Inositol oxygenase mutant and application thereof in preparation of glucaric acid

Abstract

The invention discloses an inositol oxygenase mutant and application of the inositol oxygenase mutant in preparation of glucaric acid. The protein provided by the invention is as follows: one or more amino acid residues in the 151, 253, 119, 295, 63, 92 and 71 sites of an amino acid sequence of wild inositol oxygenase are replaced to obtain the protein with the same function; the invention provides an enzyme activity enhanced inositol oxygenase mutant which is used for fermentation production of glucaric acid, and the yield of the glucaric acid is improved by 1.5 times.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to an inositol oxygenase mutant and application thereof in the preparation of glucaric acid. Background Art

[0002] D-glucaric acid was called "one of the most valuable biorefining products" by the U.S. Department of Energy in 2004 and is widely used in food, medicine, chemical industry and other fields. In the pharmaceutical field, D-glucaric acid can effectively inhibit the activity of β-glucuronidase, prevent and inhibit the formation of cancer and gallstones. D-glucaric acid can also participate in regulating the hormone environment in the body, and has the effects of lowering cholesterol and treating diabetes. In the chemical industry, D-glucaric acid has excellent degradability. It is used as a raw material for industrial products such as synthetic detergents, nylon, and plastics. It can solve the problem of environmental pollution caused by the use of biodegradable materials and reduce the use of fossil fuels.

[0003] At present, the industry mainly produces glucaric acid through chemical oxidation. The catalyst used in this method is expensive, the product yield is low, and it is not suitable for large-scale production. Compared with chemical oxidation, microbial fermentation is more suitable for large-scale production because of its green production process, greatly reduced costs, and easy reaction control.

[0004] The model organism Escherichia coli has a clear genetic background, a clear metabolic pathway, and is easy to culture and operate, which is more conducive to large-scale industrial applications. Researchers constructed the glucaric acid synthesis pathway by heterologously expressing inositol oxygenase (MIOX) and aldehyde dehydrogenase (Udh) in Escherichia coli, and achieved the biosynthesis of glucaric acid in Escherichia coli. However, the enzyme activity of MIOX is low, so the reaction catalyzed by it is considered to be an important rate-limiting step in the glucaric acid synthesis pathway. Therefore, improving the enzyme activity of MIOX is a key problem to be solved in increasing the yield of glucaric acid. Summary of the invention

[0005] At present, in the synthesis pathway of glucaric acid, inositol oxygenase MIOX is the main rate-limiting enzyme, and its enzyme activity is low, which seriously limits the production of glucaric acid. In order to solve the problem of low enzyme activity of inositol oxygenase, it is hoped that the coding gene miox of inositol oxygenase can be rationally designed through bioinformatics methods, the structure of inositol oxygenase can be modified, the enzyme activity of inositol oxygenase can be improved, and thus the production of glucaric acid can be increased.

[0006] The purpose of the present invention is to provide an inositol oxygenase mutant and application thereof in the preparation of glucaric acid.

[0007] In a first aspect, the present invention provides a protein, which is the following A1) or A2) or A3):

[0008] A1) replacing one or more amino acid residues in positions 151, 253, 119, 295, 63, 92, and 71 of the amino acid sequence of the wild-type inositol oxygenase to obtain an inositol oxygenase mutant having the same function;

[0009] A2) a protein having the same function obtained by replacing and / or deleting and / or adding one or more amino acid residues in the amino acid residues other than the amino acid residue at position 151, 253, 119, 295, 63, 92 or 71 of the inositol oxygenase mutant shown in A1);

[0010] A3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in A1) or A2).

[0011] In the above-mentioned protein, the substitution is to mutate the amino acid residue;

[0012] Furthermore, each amino acid residue is mutated as follows:

[0013] The lysine K at position 151 was mutated to alanine A;

[0014] The proline P at position 295 was mutated to glutamine Q;

[0015] Lysine K at position 253 was mutated to leucine L;

[0016] The glutamine Q at position 119 was mutated to glutamic acid E;

[0017] The glycine G at position 63 was mutated to valine V;

[0018] The arginine R at position 92 was mutated to serine K;

[0019] Asparagine N at position 71 was mutated to arginine R.

[0020] Among the proteins mentioned above, the inositol oxygenase activity of the inositol oxygenase mutant is higher than that of the wild-type inositol oxygenase.

[0021] In the embodiment of the present invention, the inositol oxygenase activity of the inositol oxygenase mutant is higher than that of the wild-type inositol oxygenase, which is specifically reflected in that compared with the wild-type inositol oxygenase, the inositol oxygenase mutant has an increased yield of glucaric acid fermentation in combination with aldehyde dehydrogenase.

