A Trichoderma longibrachiatum NT241 and its applications

By using T. aphrodisiac NT241 liquid bacteria agent, the lignocellulose in the straw is degraded with its efficient enzyme system, which solves the problem of long straw decomposition cycle and achieves rapid decomposition and efficient utilization of straw.

CN119506102BActive Publication Date: 2025-07-25GUIZHOU UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411675277.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-21
Publication Date
2025-07-25
Estimated Expiration
2044-11-21

AI Technical Summary

Technical Problem

The lignocellulose structure in the straw hinders the degradation of enzymes, resulting in long corrosion cycles and insufficient corrosion, making it difficult to achieve efficient straw return to the field.

Method used

Trichoderma longibrachiatum NT241 liquid bacterial agent is used to mechanically treat the straw and add the bacterial agent, and the enzymes produced by it are used to promote the rapid decomposition of straw.

Benefits of technology

It significantly improves the lignocellulose degradation efficiency of rapeseed and wheat straw, shortens the decay cycle, increases the humus content, and provides efficient microbial resources for straw returning to the fields.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119506102B_ABST
    Figure CN119506102B_ABST
Patent Text Reader

Abstract

The present invention discloses a Trichoderma longibrachiatum NT241 and its application. The microbiological taxonomic name of this strain is Trichoderma longibrachiatum NT241, with the Latin scientific name Trichoderma longibrachiatum NT241. The preservation number is CGMCC No. 41139, and the preservation address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The Trichoderma longibrachiatum NT241 of the present invention grows rapidly and has relatively high activities of endo-β-glucanase and manganese peroxidase. Adding this liquid bacterial agent can promote the degradation of crop straws such as rape and wheat, and can provide an efficient microbial resource for the utilization of straw returning to the field.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to Trichoderma longibrachiatum NT241 and its application, belonging to the field of microbial technology. Background Art

[0002] In recent years, straw treatment has always been a difficult problem in rural environmental governance. With the improvement of environmental protection requirements and the implementation of straw utilization policies, a pattern of comprehensive utilization of straw in "five forms" has gradually taken shape in China. Among them, straw fertilization can increase soil nutrients, improve crop yields, and reduce the application of chemical fertilizers. Therefore, the proportion of straw returned to the field has gradually increased. However, the lignocellulose structure in straw hinders the degradation of enzymes, resulting in a long decomposition cycle and incomplete decomposition of straw.

[0003] Microbial inoculants can help straw decompose rapidly and effectively alleviate the adverse effects of direct straw returning to the field. Among the natural cellulose-degrading strains, fungi have more advantages than bacteria and actinomycetes. The various redox enzymes and a large number of hyphae produced can efficiently break down the complex structure of lignin and further promote cellulose degradation. Among them, Trichoderma fungi have become filamentous fungi with relatively extensive research due to their strong survival ability, diverse cellulase systems, and good degradation efficiency. Zhang Yanping et al. [1] The mutant strain 5 obtained by ultraviolet mutagenesis of the cellulose-degrading strain Trichoderma longibrachiatum M-1 # , after identification, strain 5 # is also Trichoderma longibrachiatum, and its filter paper enzyme activity has increased by 30.06 U / mL, and its endo-enzyme activity has increased by 19.01 U / mL. Wanyun Li et al. [2] A Trichoderma longibrachiatum MK 878447 was isolated from the rhizosphere soil of Scutellaria baicalensis. Under its optimal fermentation conditions, the crude fiber degradation rate of corn straw can be increased to 23.5% within 5 - 6 days. Even in the dark environment at 16°C, Huang Yali et al. [3] The developed composite inoculant (containing Trichoderma longibrachiatum) can also increase the degradation rate of corn straw to 41.67% on the 45th day.

[0004] Based on the above, the addition of microbial inoculants provides effective technical support for the rapid decomposition of straw. In particular, microorganisms mainly composed of Trichoderma fungi show remarkable performance in conversion efficiency. Further exploring the enzyme activity of Trichoderma longibrachiatum and its degradation performance on rapeseed straw and wheat straw can provide an efficient microbial resource for straw returning to the field and utilization. Summary of the Invention

[0005] The first object of the present invention is to provide a Trichoderma longibrachiatum NT241, whose microbiological taxonomic name is Trichoderma longibrachiatum NT241, with the Latin scientific name Trichoderma longibrachiatum NT241, the preservation number CGMCC No. 41139, the preservation date April 7, 2024, and the preservation unit is the General Microbiology Center of the China Committee for Culture Collection of Microorganisms, with the preservation address at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. This Trichoderma longibrachiatum NT241 was obtained by isolation and screening from humus soil in Inner Mongolia. The ratio of the hydrolysis circle diameter to the strain diameter on a Congo red staining plate is 2.55. It is preliminarily determined that this strain can produce cellulase and has a strong cellulose degradation ability. Trichoderma longibrachiatum NT241 grows rapidly on PDA medium and can cover the entire petri dish in 3 days. Observing the colony morphology of this strain, the colony has white flocculent hyphae, and then the hyphae gradually turn green and form a small amount of white-yellow sporulation clusters. When cultured for 5 days, the hyphae turn dark green.

