liquid GMM medium, and 3 replicates were set up. The culture was cultured at 25°C and 200 rpm for 5 days for secondary metabolite extraction. 100 mL of ethyl acetate was directly added to the culture medium, and the organic reagent was evaporated by rotary evaporator at 25°C and 150 rpm for 1 hour. The extraction and evaporation were repeated 3 times. 3 mL of chromatographic methanol was used to dissolve the extract, and 1 mL was taken for metabolome determination by LC-HRMS after filtering with a 0.22 um filter membrane.

[0169] (2) Data processing and analysis: All the above LC-HRMS data processing was the same as described in P. fici. By comparing the changes in ion products between the csdA gene mutant and the control strain in A. fumigatus, a total of 5081 metabolite ion products were detected. Among them, 1321 (26%) metabolite ion products changed significantly in the csdA gene mutant (|Log2foldchange|>1), 406 (8%) ion product abundances were significantly upregulated, and 915 (18%) ion product abundances were significantly downregulated ( Figure 7 ). For example, the representative secondary metabolites with significant changes include the fungal toxins fumigaclavine A (Log2foldchange=3.4), fumigaclavine C (Log2foldchange=1.6), fumiquinazoline A (Log2foldchange=5.3), fumiquinazoline C (Log2foldchange=4.3), fumiquinazoline D (Log2foldchange=4.3), pyripyropene A (Log2foldchange=4.5), tryprostatin B (Log2foldchange=-2.3), pseurotin A (Log2foldchange=-2.1), and the famous gliotoxin gliotoxin (Log2foldchange=-2.9). Therefore, the csdA gene can be widely used in the regulation of fungal secondary metabolites and used to control the synthesis of fungal secondary metabolites.

[0170] Example 4: Application of csdA gene in regulating the virulence of pathogenic fungi

[0171] At present, A. fumigatus has been listed as one of the important pathogens threatening human health by the World Health Organization. It is known that A. fumigatus can cause severe pulmonary aspergillosis in immunodeficient patients, but the molecular mechanism of A. fumigatus pathogenicity is not clear, especially at the post-transcriptional regulation level of A. fumigatus. In this example, the csdA gene knockout strain of A. fumigatus obtained in Example 2 was used to infect immunosuppressed BalB / C mice to determine the role of the csdA gene in regulating the virulence of A. fumigatus.

[0172] First, the csdA knockout mutant of A. fumigatus obtained in Example 2 and the control strain (A. fumigatus Cea17-1, which was based on A. fumigatus Cea17-2 and only the pyrG gene was complemented to eliminate the interference caused by the introduction of the pyrG gene) were inoculated into SMM medium and cultured at 37° C. for 3-4 days. The spores were washed with PBS solution and filtered. The number of spores was counted by a hemocytometer, and the spore concentration was adjusted to 1×10 8 / mL, stored at 4℃ for later use. Immunosuppression of BalB / C mice: 6-week-old BalB / C male mice (approximately 20g) were purchased from Beijing Weitong Lihua Experimental Animal Technology Co., Ltd. On the first day, 100μL of cyclophosphamide solution (30mg cyclophosphamide dissolved in 1mL normal saline, filtered through 0.22μm filter membrane) was intraperitoneally injected. On the next day (the third day), 100μL of phosphamide solution was continued to be intraperitoneally injected. At the same time, 100μL of hydrocortisone sodium succinate solution (40mg hydrocortisone sodium succinate dissolved in 1mL normal saline, filtered through 0.22μm filter membrane) was subcutaneously injected. On the fourth day, after anesthesia with 1.25% Avertin solution, each mouse was intranasally fed 20μL of A. fumigatus spores, and the control group was replaced with an equal volume of PBS solution. There were 10 mice in each group. The weight changes of the mice were observed and recorded every day. Twelve days after infection, the survival curve of the mice was counted and plotted ( Figure 8 ), the results showed that the csdA knockout mutant had stronger virulence than the control strain, indicating that CsdA negatively regulates the virulence of A. fumigatus. Therefore, CsdA can be used as an important target for regulating the virulence of A. fumigatus, and genetic modification can be used to slow down A. fumigatus infection.