[0022] In an embodiment of the present invention, the amino acid sequence of the wild-type inositol oxygenase is sequence 11.

[0023] In a second aspect, the present invention provides a nucleic acid molecule encoding the protein of the first aspect.

[0024] In a third aspect, the present invention provides an expression cassette, a recombinant vector or a recombinant microorganism containing the nucleic acid molecule described in the second aspect.

[0025] The recombinant microorganism described above is a recombinant microorganism obtained by introducing the nucleic acid molecule and aldehyde dehydrogenase encoding nucleic acid described in the second aspect into the chassis bacteria.

[0026] In an embodiment of the present invention, the bottom plate bacteria is Escherichia coli.

[0027] In a fourth aspect, the present invention provides the use of the protein described in the first aspect in any of the following B1)-B5);

[0028] Or, the present invention provides the use of the nucleic acid molecule of the second aspect in any of the following B2)-B5);

[0029] Alternatively, the present invention provides a third aspect of the use of an expression cassette, a recombinant vector or a recombinant microorganism containing the nucleic acid molecule of the second aspect in any of the following B2)-B5):

[0030] B1) preparing inositol oxygenase;

[0031] B2) preparing products for producing glucaric acid;

[0032] B3) production of glucaric acid;

[0033] B4) increasing the yield of glucaric acid;

[0034] B5) Improve the conversion rate of inositol.

[0035] In the above, the product for producing glucaric acid is an enzyme system or a precursor substance for producing glucaric acid, and the enzyme system also includes aldehyde dehydrogenase; and the precursor substance is glucuronic acid.

[0036] The above application is that inositol oxygenase cooperates with aldehyde dehydrogenase to catalyze inositol to produce glucaric acid.

[0037] In a fifth aspect, the present invention provides the use of the protein and aldehyde dehydrogenase described in the first aspect in any of the following B2)-B5):

[0038] B2) preparing products for producing glucaric acid;

[0039] B3) production of glucaric acid;

[0040] B4) increasing the yield of glucaric acid;

[0041] B5) Improve the conversion rate of inositol.

[0042] In the above, the product for producing glucaric acid is an enzyme system or a precursor substance for producing glucaric acid, and the enzyme system also includes aldehyde dehydrogenase; and the precursor substance is glucuronic acid.

[0043] In a sixth aspect, the present invention provides a product for producing glucaric acid, which is any one of the following:

[0044] C1) comprising the protein of the first aspect and aldehyde dehydrogenase;

[0045] C2) a recombinant microorganism expressing the protein of the first aspect and aldehyde dehydrogenase;

[0046] C3) Glucuronic acid produced using the protein of the first aspect or a recombinant microorganism containing the nucleic acid molecule of the second aspect.

[0047] In a seventh aspect, the present invention provides a method for producing glucaric acid, comprising the steps of:

[0048] Fermenting and culturing the recombinant microorganism described in the third aspect, collecting the fermentation product, and obtaining glucaric acid;

[0049] The fermentation system contains inositol;

[0050] The recombinant microorganism expresses the protein of the first aspect and aldehyde dehydrogenase.

[0051] In the above, the aldehyde dehydrogenase in the embodiment of the present invention is the udh protein encoded by sequence 2.

[0052] The experiment of the present invention proves that the inositol oxygenase mutant is obtained based on rational design and expressed in Escherichia coli, which increases the fermentation yield of glucaric acid by 1.5 times. The present invention obtains an inositol oxygenase mutant with enhanced enzyme activity, which is used for the fermentation production of glucaric acid, can significantly increase the yield of glucaric acid, and lays a foundation for the large-scale production of glucaric acid. DETAILED DESCRIPTION

[0053] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0054] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0055] The strains and plasmids constructed in the following examples are detailed in Table 1, and the primers used are detailed in Table 2.

[0056] Table 1 shows the strains and plasmids used in the present invention.

[0057]

[0058]

[0059] The following embodiments involve biological materials:

[0060] 2×pfx high-fidelity enzyme is a product of Kangwei Century Biotechnology Co., Ltd., product number: CW2965S.

[0061] 2×rapid taq enzyme is a product of Novozymes, catalog number P222-01.

[0062] DH5α competent cells are products of Nanjing Novozymes Biotech Co., Ltd., catalog number C502-03.

[0063] DpnI digestive enzyme was a product of Thermo Fisher Scientific, No. E101.