[0006] The ITS rDNA sequence of the above-mentioned Trichoderma longibrachiatum NT241 is shown in SEQ ID NO.1.

[0007] The above-mentioned Trichoderma longibrachiatum NT241 simultaneously has the activities of laccase, manganese peroxidase, lignin peroxidase, filter paper enzyme, and endo-β-glucosidase.

[0008] The second object of the present invention is to provide a preparation method of a Trichoderma longibrachiatum NT241 liquid inoculum. The above-mentioned Trichoderma longibrachiatum NT241 strain is inoculated into a potato dextrose agar (PDA) liquid medium and cultured in a constant temperature oscillator at 30 °C and 180 r / min for 3 - 4 days to obtain the liquid inoculum.

[0009] The third object of the present invention is to provide an application of the above-mentioned Trichoderma longibrachiatum NT241 liquid inoculum in degrading rape straw and wheat straw.

[0010] Application of the above-mentioned Trichoderma longibrachiatum NT241 liquid bacterium agent in degrading rape straw and wheat straw. First, the straw is harvested and naturally air-dried, then mechanically processed into 5 - 10 cm, and then sterilized. Sterile water is sprayed on the sterilized straw to keep the moisture content at 60 - 70%. Finally, 5 - 15% of the Trichoderma longibrachiatum NT241 liquid bacterium agent is added to the straw, and after uniform mixing, it is composted at 30°C for 14 days.

[0011] Compared with the prior art, the advantages of the present invention are as follows: The strain Trichoderma longibrachiatum NT241 grows and reproduces rapidly, and the enzyme production peak can be reached after 3 - 5 days of shaking culture; it can produce laccase, manganese peroxidase, lignin peroxidase, filter paper enzyme and endo-β-glucosidase, among which the activities of endo-β-glucosidase and manganese peroxidase are relatively high; at the same time, the present invention adds 15% of the Trichoderma longibrachiatum NT241 liquid bacterium agent, which helps to degrade the lignocellulose of rape straw and wheat straw and increase the humus content, providing an efficient microbial resource for subsequent straw biodegradation and having a wide application prospect. Description of the Drawings

[0012] Figure 1 Schematic diagram of the Congo red decolorization result of Trichoderma longibrachiatum NT241;

[0013] Figure 2 a is a schematic diagram of the morphological characteristics of Trichoderma longibrachiatum NT241;

[0014] Figure 2 b is a phylogenetic tree analysis diagram of Trichoderma longibrachiatum NT241;

[0015] Figure 3 Glucose standard curve graph;

[0016] Figure 4 Growth curve graph of Trichoderma longibrachiatum NT241;

[0017] Figure 5 Schematic diagram of the cellulase activity of Trichoderma longibrachiatum NT241;

[0018] Figure 6 Schematic diagram of the lignin degradation enzyme activity of Trichoderma longibrachiatum NT241;

[0019] Figure 7a Effect diagram of the hemicellulose degradation of Trichoderma longibrachiatum NT241;

[0020] Figure 7b Effect diagram of the cellulose degradation of Trichoderma longibrachiatum NT241;

[0021] Figure 7c The lignin degradation effect diagram of Trichoderma longibrachiatum NT241;

[0022] Figure 8 The schematic diagram of the change of humus in rape straw after being treated with Trichoderma longibrachiatum NT241;

[0023] Figure 9 The schematic diagram of the change of humus in wheat straw after being treated with Trichoderma longibrachiatum NT241. Specific implementation manners

[0024] In order to make the objectives, technical solutions and advantages of the present invention clearer, the present invention will be further described in detail below in conjunction with embodiments and the accompanying drawings.

[0025] The main culture media involved in the present invention include:

[0026] 1. Sodium carboxymethyl cellulose liquid medium: 10.0 g of sodium carboxymethyl cellulose, 2.0 g of potassium dihydrogen phosphate, 4.0 g of ammonium sulfate, 0.244 g of magnesium sulfate, 1.0 g of peptone, 1.0 L of ultrapure water, pH 7.0 - 7.5, sterilized at 121 °C for 20 min.

[0027] 2. Sodium carboxymethyl cellulose solid medium: 10.0 g of sodium carboxymethyl cellulose, 2.0 g of potassium dihydrogen phosphate, 4.0 g of ammonium sulfate, 0.244 g of magnesium sulfate, 1.0 g of peptone, 20.0 g of agar, 1.0 L of ultrapure water, pH 7.0 - 7.5, sterilized at 121 °C for 20 min.