[0173] Example 5: Application of csdA gene in regulating drug resistance of pathogenic fungi

[0174] As the discovery of new drugs becomes increasingly difficult and antibiotics are abused, a large number of pathogenic fungi have developed drug resistance. A. fumigatus, one of the major pathogens threatening human health, is no exception. Currently, only three types of drugs are recommended for the treatment of aspergillosis, of which azoles are the first choice for the treatment of aspergillosis. Despite this, resistance to azoles is emerging rapidly, so it is crucial to find targets that regulate the tolerance of A. fumigatus to azoles. At present, it has been revealed that multiple transcription factors are involved in the tolerance of A. fumigatus to azoles at the transcriptional level, but regulation at the post-transcriptional level has not yet been reported.

[0175] RNA binding proteins are crucial for gene regulation at the post-transcriptional level. We determined the regulatory role of RNA binding protein CsdA in A. fumigatus on azole tolerance. We inoculated the csdA knockout mutant of A. fumigatus obtained in Example 2 and the control strain (A. fumigatus Cea17-1, which only complemented the pyrG gene on the basis of A. fumigatus Cea17-2 to eliminate the interference caused by the introduction of the pyrG gene) into SMM medium, cultured at 37°C for 3-4 days, washed the spores with 0.1% Tween aqueous solution and filtered, counted the number of spores by hemocytometer, and adjusted the spore concentration to 1×10 6 / mL, and save for later use. We selected three azole drugs, Itraconazole, Posaconazole or Voriconazole, for testing. First, we used DMSO to prepare different concentrations of mother solutions of Itraconazole (20mg / L), Posaconazole (10mg / L), and Voriconazole (10mg / L), and then diluted them into different working concentrations. The working concentrations of itraconazole were 0, 1.6, 1.8, 2.0, 2.2, 2.4, 2.6, 2.8, 3.0, 3.2, 3.4, 3.6, 3.8, 4.0 mg / L; the working concentrations of posaconazole were 0, 0.024, 0.028, 0.032, 0.036, 0.040, 0.044, 0.048, 0.052, 0.056, 0.06, 0.064, 0.068 mg / L; the working concentrations of voriconazole were 0, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20 mg / L. Take 1 μL of the above A. fumigatus spore solution and inoculate it on GMM medium containing different working concentrations of azole drugs, culture it at 37°C for 3-4 days, measure the colony diameters of different strains, and use GMM medium containing an equal volume of DMSO as a control. The relative growth of different strains is calculated by the formula (colony diameter at different concentrations / colony diameter of the control group). According to the relative growth of different strains, the minimum inhibitory concentration (MIC) of different drugs is analyzed, such as Fig. 9 As shown in the figure, the drug sensitivity of the csdA knockout strain was significantly enhanced compared with the control strain of A. fumigatus. This result shows that the csdA gene is positively correlated with the tolerance of A. fumigatus to azole drugs, and has important application potential in improving the drug resistance of A. fumigatus.

[0176] Example 6: Application of CsdA in regulating fungal growth and development

[0177] 1. Regulation of CsdA on the growth and development of P. fici

[0178] The CsdA mutant of P. fici obtained in Example 2 and its control strain (untransformed P. fici) were inoculated on PDA medium and cultured at 25°C for 5 days. The changes in colony diameter were recorded every day. Five replicates were set for each strain. Fig.10 As shown in the figure, the colony diameter of the CsdA mutant was significantly smaller than that of the control strain, indicating that CsdA positively regulated the growth rate of hyphae. The strains on the above PDA were cultured for 14 days, and the fungal spores in different plates were washed and filtered with 0.1% Tween 80. The number of conidia of the mutant and the control strain was counted using a hemocytometer. The results showed that the number of conidia of the CsdA mutant was 60 times higher than that of the control strain. Further, under a stereomicroscope, it was found that the number of conidiomata of the csdA mutant was significantly higher than that of the control strain. And under the microscope, the conidia morphology of the mutant was no longer a regular morphology formed by 5 specialized cells. These results indicate that CsdA plays an important role in maintaining the normal growth and development of P.fici and can be used to control the growth and development process of P.fici.

[0179] 2. Regulation of CsdA on the growth and development of A. fumigatus

[0180] The csdA knockout mutant of A. fumigatus obtained in Example 2 and the control strain (A. fumigatus Cea17-1, which is based on A. fumigatus Cea17-2 and only the pyrG gene is complemented to eliminate the interference caused by the introduction of the pyrG gene) were inoculated into SMM medium and cultured at 37°C for 2-3 days. The spores on each plate were washed with 0.1% Tween 80, and the number of conidia was counted by a hemocytometer. 1 μL of spore solution (1000 spores) was spotted onto GMM medium and cultured at 37°C for 1-5 days. The changes in colony diameter were recorded every day, and 5 replicates were set for each strain. Fig.11 As shown, the growth rate of the csdA mutant was significantly lower than that of the control strain, which was consistent with the results of P. fici. The conidia of the strain cultured for 5 days were further washed with 0.1% Tween 80 and the number of conidia was counted by a hemocytometer. The results showed that the number of conidia of the csdA mutant was significantly lower than that of the control strain ( Fig.11 ). And further observation of the conidia morphology of the csdA mutant and its control strain revealed that the conidia morphology of the csdA mutant was no longer regular ( Fig.11). Likewise, these results suggest that CsdA plays an important role in maintaining normal growth and development of A. fumigatus and can be used to control the growth and development processes of fungi.