[0064] MultiS One Step Cloning Kit, purchased from Vazyme, product number Vazyme.C113-01.

[0065] TB medium: 12 g peptone, 24 g yeast powder, 4 mL glycerol, add water to dissolve and make up to 900 mL, sterilize at 121°C for 20 min;

[0066] Phosphate buffer: KH2PO4 2.31 g, K2HPO4 12.54 g, completely dissolved in water, fixed to 100 mL, sterilized at 121 °C for 20 min;

[0067] Fermentation medium: 100 mL of phosphate buffer was added to 900 mL of TB medium.

[0068] The HPLC detection method of glucaric acid in the following examples:

[0069] The sample was diluted 10 times with sterile water and centrifuged at 12000r / min for 10min. The supernatant was filtered with a 0.22μm filter membrane and then measured by HPLC.

[0070] HPLC chromatographic conditions are as follows: high performance liquid chromatograph (with differential detector), organic acid column: Aminex HPX-87H Column 300x7.8mm; determination mobile phase: 18mmol / L concentrated sulfuric acid; elution condition: constant rate 0.5ml / min; chromatographic column temperature: 35°C, detector temperature: 35°C.

[0071] The standard substance D-glucaric acid (Aladdin, CAS No.: 87-73-0) was used for qualitative detection and standard curve preparation. The retention time of the standard substance D-glucaric acid was 8.6 min.

[0072] The calibration function of glucaric acid is as follows: y = 234892.9952x, R 2 =1, x is the peak area, y is the content of glucaric acid (g / L).

[0073] Example 1. Obtaining inositol oxygenase and its mutants

[0074] 1. Inositol oxygenase and its mutants

[0075] The specific details of inositol oxygenase and its mutants are as follows:

[0076] The amino acid sequence of inositol oxygenase miox1 is sequence 11 in the sequence table, and its encoding gene miox1 is the gene miox1 from Arabidopsis thaliana, and the nucleotide sequence is sequence 1.

[0077] The amino acid sequence of the inositol oxygenase mutant miox1(K151A) is obtained by mutating the lysine K at position 151 of sequence 11 to alanine A, while keeping other amino acid residues unchanged. The nucleotide sequence of the gene encoding the inositol oxygenase mutant miox1(K151A) is sequence 3.

[0078] The amino acid sequence of the inositol oxygenase mutant miox1(K253L) is obtained by mutating the lysine K at position 253 of sequence 11 to leucine L, while keeping other amino acid residues unchanged. The nucleotide sequence of the gene encoding the inositol oxygenase mutant miox1(K253L) is sequence 4.

[0079] The amino acid sequence of the inositol oxygenase mutant miox1(Q119E) is a sequence obtained by mutating the glutamine Q at position 119 of sequence 11 to glutamic acid E, while keeping other amino acid residues unchanged. The nucleotide sequence of the gene encoding the inositol oxygenase mutant miox1(Q119E) is sequence 5.

[0080] The amino acid sequence of the inositol oxygenase mutant miox1(P295Q) is obtained by mutating the proline P at position 295 of sequence 11 to glutamine Q, while keeping other amino acid residues unchanged. The nucleotide sequence of the gene encoding the inositol oxygenase mutant miox1(P295Q) is sequence 6.

[0081] The amino acid sequence of the inositol oxygenase mutant miox1(G63V) is obtained by mutating the glycine G at position 63 of sequence 11 to valine V, while keeping other amino acid residues unchanged. The nucleotide sequence of the gene encoding the inositol oxygenase mutant miox1(G295V) is sequence 7.

[0082] The amino acid sequence of the inositol oxygenase mutant miox1(S58H) is obtained by mutating the serine S at position 58 of sequence 11 to histidine H, while keeping other amino acid residues unchanged. The nucleotide sequence of the gene encoding the inositol oxygenase mutant miox1(S58H) is sequence 8.

[0083] The amino acid sequence of the inositol oxygenase mutant miox1(R92K) is obtained by mutating the arginine R at position 92 of sequence 11 to serine K, while keeping other amino acid residues unchanged. The nucleotide sequence of the gene encoding the inositol oxygenase mutant miox1(R58K) is sequence 9.

[0084] The amino acid sequence of the inositol oxygenase mutant miox1(N71R) is obtained by mutating the asparagine N at position 71 of sequence 11 to arginine R, while keeping other amino acid residues unchanged. The nucleotide sequence of the gene encoding the inositol oxygenase mutant miox1(N71R) is sequence 10.