[0028] 3. Potato dextrose agar (PDA) solid medium: extract of 200.0 g of fresh potatoes, 20.0 g of glucose, 1.0 L of ultrapure water, natural pH, sterilized at 121 °C for 20 min.

[0029] 4. Potato dextrose agar (PDA) liquid medium: extract of 200.0 g of fresh potatoes, 20.0 g of glucose, 1.0 L of ultrapure water, 20.0 g of agar, natural pH, sterilized at 121 °C for 20 min

[0030] 5. Lignin fermentation enzyme-producing medium: 4 g of lignin, 4 g of ammonium sulfate, 1 g of potassium dihydrogen phosphate, 1 g of dipotassium hydrogen phosphate, 0.1 g of sodium chloride, 0.3 g of magnesium sulfate, 0.05 g of manganese sulfate, 0.01 g of ferrous sulfate, 0.01 g of copper sulfate, 0.01 g of zinc sulfate, 0.005 g of cobalt chloride, 0.001 g of sodium molybdate, 0.001 g of potassium alum, 0.01 g of boric acid, pH 7.0 - 7.2, sterilized at 121 °C for 20 min.

[0031] Example 1: Isolation and purification of Trichoderma longibrachiatum strain NT241

[0032] 1. Preparation of bacterial suspension: Weigh 2 g of sample from humified soil in Inner Mongolia and add it to a 100 mL Erlenmeyer flask containing 40 mL of sterile water. After culturing at 30 °C with constant shaking at 180 r / min for 30 min, a bacterial suspension is obtained.

[0033] 2. Domestication and enrichment: Inoculate the bacterial suspension into the straw domestication medium at 5% (v / v), and culture it at 30 °C with shaking at 180 r / min for 4 - 5 days. Repeat this operation 2 times.

[0034] 3. Isolation and purification: The dilution coating plate method is used for isolation. Take the culture solution and dilute it stepwise with sterile water to a concentration of 10 -4 ~10 -7 . Pipette 200 μL of each diluted solution and spread it on the PDA solid medium, then place it in an incubator at 30 °C for inverted culture. Observe the colonies growing on the medium. According to the characteristics such as the size, color, and surface pattern of the colonies, pick the larger single colonies and perform multiple streak plate cultures on the PDA solid medium. Repeatedly purify for 2 - 3 generations until single colonies appear.

[0035] Example 2: Screening of Trichoderma longibrachiatum strain NT241

[0036] Inoculate the strains obtained by isolation and purification onto the carboxymethyl cellulose sodium solid medium respectively, and culture them at a constant temperature of 30 °C for 3 days. After staining with 1 g / L congo red solution for 30 min, decolorize with 1 mol / L sodium chloride solution for 30 min, and measure and record the colony diameter (d) and the hydrolysis circle diameter (D) respectively to preliminarily judge the lignocellulose degradation ability of the strains. The results are as Figure 1 shown: For strain NT241, the hydrolysis circle diameter after congo red staining is 11.4, the colony diameter is 4.5, and the ratio is 2.55.

[0037] Example 3: Identification of Trichoderma longibrachiatum strain NT241

[0038] (1) Morphological analysis of the strain

[0039] Inoculate the strain NT241 onto the PDA solid medium and culture it in an incubator at 30 °C for inverted culture. Observe and record the growth morphological characteristics of the strain. The results are as Figure 2As shown in a: The strain grew rapidly. After 3 days, white flocculent hyphae appeared and covered the entire culture dish. As it grew, the hyphae gradually changed from the initial white to grayish-yellow, producing subglobular granular or powdery spores, translucent to light green. When cultured for 5 days, the central part of the strain gradually became thicker and darker, the hyphae turned dark green, and a dense white-yellow sporulation cluster was formed. When observing the strain, there was no obvious odor, and the colony morphological characteristics were basically the same as those of the Trichoderma longibrachiatum strain.

[0040] (2) Phylogenetic tree analysis of the strain

[0041] The DNA of Trichoderma longibrachiatum NT241 was extracted using the Bacterial / Fungal Genomic DNA Extraction Kit from Solarbio. Using this as a template, PCR gene amplification was carried out using the fungal ITS universal primers ITS1 (TCCGTAGGTGAACCTGCC) and ITS4 (TCCTCCGCTTATTGATATGC). The PCR products were identified by 1% agarose gel electrophoresis and directly sequenced using the PCR primers. The obtained sequences were subjected to sequence alignment and homology analysis using the Basic Local Alignment Search Tool (BLAST) on the National Center for Biotechnology Information (NCBI) in the United States to determine the accuracy of the sequencing results. After confirming that the sequences were correct, the reference strain sequences were downloaded, and multiple alignments were performed with the sequenced strain sequences using BioEdit. The phylogenetic tree was constructed using the Maximum Likelihood method with MEGA7.0 software and subjected to 1000 times of Bootstrap tests to complete the strain clustering analysis. The results are as Figure 2 shown in b: NT241 and Trichoderma longibrachiatum formed an obvious branch. The ITS rDNA sequence alignment and results further verified at the molecular biological level that NT241 is Trichoderma longibrachiatum.