[0181] Example 7: Application of csdA gene in regulating fungal conidia germination

[0182] After entering the host, the conidia of A. fumigatus germinate to form invasive hyphae, leading to deep infection of the host. Therefore, the regulation of conidia germination of A. fumigatus is crucial to maintain its pathogenicity.

[0183] Conidia of the csdA knockout mutant of A. fumigatus obtained in Example 2 and a control strain (A. fumigatus Cea17-1, which was based on A. fumigatus Cea17-2 and only complemented with the pyrG gene to eliminate the interference caused by the introduction of the pyrG gene) were inoculated on SMM medium and cultured at 37°C for 2-3 days. The conidia were washed with 0.1% Tween 80 and the number of conidia was counted using a hemocytometer. The number of conidia of the csdA mutant and the control strain was adjusted to 1×10 8 / mL. 1mL of conidia of the csdA mutant and its control strain were inoculated into 100mL Erlenmeyer flasks containing 30mL LMM medium, with 3 replicates for each bacterium. Cultured at 37°C, 200rpm for 10 hours, the number of germinated spores was counted every hour from the 4th hour onwards using a hemocytometer. The germination rate of conidia was calculated using the formula "(number of germinated spores / total number of spores) × 100%".

[0184] like Fig.12 As shown in the figure, both the csdA mutant and its control strain began to germinate from the 4th hour. However, the germination rate of the control strain reached 100% at the 8th hour, and the germination rate of the csdA mutant at the 8th hour was 66%, indicating that the loss of csdA in A. fumigatus can significantly reduce the germination rate of conidia, and this gene can be used to control the conidia germination process of fungi.

[0185] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. Application of RNA binding protein CsdA or its related biomaterials in regulating fungal secondary metabolites or preparing products for regulating fungal secondary metabolites; The related biological material is selected from any of the following: a nucleic acid molecule capable of expressing the RNA binding protein CsdA, an expression cassette or a recombinant vector or a recombinant bacterium or a transgenic cell line containing the nucleic acid molecule, a substance capable of promoting the expression of the RNA binding protein CsdA, a substance capable of inhibiting the expression of the RNA binding protein CsdA; The RNA binding protein CsdA is any of the following proteins: (A1) a protein with an amino acid sequence as shown in SEQ ID No. 3; (A2) a protein with an amino acid sequence as shown in SEQ ID No. 2; (A3) a protein having the same function as that of fungi or Aspergillus fumigatus or Pseudomonas syringae, wherein one or more amino acid residues of the amino acid sequence defined in (A1) or (A2) are substituted and / or deleted and / or added; (A4) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more identity with the amino acid sequence defined in any one of (A1) to (A3) and derived from fungi or Aspergillus fumigatus or Pseudomonas ficifolia and having the same function; (A5) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein defined in any one of (A1) to (A4).

2. Application of RNA binding protein CsdA or its related biomaterials in regulating fungal growth and development or preparing products for regulating fungal growth and development; The related biological material is selected from any of the following: a nucleic acid molecule capable of expressing the RNA binding protein CsdA, an expression cassette or a recombinant vector or a recombinant bacterium or a transgenic cell line containing the nucleic acid molecule, a substance capable of promoting the expression of the RNA binding protein CsdA, a substance capable of inhibiting the expression of the RNA binding protein CsdA; The RNA binding protein CsdA is any of the following proteins: (A1) a protein with an amino acid sequence as shown in SEQ ID No. 3; (A2) a protein with an amino acid sequence as shown in SEQ ID No. 2; (A3) a protein having the same function as that of fungi or Aspergillus fumigatus or Pseudomonas syringae, wherein one or more amino acid residues of the amino acid sequence defined in (A1) or (A2) are substituted and / or deleted and / or added; (A4) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more identity with the amino acid sequence defined in any one of (A1) to (A3) and derived from fungi or Aspergillus fumigatus or Pseudomonas ficifolia and having the same function; (A5) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein defined in any one of (A1) to (A4).

