Wheat TaPSY5 small peptide and coding gene thereof for promoting plant root growth and application of wheat TaPSY5 small peptide and coding gene thereof

Abstract

The invention relates to the technical field of molecular biology, and discloses application of TaPSY5 small peptide and a coding gene thereof in promoting plant root growth. A tyrosine sulfated polypeptide is named as TaPSY5 small peptide and is as follows: (a) mature small peptide composed of 18 amino acids shown in a sequence 1 in a sequence table and having tyrosine sulfated modification; the TaPSY5 small peptide precursor protein is the following (b) or (c): (b) a protein composed of amino acids as shown in a sequence table 2; and (c) a protein derived from the amino acid of the sequence 2 in the sequence table through deletion / or substitution / or insertion of one or more amino acids. The TaPSY5 small peptide is externally applied, so that the growth rate of a plant root system can be increased. The gene (TaPSY5 gene) for coding the TaPSY5 precursor small peptide also belongs to the protection range of the invention. The invention also protects that the TaPSY5 gene is introduced into a target plant, and lateral roots and main roots of the obtained transgenic plant are significantly more than those of the target plant.

Description

Technical Field

[0001] The invention relates to the technical field of molecular biology, in particular to wheat TaPSY5 small peptide and its encoding gene for promoting plant root growth and application thereof. Background Art

[0002] Many studies have shown that small peptide molecules regulate intercellular signal transduction and play an important role in many processes of plant growth and development and biotic and abiotic stresses. Plant peptides containing sulfated tyrosine (PSYs) play an important role in regulating cell proliferation, balancing plant growth and development, and stress responses. Studies have shown that PSY is formed by modified cleavage of a precursor peptide of 80-200 amino acids in length, and is post-translationally modified by tyrosine sulfation, hydroxyproline modification, and triple arabinosylation. Studies have found that PSY, as a class of small peptide ligands, binds to its leucine-rich receptor kinase (LRR-RLK PSY1RECEPTOR, PSY1R) and plays a very important role in balancing growth and stress and defense responses. In Arabidopsis, tyrosine sulfation of PSY is mediated by tyrosylprotein sulfotransferase TPST (tyrosylprotein sulfotransferase). Mutations in this gene significantly affect plant growth and development, and plants show obvious growth defects, manifested as shortened roots and reduced biomass.

[0003] Small peptides have a regulatory role in the growth and development of plant roots. Small peptides can act on plants through external application, suggesting the value of small peptides in crop improvement. Therefore, clarifying the effects of small peptides on plant root development and improving the root system through exogenous application of small peptides and genetic engineering methods are of significance for crop genetic improvement. Summary of the invention

[0004] The purpose of the present invention is to provide a wheat TaPSY5 small peptide and a coding gene thereof for promoting plant root growth and application.

[0005] In order to achieve the above purpose, the technical solutions provided are as follows:

[0006] The present invention provides a tyrosine sulfated polypeptide, named TaPSY5 small peptide, which is as follows (a):

[0007] (a) A mature small peptide consisting of 18 amino acids shown in Sequence 1 in the sequence table, which is modified by tyrosine sulfonation; the small peptide modified by tyrosine sulfation in (a) is artificially synthesized.

[0008] A use of a tyrosine sulfated polypeptide in promoting plant root growth, characterized by at least one of the following (1)-(3):

[0009] (1) Improve plant root-related traits;

[0010] (2) Methods for cultivating a well-developed root system;

[0011] (3) Products that improve plant root systems.

[0012] In the above application, the plant is a monocotyledon or a dicotyledon, the monocotyledon is specifically wheat, and the dicotyledon is specifically Arabidopsis thaliana.

[0013] The present invention provides a TaPSY5 small peptide precursor protein, which is as follows (b) or (c):

[0014] (b) a protein consisting of the amino acids shown in Sequence Table 2;

[0015] (c) A protein derived from the amino acids in sequence 2 in the sequence list by deletion / or substitution / or insertion of one or more amino acids.

[0016] The gene encoding the TaPSY5 small peptide precursor protein (TaPSY5 gene) also falls within the protection scope of the present invention.