[0042] Example 4: Determination of the cellulase activity of Trichoderma longibrachiatum NT241

[0043] (1) Drawing of the glucose standard curve

[0044] Accurately measure 0 mL, 0.2 mL, 0.4 mL, 0.6 mL, 0.8 mL, 1.0 mL, 1.2 mL, 1.4 mL, 1.6 mL, and 1.8 mL of a glucose standard solution with a concentration of 1 mg / mL into 25-mL colorimetric tubes respectively, make up to 2 mL with ultrapure water. After fully mixing the two, add 3 mL of DNS reagent to each colorimetric tube, perform a boiling water bath for 5 min, then quickly cool and make up to 25 mL with ultrapure water. Measure the absorbance of the sample in an ultraviolet spectrophotometer at a wavelength of 540 nm. According to the recorded data, plot a standard curve with the glucose content as the abscissa and the absorbance as the ordinate. The results are as Figure 3 shown.

[0045] (2) Plotting the growth curve of the strain

[0046] The growth characteristics and growth pattern of the strain can be understood from the growth curve of the strain. The growth curve of the Trichoderma longibrachiatum NT241 strain was determined by the weight measurement method. Inoculate the Trichoderma longibrachiatum NT241 in Example 1 into 250 mL of sterilized PDA liquid medium at high temperature for activation, and culture it in a constant temperature oscillator at 30 °C and 180 r / min for 48 h to obtain a seed solution with a cell concentration of 173 mg / L.

[0047] Inoculate the Trichoderma longibrachiatum NT241 seed solution into the lignin fermentation enzyme-producing medium at an inoculation amount of 5% (v / v), and culture it at 30 °C and 180 r / min for 11 days. Starting from the first day of culture, take samples every 24 h. After centrifuging the samples at 12000 r / min and 4 °C for 10 min, remove the supernatant to obtain water-containing mycelial balls, further filter them by suction, place them in an oven at 50 °C and dry them to a constant weight and weigh. Plot a growth curve of the strain NT241 with time - weight as the abscissa and ordinate. The results are as Figure 4 shown: The cell biomass has been increasing until the fourth day when it reaches the maximum growth amount, and the cell biomass at this time is 872 mg / L. After that, it starts to decline and enters the stationary phase.

[0048] (3) Preparation of crude enzyme solution

[0049] Inoculate the strain NT241 into 250 mL of sterilized PDA liquid medium and culture it until the logarithmic growth phase to obtain a seed solution for the next enzyme production culture. Inoculate the seed solution into the lignin fermentation enzyme-producing medium at an inoculation amount of 5% (v / v), and continuously culture it at 30 °C and 180 r / min for 7 days. Take 5 mL of the fermentation broth every day, centrifuge it at 12000 r / min and 4 °C for 10 min, and the supernatant is the crude enzyme solution.

[0050] (4) Determination of filter paper enzyme activity

[0051] Take 4 colorimetric tubes, use 1 as a blank control, and the remaining 3 as experimental parallel tubes. Add 0.5 mL of crude enzyme solution, a 1×6 cm filter paper strip, and 1.5 mL of sodium citrate buffer to the experimental tubes; the blank tube uses the enzyme solution inactivated by boiling for 10 min as a control. After both of the above two types of colorimetric tubes are placed in a water bath at 50 °C for 1 h, add 3 mL of DNS reagent, then place them in a boiling water bath and heat for 5 min. Immediately cool them to room temperature with running water and make the volume up to 20 mL. Use a UV spectrophotometer to measure the absorbance at a wavelength of 540 nm, find the reducing sugar content through the glucose standard curve, and calculate the enzyme activity according to the formula.

[0052] (5) Determination of endo-β-glucosidase activity

[0053] Endo-β-glucosidase plays a key role in cellulose degradation. By cutting the molecular chain, it promotes the further degradation of other enzymes to generate simple sugars such as glucose. The enzyme activity is usually determined by analyzing the amount of reducing sugar generated. After obtaining the crude enzyme solution, add 1 mL of 1% sodium carboxymethyl cellulose, and the subsequent steps are the same as those for "filter paper enzyme activity determination".

[0054] (6) Calculation of cellulase activity

[0055] One enzyme activity unit is defined as the hydrolysis of the substrate by 1 mL of crude enzyme solution to generate 1 μg of glucose in 1 min, and the result is expressed as U / mL. The calculation formula is as follows:

[0056]

[0057] In the formula: X represents the enzyme activity (U / mL), A is the glucose content corresponding to the absorbance (μg), N is the dilution factor of the enzyme solution, V is the volume of the enzyme solution added (i.e., 0.5 mL), and T is the enzyme-catalyzed reaction time (i.e., 60 min).