3. Application of RNA binding protein CsdA or its related biological materials in regulating the virulence of pathogenic fungi or preparing products for regulating the virulence of pathogenic fungi; The related biological material is selected from any of the following: a nucleic acid molecule capable of expressing the RNA binding protein CsdA, an expression cassette or a recombinant vector or a recombinant bacterium or a transgenic cell line containing the nucleic acid molecule, a substance capable of promoting the expression of the RNA binding protein CsdA, a substance capable of inhibiting the expression of the RNA binding protein CsdA; The RNA binding protein CsdA is any of the following proteins: (A1) a protein with an amino acid sequence as shown in SEQ ID No. 3; (A2) a protein with an amino acid sequence as shown in SEQ ID No. 2; (A3) a protein having the same function as that of fungi or Aspergillus fumigatus or Pseudomonas syringae, wherein one or more amino acid residues of the amino acid sequence defined in (A1) or (A2) are substituted and / or deleted and / or added; (A4) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more identity with the amino acid sequence defined in any one of (A1) to (A3) and derived from fungi or Aspergillus fumigatus or Pseudomonas ficifolia and having the same function; (A5) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein defined in any one of (A1) to (A4).

4. Application of RNA binding protein CsdA or its related biomaterials in regulating the drug resistance of pathogenic fungi or preparing products for regulating the drug resistance of pathogenic fungi; The related biological material is selected from any of the following: a nucleic acid molecule capable of expressing the RNA binding protein CsdA, an expression cassette or a recombinant vector or a recombinant bacterium or a transgenic cell line containing the nucleic acid molecule, a substance capable of promoting the expression of the RNA binding protein CsdA, a substance capable of inhibiting the expression of the RNA binding protein CsdA; The RNA binding protein CsdA is any of the following proteins: (A1) a protein with an amino acid sequence as shown in SEQ ID No. 3; (A2) a protein with an amino acid sequence as shown in SEQ ID No. 2; (A3) a protein having the same function as that of fungi or Aspergillus fumigatus or Pseudomonas syringae, wherein one or more amino acid residues of the amino acid sequence defined in (A1) or (A2) are substituted and / or deleted and / or added; (A4) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more identity with the amino acid sequence defined in any one of (A1) to (A3) and derived from fungi or Aspergillus fumigatus or Pseudomonas ficifolia and having the same function; (A5) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein defined in any one of (A1) to (A4).

5. The use according to any one of claims 1 to 4, characterized in that: In the use of claim 1, the expression level and / or activity of the RNA binding protein CsdA in the fungus is reduced, and the content of more than 50% of the secondary metabolites of the fungus is changed; and / or In the use of claim 1, the expression level and / or activity of the RNA binding protein CsdA in the fungus is reduced, and the content of the fungal secondary metabolites melanin and / or pesteic acid is increased; and / or In the use of claim 2, the expression level and / or activity of the RNA binding protein CsdA in the fungus is reduced, and the growth rate of the fungus is slowed down; and / or In the use of claim 2, the expression level and / or activity of the RNA binding protein CsdA in the fungus is reduced, and the conidia germination rate of the fungus is reduced; and / or In the use of claim 3, the expression level and / or activity of the RNA binding protein CsdA in the pathogenic fungus is reduced, and the virulence of the pathogenic fungus is enhanced; and / or In the use described in claim 4, the expression level and / or activity of the RNA binding protein CsdA in the pathogenic fungus is reduced, and the drug resistance of the pathogenic fungus is weakened.

6. Either of the following methods: Method I: A method for regulating fungal secondary metabolites, comprising the step of reducing or increasing the expression level and / or activity of RNA binding protein CsdA in a recipient fungus; Method II: A method for preparing fungal melanin and / or pesteic acid, comprising the step of reducing the expression level and / or activity of RNA binding protein CsdA in a recipient fungus; Method III: A method for delaying fungal growth, comprising the step of reducing the expression level and / or activity of RNA binding protein CsdA in a recipient fungus; Method IV: A method for reducing the conidia germination rate of fungi, comprising the step of reducing the expression amount and / or activity of RNA binding protein CsdA in a recipient fungus; Method V: A method for improving the virulence of pathogenic fungi, comprising the step of reducing the expression level and / or activity of RNA binding protein CsdA in the recipient pathogenic fungi; Method VI: A method for reducing drug resistance of pathogenic fungi, comprising the step of reducing the expression level and / or activity of RNA binding protein CsdA in the recipient pathogenic fungi; The RNA binding protein CsdA is any of the following proteins: (A1) a protein with an amino acid sequence as shown in SEQ ID No. 3; (A2) a protein with an amino acid sequence as shown in SEQ ID No. 2; (A3) a protein having the same function as that of fungi or Aspergillus fumigatus or Pseudomonas syringae, wherein one or more amino acid residues of the amino acid sequence defined in (A1) or (A2) are substituted and / or deleted and / or added; (A4) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more identity with the amino acid sequence defined in any one of (A1) to (A3) and derived from fungi or Aspergillus fumigatus or Pseudomonas ficifolia and having the same function; (A5) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein defined in any one of (A1) to (A4).