[0017] The gene is a DNA molecule as described in (1) or (2) or (3):

[0018] (1) The coding region of the DNA molecule is as shown in nucleotides 247 to 567 from the 5' end of Sequence 3 in the sequence listing;

[0019] (2) The coding region of the DNA molecule is as shown in nucleotides 87 to 605 from the 5' end of Sequence 4 in the sequence listing;

[0020] (3) The coding region is a DNA molecule as shown in Sequence 5 in the sequence listing from nucleotides 43 to 570 at the 5' end.

[0021] The recombinant expression vector, transgenic plant cell line or recombinant bacteria containing the TaPSY5 gene all fall within the protection scope of the present invention.

[0022] The present invention also protects the use of the TaPSY5 small peptide precursor protein or its encoding gene in plant root development.

[0023] The present invention also protects a method for cultivating transgenic plants, which comprises introducing the gene of the TaPSY5 protein into a target plant to obtain a transgenic plant; the transgenic plant has at least one phenotype among the following (1)-(3);

[0024] (1) The roots of the transgenic plant grow larger than those of the target plant;

[0025] (2) the number of lateral roots of the transgenic plant is greater than that of the target plant;

[0026] (3) The above-ground and underground parts of the transgenic plant are heavier than those of the target plant.

[0027] The beneficial effect of the present invention is that: in view of the important role that PSY-PSYR-mediated signal transduction plays in plant growth and development and immune regulation, the present invention has mined wheat PSYs family members through bioinformatics methods. Wheat TaPSY5 is one of the members of the PSY family, and the TaPSY5 small peptide is formed by post-translational modification of the encoded precursor protein. Small peptides have a regulatory effect on the growth and development of plant roots. In addition, small peptides can also act on the plant body through external application, suggesting the value of small peptides in crop improvement. Therefore, clarifying the effect of small peptides on plant root development and improving the root system by exogenous application of small peptides and genetic engineering methods are of significance for crop genetic improvement. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is the result of multiple sequence alignment of PSY family proteins.

[0029] Figure 2 The following are the root phenotypes of Arabidopsis thaliana treated with mature TaPSY5 peptides; A is the phenotype of Arabidopsis thaliana mutant tpst-1 plants treated with mature TaPSY5 peptides, B is the root length statistics of Arabidopsis thaliana mutant tpst-1 plants treated with mature TaPSY5 peptides, C is the phenotype of wild-type Arabidopsis thaliana plants treated with mature TaPSY5 peptides, and D is the root length statistics of wild-type Arabidopsis thaliana plants treated with TaPSY5 peptides.

[0030] Figure 3 Figure 1 is the root phenotype of wheat treated with TaPSY5 mature peptide; A is the phenotype of wheat variety Fielder plants treated with TaPSY5 mature peptide. B is the root length statistics of wheat variety Fielder plants treated with TaPSY5 peptide.

[0031] Figure 4 This is the expression pattern of the TaPSY5 precursor gene in wheat.

[0032] Figure 5Figure 2 is the root phenotype of transgenic Arabidopsis thaliana overexpressing the TaPSY5 gene; A is the root morphology of wild-type (WT) and transgenic Arabidopsis plants (OE1-OE3), B is the statistical results of root length of wild-type and transgenic Arabidopsis plants, C is the statistical results of the number of lateral roots of wild-type and transgenic Arabidopsis roots, D is the statistical results of the fresh weight of the aboveground parts of wild-type and transgenic Arabidopsis. E is the statistical results of the root fresh weight of wild-type and transgenic Arabidopsis roots. DETAILED DESCRIPTION

[0033] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0034] Example 1: Identification of wheat TaPSY family precursor genes

[0035] Wheat PSY family members were identified by two methods: First, the reported Arabidopsis and rice PSY family member gene sequences and protein sequences were downloaded from the Arabidopsis (http: / / web.arabidopsis.org) and rice databases (http: / / rice.plantbiology.msu.edu / ). The Arabidopsis and rice PSK precursor protein sequences were used as reference sequences for a Blastp search in the wheat database. Wheat PSK family members must meet the following three aspects: (1) E-value < 20; (2) the length of the precursor protein sequence is between 60 and 200; (3) the C-terminus of the precursor protein contains the PSY conserved motif DYXXXX[AP]NXXHXP. The PSY precursor sequences obtained by the above methods were further verified using the SMART website (http: / / smart.embl-heidelberg.de / ) to obtain the final wheat PSY precursor gene family members. Evolutionary analysis such as Figure 1 As shown, a total of 29 TaPSY gene family members were identified in the wheat genome, all of which contained the conserved DYXXXX[AP]NXXHXP conserved motif at the N-terminus of the precursor protein. The PSY conserved motif is indicated by the red box.