[0058] The results are as Figure 5 shown. During the filter paper enzyme determination process, the filter paper enzyme activity of Trichoderma longibrachiatum NT241 reached a peak value of 33.14 ± 0.34 U / mL on the 3rd day, indicating that the induced complex enzyme system composed of three enzymes of this strain had a strong combined effect under this condition, but then gradually decreased and stabilized at about 8.23 U / mL. Endo-β-glucosidase is an important component of cellulase, and its activity is usually higher than that of other cellulases. The endo-β-glucosidase activity of Trichoderma longibrachiatum NT241 reached a peak value of 46.60 ± 0.93 U / mL on the 4th day, and then decreased and stabilized at about 23.73 U / mL. Obviously, the endo-β-glucosidase activity of this strain (6.54 - 46.6 U / mL) is generally higher than the filter paper enzyme activity (5.37 - 33.14 U / mL).

[0059] Example 5: Lignin-degrading enzyme activity of Trichoderma longibrachiatum NT241

[0060] After obtaining the crude enzyme solution according to the "preparation of crude enzyme solution" described in Example 3, the lignin-degrading enzyme activity of the strain was measured, usually expressed in enzyme activity units (U).

[0061] (1) Laccase activity assay

[0062] It refers to the amount of enzyme required to catalytically oxidize 1 μmol of ABTS per minute, using the ABTS method. The specific operation is as follows: Take 2 mL of 0.1 mol / L acetic acid-sodium acetate buffer, add 0.5 mL of 0.5 mmol / L ABTS solution and 200 μL of crude enzyme solution, mix well and place in a water bath at 30 °C for 3 min, and measure the change in absorbance at 420 nm.

[0063] (2) Manganese peroxidase activity assay

[0064] It refers to the amount of enzyme required to oxidize 1 μmol of Mn 2+ to Mn 3+ per minute, using the MnSO4 method. The specific operation is as follows: Take 2.5 mL of 50 mmol / L succinic acid-sodium succinate buffer, add 0.4 mL of 1.6 mmol / L MnSO4 solution and 1 mL of crude enzyme solution, then add 100 μL of 10 mmol / L H2O2 solution to initiate the reaction. Mix well and place in a water bath at 37 °C for 3 min, and measure the change in absorbance at 240 nm.

[0065] (3) Lignin peroxidase activity assay

[0066] It refers to the amount of enzyme required to catalytically oxidize 1 umol of veratryl alcohol per minute, using the VA (veratryl alcohol) method. The specific operation is as follows: Take 2.5 mL of 250 mmol / L tartaric acid-sodium tartrate buffer, add 0.4 mL of 10 mmol / L veratryl alcohol and 1 mL of crude enzyme solution, then add 100 μL of 10 mmol / L H2O2 solution to initiate the reaction. Mix well and place in a water bath at 30 °C for 3 min, and measure the change in absorbance at 310 nm.

[0067] (4) Calculation of lignin-degrading enzyme activity

[0068]

[0069] In the formula: ΔOD represents the change in absorbance value within t time, b is the thickness of the cuvette (cm), Δt is the reaction time (min), V 总 is the volume of the reaction system (mL), V 酶 is the volume of the enzyme solution in the reaction (mL); ε is the molar extinction coefficient (M -1 ·cm -1 ), ABTS: ε 420= 36000 M -1 ·cm -1 , ε 240 = 6500 M -1 ·cm -1 , ε 310 = 9300 M -1 ·cm -1 .

[0070] In nature, microorganisms mainly catalyze the decomposition of lignin by producing laccase, lignin peroxidase and manganese peroxidase. The results are as Figure 6 shown. The enzyme activities of Trichoderma longibrachiatum NT241 strain mostly showed a trend of increasing first and then decreasing with time. Among them, the laccase activity gradually increased with the progress of cultivation, reaching the first peak of 3.95 ± 0.13 U / mL on the 3rd day, rapidly decreasing and then rapidly increasing, and reaching the second peak of 10.63 ± 1.72 U / mL on the 7th day of cultivation; the lignin peroxidase was significantly higher than laccase, rising rapidly in the early stage of cultivation and reaching the highest of 12.62 ± 1.59 U / mL on the 3rd day, and then the enzyme activity gradually decreased; the manganese peroxidase activity changed the most, rising to the maximum of 80.95 ± 5.93 U / mL in the first 6 days and then starting to decrease with time.

[0071] Although Examples 4 and 5 proved to a certain extent that the strain has a certain lignocellulose degradation ability, its actual degradation effect on straw needs to be further studied. In subsequent Examples 7 and 8, the strain was actually applied to the decomposition of rapeseed and wheat straw.