7. Either of the following methods: Method I': A method for regulating fungal secondary metabolites, comprising the following steps: inhibiting the expression of a nucleic acid molecule capable of expressing RNA binding protein CsdA in a recipient fungus to obtain a transgenic fungus; the transgenic fungus has a secondary metabolite content that is more than 50% different from that of the recipient fungus; Method II': A method for preparing fungal melanin and / or pesteic acid, comprising the following steps: inhibiting the expression of a nucleic acid molecule capable of expressing RNA binding protein CsdA in a recipient fungus to obtain a transgenic fungus; the transgenic fungus has a significantly higher content of melanin and / or pesteic acid than the recipient fungus; and then preparing fungal melanin and / or pesteic acid from the transgenic fungus; Method III': A method for delaying fungal growth, comprising the following steps: inhibiting the expression of a nucleic acid molecule capable of expressing RNA binding protein CsdA in a recipient fungus to obtain a transgenic fungus; the transgenic fungus grows slower than the recipient fungus; Method IV': A method for reducing the conidia germination rate of fungi, comprising the following steps: inhibiting the expression of a nucleic acid molecule capable of expressing RNA binding protein CsdA in a recipient fungus to obtain a transgenic fungus; the transgenic fungus has a lower conidia germination rate than the recipient fungus; Method V': A method for improving the virulence of pathogenic fungi, comprising the following steps: inhibiting the expression of a nucleic acid molecule capable of expressing RNA binding protein CsdA in a recipient pathogenic fungus to obtain a transgenic pathogenic fungus; the transgenic pathogenic fungus has improved virulence compared to the recipient pathogenic fungus; Method VI': A method for reducing the drug resistance of pathogenic fungi, comprising the following steps: inhibiting the expression of a nucleic acid molecule capable of expressing RNA binding protein CsdA in a recipient pathogenic fungus to obtain a transgenic pathogenic fungus; the transgenic pathogenic fungus has reduced drug resistance compared to the recipient pathogenic fungus; The RNA binding protein CsdA is any of the following proteins: (A1) a protein with an amino acid sequence as shown in SEQ ID No. 3; (A2) a protein with an amino acid sequence as shown in SEQ ID No. 2; (A3) a protein having the same function as that of fungi or Aspergillus fumigatus or Pseudomonas syringae, wherein one or more amino acid residues of the amino acid sequence defined in (A1) or (A2) are substituted and / or deleted and / or added; (A4) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more identity with the amino acid sequence defined in any one of (A1) to (A3) and derived from fungi or Aspergillus fumigatus or Pseudomonas ficifolia and having the same function; (A5) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein defined in any one of (A1) to (A4).

8. The use or method according to any one of claims 1 to 7, characterized in that: In the method of claim 7, inhibiting the expression of the nucleic acid molecule capable of expressing the RNA binding protein CsdA in the recipient fungus or the recipient pathogenic fungus is achieved by homologous recombination technology; and / or The nucleic acid molecule capable of expressing the RNA binding protein CsdA is any of the following DNA molecules: (B1) DNA molecule shown in SEQ ID No.4; (B2) DNA molecule shown in SEQ ID No. 1; (B3) A DNA molecule that has a homology of more than 99%, more than 95%, more than 90%, more than 85% or more than 80% with any of the DNA sequences defined in (B1) to (B2) and encodes the RNA binding protein CsdA.

9. The use or method according to any one of claims 1 to 8, characterized in that: The drug is an azole drug; Furthermore, the azole drug is itraconazole, posaconazole or voriconazole.

10. The use according to any one of claims 1 to 9, characterized in that: The fungus is Aspergillus fumigatus or Pseudomonas ficifolia; and / or The pathogenic fungus is Aspergillus fumigatus.

Images