[0036] Example 2: Synthesis of TaPSY5 mature peptide

[0037] Based on the PSYs modification site, this study synthesized a tyrosine sulfated peptide named TaPSY5 (DY(SO3H)PRYGANGRHNPEGPHP). The TaPSY5 peptide was diluted with sterile distilled water to a 1 mmol mother solution and stored in a -80℃ refrigerator to avoid repeated freezing and thawing. The peptide was synthesized by Dangang Biotechnology Co., Ltd. with a purity greater than 95%. The second tyrosine of the TaPSY5 peptide contains a sulfonation modification site.

[0038] Example 3: Treatment of Arabidopsis plants with TaPSY5 mature peptide

[0039] Wild-type Arabidopsis Columbia C0 and tpst-1 mutant seeds were disinfected with 2% sodium hypochlorite for 10 minutes, rinsed with distilled water five times, and then sown on a culture medium (the culture medium composition is 1 / 2 MS, 1% sucrose, 0.8% Agar). When the Arabidopsis roots grew to about 0.9 cm, the Arabidopsis seedlings with consistent root length were transferred to a culture medium with 500 nmol of small peptide (the composition is 1 / 2 MS, 1% sucrose, 0.8% Agar, 500 nmol small peptide), placed in a light incubator for 7 days, and observed and photographed. The results are shown in Figure 2 As shown, the root length of wild-type Arabidopsis and tpst-1 mutant treated with exogenous TaPSY5 peptide was significantly longer than that of the control plants.

[0040] Example 4: Treatment of wheat seedlings with TaPSY5 mature peptide

[0041] Select full wheat varieties Fielder seeds, disinfect with 70% alcohol for 30 seconds, rinse with sterile water 3 times, disinfect with 10% sodium hypochlorite for 10 minutes, rinse with sterile distilled water in a clean bench for 4-5 times, dry the surface moisture with filter paper, plant the sterilized wheat seeds on MS culture medium (the culture medium composition is 1 / 2 MS, 0.5% Agar), and culture in a light incubator for 3-4 days. When the wheat seed roots are about 1 cm long, cut off the endosperm, and transfer the wheat seedlings with consistent root length to the culture medium with exogenous TaPSY5 peptide (the culture medium composition is 1 / 2 MS, 0.3% sucrose, 0.8% Agar, 500nmol peptide). After 6 days of continuous culture, use ImageJ to count the wheat root length. The results are as follows Figure 3 As shown, the root length of wheat plants treated with exogenous TaPSY5 peptide was significantly longer than that of the control plants.

[0042] Example 5. Study on TaPSY5 precursor protein, its encoding gene and its expression

[0043] 1. Obtaining the TaPSY5 Precursor Protein and Its Coding Gene

[0044] Select the plump seeds of Fielder, place them in a culture dish covered with two layers of filter paper, add a small amount of water to the culture dish, and place it in an artificial climate chamber for 14 days. Take the root tissue of the seedling, freeze it in liquid nitrogen, extract the total RNA of the sample with TRIZOL, and synthesize the first-chain cDNA of the target gene with the M-MLV reverse transcription kit. Using the cDNA of the root tissue as a template, PCR amplification was performed with primers YF1 and YR1 to obtain the PCR amplification product. After the amplification product was purified and recovered, it was connected to the pMD18-T vector using T4 ligase, and the connection product was transformed into Escherichia coli. After culturing for 16 hours, a single clone was selected, shaken and sent for sequencing. After sequencing, the full-length sequence of the target clone was obtained, as shown in sequence 3 in the sequence table, encoding the protein shown in sequence 2 in the sequence table.

[0045] The primer sequences for cloning the TaPSY5 gene are as follows:

[0046] YF1 5'-AAGTCAAATCGCCCAGGAGG-3'

[0047] YR1 5'-GAAGCAGTAGCGGAAGACAAAT-3'

[0048] The protein shown in sequence 2 of the sequence table is named as the precursor protein TaPSY5 of the mature small peptide, and the protein is modified after shearing and translation to form a mature small peptide. The precursor protein consists of 106 amino acid residues. The coding gene of the precursor protein TaPSY5 is named as the TaPSY5 gene. The full length of the TaPSY5 gene is shown in sequence 3 in the sequence table (1126bp), and the nucleotides 1-246 are 5'UTR (246bp), the nucleotides 247-567 are open reading frames (321bp), and the nucleotides 568-1126 are 3'UTR (559bp).