[0072] Example 6: Preparation of Trichoderma longibrachiatum NT241 bacterial liquid

[0073] The logarithmic growth phase of Trichoderma longibrachiatum NT241 was determined by growth curve measurement. At this time, the strain grew well, which was also the best time to prepare the liquid bactericide. On the ultra-clean workbench, the seed liquid was inoculated into 250 mL of high-temperature sterilized PDA liquid medium at an inoculation amount of 5% (v / v), and cultured in a constant temperature oscillator at 30 °C and 180 r / min for 3 - 4 days to obtain the liquid bactericide.

[0074] Example 7: Degradation effect of Trichoderma longibrachiatum NT241 on rapeseed straw and wheat straw

[0075] The Trichoderma longibrachiatum NT241 strain is applied to the degradation of lignocellulose in rape straw and wheat straw, and the implementation steps are as follows: The harvested straw is naturally air-dried and mechanically processed to 5 - 10 cm, and 30 g is weighed and placed in a nylon mesh bag for sterilization at 121 °C for 20 min for later use. After sterilization and cooling, sterile water is sprayed to keep the moisture content at 60% - 70%. Four groups are designed in the experiment: three different inoculant addition amounts of 5%, 10%, and 15% are added as experimental groups, and another sterile PDA liquid medium is set as the blank group. After mixing evenly, it is cultured at 30 °C for 14 days. By observing the changes in the morphological characteristics of the straw during the degradation process and the changes in the quality of lignocellulose before and after degradation, the degradation effect of Trichoderma longibrachiatum NT241 on the two crop straws is comprehensively evaluated.

[0076] (1) Physical changes during straw degradation

[0077] Table 1 Physical changes in straw composting

[0078]

[0079] During the composting process, the physical state changes of the straw are a direct manifestation of the decomposition activities of microorganisms in the composting agent. By observing changes in color, smell, hardness, etc., the progress and quality of straw composting can be understood. The above table records the physical changes of the two crop straws during the entire composting process. It can be seen from Table 1 that on the 7th day, the straw in the bacterial liquid treatment group was attached with bacteria, and even the hyphae were wound and aggregated. The color gradually deepened, and there were different odors and hand feelings compared with the control group. As the composting time extended, the color of the straw in the bacterial liquid treatment group gradually deepened from yellowish-brown to dark brown or dark yellow. The ammonia smell and slight mud smell changed to the smell of milk spoilage or wine smell, and the hand feeling gradually became soft.

[0080] (2) Degradation effect of lignocellulose

[0081] The components of straw biomass mainly include cellulose, hemicellulose, and lignin, which are determined by the improved Van Soest washing method using an ANKOM DELTA automatic fiber analyzer. During the analysis process, the samples in the filter bags are washed with acidic detergent or neutral detergent, and the cell contents in the samples are removed, leaving the fiber part. Further weighing and calculation are carried out to obtain the results. The specific operation process is as follows:

[0082] (I) Determination of neutral detergent fiber (NDF)

[0083] Number the filter bags with a marker pen and weigh the filter bags (W1) without pre-drying. Then weigh 0.45 - 0.55 g of the sample (W2) and put it into the filter bag, seal it at 4 mm from the bag mouth and ensure it is firm. Next, accurately weigh a blank filter bag (C1). If the fat content of the sample exceeds 5%, it needs to be defatted first: soak the filter bag in acetone for 10 minutes, take out the filter bag after repeated washing and air-dry it. Place the bracket with the filter bag in the analyzer, place a metal hammer on the top to ensure that the tray is completely immersed under the liquid surface, and then conduct the experiment according to the operation method of the ANKOM instrument.

[0084] (II) Determination of Acid Detergent Fiber (ADF)

[0085] When simultaneously determining NDF and ADF, NDF can be determined first, and then the filter bag containing the residue after the determination can be placed on the sample rack, directly add the acid detergent solution and determine it according to the ADF determination procedure. The subsequent steps are the same as those in the "NDF determination" step. After drying, weigh (W4).

[0086] (III) Determination of Acid Detergent Lignin (ADL)

[0087] After determining ADF, put the dry filter bag into a beaker, add 72% sulfuric acid to cover the sample and soak it. The subsequent steps are the same as those in the "NDF determination" step. After drying, weigh M1, and record the weight of the blank filter bag as C1. Place the dried and weighed sample in a pre-weighed crucible (M2), the weight of the crucible used for the blank is C2, quickly move the crucible to a desiccator after ashing in a muffle furnace and cool it to room temperature and weigh M3. Record the weight of the crucible and the ash of the blank sample as C3.

[0088] (IV) Calculation

[0089]

[0090] In the formula: W1 is the mass of the empty bag (g), W2 is the mass of the sample (g), W3 is the mass of the sample residue + filter bag after medium washing treatment (g), W4 is the mass of the sample residue + filter bag after acid washing treatment (g), and C1 is the blank bag correction factor (mass after drying / original mass).