[0085] 2. Construction of mutation expression vector

[0086] Inositol is converted into glucuronic acid under the action of inositol oxygenase, and glucuronic acid is converted into glucaric acid under the action of uronic acid dehydrogenase (coding gene udh). Among them, the wild-type inositol oxygenase has low enzyme activity. In order to study the effect of different inositol oxygenase mutants on the production of glucaric acid, the inositol oxygenase or its mutant coding gene is co-expressed with the uronic acid dehydrogenase coding gene; the details are as follows:

[0087] 1. Construction of pACYC184-miox1-udh expression vector

[0088] The nucleotide sequence of the udh protein encoding gene from Pseudomonas syringae is sequence 2.

[0089] 184-CF (upstream primer): atggaagccggcggcacctc

[0090] 184-CR (downstream primer): gggaattcctggggatccac

[0091] miox1-F (upstream primer): gtggatccccaggaattcccatgactattctcatagatcg

[0092] miox1-R (downstream primer): atgtatatctccttctcaccattttagcttggacggaaaa

[0093] Udh-F (upstream primer): tggtgagaaggagatatacatatggcgtccgcgcataccac

[0094] udh-R (downstream primer): gaggtgccgccggcttccatttactggtcaccgaacggac

[0095] Using pACYC184 plasmid as template and 184-CF / 184-CR as primers, PCR amplified the pACYC184 linear plasmid vector;

[0096] Using the gene encoding inositol oxygenase MIOX1 shown in sequence 1 as a template and miox1-F / miox1-R as primers, PCR amplified the miox1 gene fragment;

[0097] The udh gene fragment was amplified by PCR using the Udh protein encoding gene shown in SEQ ID NO: 2 as a template and udh-F / udh-R as primers.

[0098] The PCR reaction system used was: ddH2O 19uL, upstream primer 2.5uL, downstream primer 2.5uL, template 1uL, Kangwei 2×pfx high-fidelity enzyme 25uL;

[0099] The PCR reaction procedure is as follows: Step 1: 98°C, 3 min; Step 2: 98°C, 10 s; 55°C, 10 s; 72°C, 1 min; this step is repeated for 30 cycles; Step 3: 72°C, 5 min. Step 4: store at 4°C.

[0100] use The ligation reaction was carried out with MultiS One Step Cloning Kit. The ligation system was: 2 μL of pACYC184 linear plasmid vector, 1 μL of miox1 gene fragment and 1 μL of udh gene fragment, 2 μL of ligase, 2 μL of 5×Buffer, and ddH2O was added to 20 μL; reaction conditions: 37°C, constant temperature metal bath reaction for 30 min to obtain ligation solution. The ligation solution was transferred into DH5a competent cells, cultured overnight, verified by colony PCR, and sent for sequencing to obtain transformants (containing pACYC184-miox1-udh expression plasmid).

[0101] The plasmid was extracted to obtain the pACYC184-miox1-udh expression plasmid.

[0102] The pACYC184-miox1-udh expression plasmid contains the miox1 protein encoding gene shown in sequence 1 and the udh protein encoding gene shown in sequence 2.

[0103] 2. Construction of pACYC184-miox1(K151A)-udh expression vector

[0104] Miox1(K151A)-F:atcttggagctgttcttcttcactcttcatttggtgagctc

[0105] Miox1(K151A)-R:agaagaacagctccaagatcgtggataagaccggtcagat

[0106] Using pACYC184-miox1-udh plasmid as vector and Miox1(K151A)-F / Miox1(K151A)-R as primers, PCR amplified the pACYC184-miox1(K151A)-udh fragment.

[0107] The PCR reaction system used above is: ddH2O 19uL, primers Miox1(K151A)-F / Miox1(K151A)-R 2.5uL each, pACYC184-miox1-udh plasmid template 1uL, Kangwei 2×pfx high-fidelity enzyme 25uL;

[0108] The PCR reaction procedure is as follows: Step 1: 98°C, 3min; Step 2: 98°C, 10s; 55°C, 10s; 72°C, 1min; this step is repeated for 30 cycles; Step 3: 72°C, 5min. Step 4: Store at 4°C. Then add 1uL of DpnI nuclease to digest the plasmid template, and the reaction conditions are 37°C for 1h. Pipette 10uL of the above mixture into DH5a competent cells, culture overnight, perform colony PCR verification, and send for sequencing to obtain a successfully mutated transformant (containing pACYC184-miox1(K151A)-udh expression plasmid).

[0109] The plasmid was extracted to obtain the pACYC184-miox1(K151A)-udh expression plasmid.