[0049] 2. Expression of TaPSY5 gene in different wheat tissues

[0050] When wheat grows to the stage of three leaves and one heart, roots, stems, and leaves of seedlings are collected. When wheat grows to the reproductive development stage, ears at the booting stage and seeds 5 days and 15 days after anthesis are collected. All collected samples are quickly frozen in liquid nitrogen and RNA is extracted. Total RNA of the above samples is extracted using the trizol method, and the first-chain cDNA is synthesized using the MMLV reverse transcription kit. The fluorescence quantitative kit qRT-PCR method is used in QuanStudio TM 5. The differential expression of TaPSY5 in different developmental stages and different tissues was detected on a fluorescence quantitative instrument. The constitutive wheat TaGAPDH gene was used as an internal reference, and the designed primer sequences were as follows:

[0051] The primer sequences for detecting TaPSY5 gene expression are as follows:

[0052] TaPSY5-F 5'-GAAGGATGGAGCGGCGACTG-3'

[0053] TaPSY5-R 5'-CGACCTCCATCACCACCCTCA-3'

[0054] The primer sequences for detecting the expression of the gene TaGAPDH are as follows:

[0055] TaGAPDH-F 5'-GACCCAGACAACTCGCAAC 3'

[0056] TaGAPDH-R 5'-GGAATCCATGACCACCTAC 3'

[0057] Real-time quantitative results such as Figure 4 As shown in , the expression level of TaPSY5 gene in wheat seedling roots was significantly higher than that in other tissues, followed by seeds and ears, while the expression levels in stems and leaves were relatively low.

[0058] Example 7: Application of TaPSY5 gene in improving plant root system

[0059] 1. Construction of overexpression vector

[0060] 1. Using the cDNA of the root of the wheat variety Fielder as a template, the TaPSY5 gene was amplified using a primer pair (F1 and R1) and the high-fidelity enzyme Pfu. The PCR product was subjected to 1% agarose gel computer and a band of about 300 bp was recovered and purified.

[0061] F1:CGGGGGACGAGCTCG GTACC ATGGCGCAGCCGCGGCAGCAG (the underlined part is the restriction site, and the sequence following it is the 247th to 267th position of sequence 1 in the table)

[0062] R1:TACGAACGAAAGCTC TGCAG TCACGGGTGCGGACCCTCCGG

[0063] (The underlined part is the restriction site, and the sequence following it is the 547th to 567th position of sequence 1 in the table)

[0064] 2. Use restriction endonucleases KpnI and PsI The vector pCAMBIA1300-EGFP was double-digested and the vector backbone was purified and recovered.

[0065] 3. The PCR product recovered in step 1 and the vector backbone in step 2 were connected using homologous recombinase. The connected product was heat-shocked and transformed into E. coli DH5a, cultured at 37°C for 16 hours, and sequenced to obtain the correct recombinant expression vector pCAMBIA1300-TaPSY5.

[0066] The structure of the recombinant vector pCAMBIA1300-TaPSY5 is described as follows: a recombinant vector in which the restriction site of the pCAMBIA1300-EGFP vector is replaced with the nucleotides shown at positions 247-567 of SEQ ID NO: 1.

[0067] 2. Obtaining Transgenic Arabidopsis

[0068] 1. The recombinant expression vector pCAMBIA1300-TaPSY5 was transformed into Agrobacterium competent cells by electroporation, and the correct recombinant Agrobacterium was identified by PCR of the bacterial solution.

[0069] 2. The pCAMBIA1300-TaPSY5 recombinant plasmid was transferred into the Arabidopsis buds by the flower bud transformation method, and the Arabidopsis plants were further cultured to obtain T0 generation seeds. Resistance screening was performed on MS medium plates containing 50 mg / L hygromycin, and the segregation ratios of T2 generation and T3 generation were calculated.