[0091] Calculate cellulose, hemicellulose and lignin according to the following formula:

[0092] Hemicellulose % = NDF % - ADF %

[0093] Cellulose % = ADF % - (ADL % + ash)

[0094]

[0095] Where: M1 is the mass of the filter bag after acid soaking and drying + sample residue (g), M2 is the constant weight of the crucible (g), and M3 is the mass of the crucible + ash after ashing (g); C1 is the mass of the blank filter bag after acid soaking and drying (g), C2 is the crucible containing the blank sample (g), and C3 is the mass of the crucible + ash containing the blank sample after ashing (g).

[0096] Through determination, it can be known that the initial contents of hemicellulose, cellulose, and lignin in the rapeseed straw used in the experiment are 19.66%, 42.73%, and 20.83% respectively; the initial contents of wheat are 25.6%, 32.12%, and 18.31% respectively. The results are as Figure 7a 、 Figure 7b and Figure 7c shown. During the composting process, due to the activities of microorganisms, lignocellulose is continuously consumed and decomposed, so the degradation rates of hemicellulose, cellulose, and lignin gradually increase.

[0097] For rapeseed straw, on the 14th day, the degradation rate of hemicellulose in the control group is 10.92%, the degradation rate of cellulose is 9.50%, and the degradation rate of lignin is 23.19%. In contrast, the change range of the degradation rate in the bacterial liquid treatment group is more significant. Overall, the degradation rate of the bacterial liquid treatment group increases rapidly from 0 to 7 days, and the increase rate slows down slightly from 7 to 14 days. At the end of the later degradation, the degradation rates of hemicellulose and cellulose in the 15% bacterial liquid treatment group are 21.58% and 22.16% respectively, and the degradation rate of lignin reaches 39.43%.

[0098] For wheat straw, on the 14th day, the degradation rate of hemicellulose in the control group is 15.59%, the degradation rate of cellulose is 15.2%, and the degradation rate of lignin is 25.20%. The overall degradation rate is slightly higher than that of the rapeseed control group. During the composting process, there are significant differences between the bacterial liquid treatment group and the control group, and the action rates on different straws are different. Among them, the degradation rate of the 15% bacterial liquid treatment group increases significantly with time. Finally, the degradation rates of hemicellulose and cellulose are 38.04% and 33.38% respectively, and the degradation rate of lignin is as high as 55.55%.

[0099] Obviously, compared with the two control groups, the addition of bacterial liquid can significantly improve the degradation efficiency, and the whole process basically shows 15% >> 10% > 5% > CK.

[0100] Example 8: Effect of Trichoderma longibrachiatum NT241 on the humus composition of rapeseed straw and wheat straw

[0101] After the cultivation in "Example 7" ended, the humus before and after degradation was determined by the sodium pyrophosphate extraction - potassium dichromate oxidation method. The humus in the sample was extracted by the mixed solution of sodium pyrophosphate and sodium hydroxide. One part of the extract was used to determine the carbon content to determine the total amount of humic acid and fulvic acid, and the other part was acidified and used to determine the content of humin. The content of fulvic acid was calculated by the difference between the total amount and the content of humin, and the content of humin was calculated by the difference between the total carbon content of humus and the carbon content of humic acid. The humification index is the ratio of humic acid to fulvic acid, and the higher the value, the higher the degree of decomposition and transformation of organic matter.

[0102] The changes in the humus of rapeseed straw are as Figure 8 shown. Although there are fluctuations in the changes in the total carbon of humus and the humification index in each treatment group, the trends are generally similar and show a gradual increase over time. Compared with the control group, the total carbon of humus and the humification index in the bacterial liquid treatment group are higher at each sampling period. Under the action of 15% bacterial liquid treatment, the total carbon of humus in rapeseed straw reaches 370.30 ± 7.68 g / kg at the end of degradation, and the humification index is 0.92.

[0103] The changes in the humus of wheat straw are as Figure 9 shown. The change trends of the indexes in each treatment group are generally similar to those of the above-mentioned "changes in the humus of rapeseed straw", with a certain increase. Under the action of 15% bacterial liquid treatment, the total carbon of humus in wheat straw reaches 355.90 ± 8.93 g / kg at the end of degradation, and the humification index is 0.98.

[0104] According to Examples 7 and 8, it is proved that the Trichoderma longibrachiatum obtained in this example can degrade the lignocellulose components of rapeseed straw and wheat straw and has the potential to be applied to straw biodegradation.

[0105] The Trichoderma longibrachii NT241 involved in the present invention has a relatively high enzyme production efficiency. When liquid enzyme production is carried out with lignin as the carbon source, the filter paper enzyme is 33.14 U / mL on the 3rd day, the endo-β-glucanase is as high as 46.60 U / mL on the 4th day, and the manganese peroxidase activity produced on the 6th day is the highest, which is 80.95 U / mL. When applied to the degradation of lignocellulose in rapeseed and wheat straws, the color of the straw in the bacterial liquid treatment group is close to dark brown or dark yellow on the 14th day, and the hand feeling is soft. Among them, the degradation rate of wheat lignin is as high as 55.55%. In addition, in the preparation methods of Trichoderma agents provided by the existing inventions, the time is mostly 2 - 7 days of shaking culture or 3 - 14 days of static culture. However, for the preparation of the liquid Trichoderma longibrachii NT241 agent provided by the present invention, only 3 - 4 days of constant temperature shaking culture is required.

[0106] References

[0107] [1] Zhang Yanping, Zhao Ying, Zhang Yunhui. Screening of mutants of Trichoderma longibrachiatum M-1 and study on its fiber degradation characteristics [J]. China Feed, 2023(17): 22-27.

[0108] [2] Wanyun L, Lili Z, Xueli H. Degradation potential of different lignocellulosic residues by Trichoderma longibrachiatum and Trichoderma afroharzianum under solid state fermentation [J]. Process Biochemistry, 2022, 112: 6-17.

[0109] [3] Huang Yuanyuan, Huang Yali, Ma Huiyuan, etc. A Trichoderma longibrachiatum, its solid microbial inoculant and application [P]. Chinese Patent: CN201811300671.4, 2020-05-12.

[0110] SEQUENCE LISTING

[0111] Sequence Listing

[0112] <110>Guizhou University

[0113] <120>A Trichoderma longibrachiatum and its application

[0114] <130>2024

[0115] <160>1

[0116] <170>PatentIn version 3.5

[0117] <210>1

[0118] <211>628

[0119] <212>DNA

[0120] <213>Trichoderma longibrachiatum NT241

[0121] <400>1

[0122] gcctgcggaggatcattaccgagtttacaactcccaaacccccaatgtgaacgttaccaa 60 tctgttgcct cggcgggatt ctcttgcccc gggcgcgtcg cagccccgga tcccatggcg 120 cccgccggag gaccaactcc aaactctttt ttctctccgt cgcggctccc gtcgcggctc 180 tgttttattt ttgctctgag cctttctcgg cgaccctagc gggcgtctcg aaaatgaatc 240 aaaactttca acaacggatc tcttggttct ggcatcgatg aagaacgcag cgaaatgcga 300 taagtaatgt gaattgcaga attcagtgaa tcatcgaatc tttgaacgca cattgcgccc 360 gccagtattc tggcgggcat gcctgtccga gcgtcatttc aaccctcgaa cccctccggg 420 gggtcggcgt tggggatcgg cccctcaccg ggccgccccc gaaatacagt ggcggtctcg 480 ccgcagcctc tcctgcgcag tagtttgcac actcgcaccg ggagcgcggc gcggccacag 540 ccgtaaaaca ccccaaactt ctgaaatgtt gacctcggat caggtaggaa tacccgctga 600 acttaagcat atcaataagc cggaggaa 628

Claims

1. A Trichoderma longibrachiatum NT241, characterized in that: The preservation number is CGMCC No. 41139, and the preservation address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing; this strain has the activities of laccase, manganese peroxidase, lignin peroxidase, filter paper enzyme and endo-β-glucanase at the same time.

2. The Trichoderma longibrachiatum NT241 according to claim 1, characterized in that: The ITS sequence of this strain is shown as SEQ ID NO.

1.

3. A method for preparing a liquid bacterial agent of Trichoderma longibrachiatum NT241, characterized in that: The Trichoderma longibrachiatum NT241 strain described in claim 1 is inoculated into a potato dextrose agar (PDA) liquid medium and cultured in a constant temperature oscillator at 30 °C and 180 r / min for 3 to 4 days to obtain a liquid bacterial agent.

4. Application of the Trichoderma longibrachiatum NT241 liquid bacterial agent described in claim 3 in degrading rape straw and wheat straw.

5. Use of the Trichoderma longibrachiatum NT241 liquid microbial agent according to claim 4 in degrading rape straw and wheat straw, characterized in that: First, the straw is harvested and naturally air-dried, then mechanically processed into 5 - 10 cm, then sterilized, sterile water is sprayed on the sterilized straw to keep the moisture content at 60 - 70%, and finally 5 - 15% of the Trichoderma longibrachiatum NT241 liquid bacterial agent is added to the straw, and after uniform mixing, it is composted at 30 °C for 14 days.

Citation Information

Patent Citations

  • Trichoderma longibrachiatum strain and application thereof

    CN103131639A

  • Trichoderma longiflorum, solid microbial agent thereof and application thereof

    CN109234173A