[0070] 3. Molecular identification of TaPSY5 transgenic Arabidopsis

[0071] RNA was extracted from the pure and homozygous lines of Arabidopsis thaliana transgenic with TaPSY5 gene in T3 plants, and the expression level of the target gene in the transgenic plants was analyzed by RT-PCR. The expression of TaPSY5 gene was detected by the primer pair consisting of TaPSY5-F (GAAGGATGGAGCGGCGACTG) and TaPSY5-R (GGAATCCATGACCACCTAC), and the expression of Arabidopsis thaliana internal reference gene Atactin was detected by the primer pair consisting of Atactin-F (GGCTCCTCTTAACCCAAAGGC) and Atactin-R (CACACCATCACCAGAATCCAG). The results are shown in the figure. Three highly expressed transgenic lines of TaPSY5 gene were selected from the positive transgenic lines for phenotypic analysis.

[0072] 3. Phenotypic Identification of Transgenic Arabidopsis

[0073] Seeds of wild-type Columbia (C0, WT) and transgenic Arabidopsis lines (OE1, OE2 and OE3) transgenic with TaPSY5 in the T3 generation were sterilized with sodium hypochlorite and sown on MS medium. After three days of light culture, seedlings of wild-type and transgenic lines with consistent root length were transferred to a new 1 / 2 MS medium, cultured for 7 more days, observed and photographed. As shown in Figure 5, the main root length of Arabidopsis transgenic with TaPSY5 in the T3 generation was significantly longer than that of the wild type. In addition, the number of lateral roots, aboveground fresh weight and underground fresh weight of the transgenic lines were significantly greater than those of the wild type. The experimental results show that overexpression of the TaPSY5 gene can significantly promote the growth rate of plant roots.

[0074] It will be apparent to those skilled in the art that the invention is not limited to the details of the exemplary embodiments described above and that the invention can be implemented in other specific forms without departing from the spirit or essential features of the invention. Therefore, the embodiments should be considered exemplary and non-limiting in all respects, and the scope of the invention is defined by the appended claims rather than the foregoing description, and it is intended that all variations falling within the meaning and scope of the equivalent elements of the claims be included in the invention. Any reference numeral in a claim should not be considered as limiting the claim to which it relates.

Claims

1. A tyrosine sulfated polypeptide, named TaPSY5 peptide, is as follows (a): (a) A mature small peptide consisting of 18 amino acids shown in Sequence 1 in the sequence table, which is modified by tyrosine sulfonation; the small peptide modified by tyrosine sulfation in (a) is artificially synthesized.

2. The use of a tyrosine sulfated polypeptide according to claim 1 in promoting plant root growth, characterized by at least one of the following (1)-(3): (1) Improve plant root-related traits; (2) Methods for cultivating a well-developed root system; (3) Products for improving plant root systems; The plant is a monocotyledon or a dicotyledon. The monocotyledon is specifically wheat, and the dicotyledon is specifically Arabidopsis thaliana.

3. A TaPSY5 small peptide precursor protein, which is (b) or (c): (b) a protein consisting of the amino acids shown in Sequence Table 2; (c) A protein derived from the amino acids in sequence 2 in the sequence list by deletion / or substitution / or insertion of one or more amino acids.

4. A gene encoding the protein according to claim 3.

5. The gene according to claim 4, characterized in that: The gene is a DNA molecule as described in (1) or (2) or (3): (1) The coding region of the DNA molecule is as shown in nucleotides 247 to 567 from the 5' end of Sequence 3 in the sequence listing; (2) The coding region of the DNA molecule is as shown in nucleotides 87 to 605 from the 5' end of Sequence 4 in the sequence listing; (3) The coding region is a DNA molecule as shown in Sequence 5 in the sequence listing from nucleotides 43 to 570 at the 5' end.

6. A recombinant expression vector, transgenic plant cell line or recombinant bacteria containing the gene according to claim 4 or 5.

7. Use of the TaPSY5 small peptide precursor protein according to claim 3 or the gene according to claim 4 or 5 in plant root development.

8. A method for cultivating transgenic plants, comprising introducing the gene according to claim 4 or 5 into a target plant to obtain a transgenic plant.

9. A method for cultivating transgenic plants according to claim 8, characterized in that: The gene described in claim 4 or 5 is introduced into the target plant via the recombinant expression vector described in claim 6.

10. A method for cultivating transgenic plants according to claim 8 or 9, characterized in that: The transgenic plant has at least one phenotype among the following (1)-(3); (1) The roots of the transgenic plant grow larger than those of the target plant; (2) the number of lateral roots of the transgenic plant is greater than that of the target plant; (3) The above-ground and underground parts of the transgenic plant are heavier than those of the target plant.

Images