[0110] The pACYC184-miox1(K151A)-udh expression plasmid contains the mutant miox1(K151A) encoding gene shown in sequence 3 and the udh protein encoding gene shown in sequence 2.

[0111] 3. Construction of pACYC184-miox1(K253L)-udh expression vector

[0112] Miox1(K253L)-F:tcacctctcagaagcatacaagcatttgatgaacaatgaag

[0113] Miox1(K253L)-R:tgtatgcttctgagaggtgaagagcgtagaacgaatggtatc

[0114] Using pACYC184-miox1-udh plasmid as vector and Miox1(K253L)-F / Miox1(K253L)-R as primers, PCR amplification of pACYC184-miox1(K253L)-udh fragment was performed. The PCR reaction system was: ddH2O 19uL, primers Miox1(K253L)-F / Miox1(K253L)-R 2.5uL, pACYC184-miox1-udh plasmid template 1uL, Kangwei 2×pfx high-fidelity enzyme 25uL; PCR reaction program was: step 1: 98℃, 3min; step 2: 98℃, 10s; 55℃, 10s; 72℃, 1min; this step was repeated for 30 cycles; step 3: 72℃, 5min. Step 4: stored at 4℃. Then add 1uL DpnI nuclease to digest the plasmid template, and the reaction conditions are 37℃ for 1h. Pipette 10uL of the above mixture and transfer it into DH5a competent cells, culture overnight, perform colony PCR verification, and send for sequencing to obtain the successful mutation transformant (containing pACYC184-miox1(K253L)-udh expression plasmid).

[0115] The plasmid was extracted to obtain the pACYC184-miox1(K253L)-udh expression plasmid.

[0116] The pACYC184-miox1(K253L)-udh expression plasmid contains the mutant miox1(K253L) encoding gene shown in sequence 4 and the udh protein encoding gene shown in sequence 2.

[0117] 4. pACYC184-miox1(Q119E)-udh

[0118] Miox1(Q119E)-F:acgaacctgagatcgagcatctgcttcagacagctgaag

[0119] Miox1(Q119E)-R:tgctcgatctcaggttcgtccaaatcaggatcactctcgtc

[0120] Using pACYC184-miox1-udh plasmid as vector and Miox1(Q119E)-F / Miox1(Q119E)-R as primers, PCR amplification of pACYC184-miox1(Q119E)-udh fragment was performed. The PCR reaction system was: ddH2O 19uL, primers Miox1(Q119E)-F / Miox1(Q119E)-R 2.5uL, pACYC184-miox1-udh plasmid template 1uL, Kangwei 2×pfx high-fidelity enzyme 25uL; PCR reaction program was: step 1: 98℃, 3min; step 2: 98℃, 10s; 55℃, 10s; 72℃, 1min; this step was repeated for 30 cycles; step 3: 72℃, 5min. Step 4: stored at 4℃. Then add 1uL DpnI nuclease to digest the plasmid template, and the reaction conditions are 37℃ for 1h. Pipette 10uL of the above mixture and transfer it into DH5a competent cells, culture overnight, perform colony PCR verification, and send for sequencing to obtain the successful mutation transformant (containing pACYC184-miox1(Q119E)-udh expression plasmid).

[0121] The plasmid was extracted to obtain the pACYC184-miox1(Q119E)-udh expression plasmid.

[0122] The pACYC184-miox1(Q119E)-udh expression plasmid contains the mutant miox1(Q119E) encoding gene shown in sequence 5 and the udh protein encoding gene shown in sequence 2.

[0123] 5. pACYC184-miox1(P295Q)-udh

[0124] Miox1(P295Q)-F:aagtgaaacagtattatctctcccttaccaacaagtattt

[0125] Miox1(P295Q)-R:agataatactgtttcacttcctcaacgtttacgcggactttg

[0126] Using pACYC184-miox1-udh plasmid as vector and Miox1(P295Q)-F / Miox1(P295Q)-R as primers, PCR amplification of pACYC184-miox1(P295Q)-udh fragment was performed. The PCR reaction system was: ddH2O 19uL, primers Miox1(P295Q)-F / Miox1(P295Q)-R 2.5uL, pACYC184-miox1-udh plasmid template 1uL, Kangwei 2×pfx high-fidelity enzyme 25uL; PCR reaction program was: step 1: 98℃, 3min; step 2: 98℃, 10s; 55℃, 10s; 72℃, 1min; this step was repeated for 30 cycles; step 3: 72℃, 5min. Step 4: stored at 4℃. Then add 1uL DpnI nuclease to digest the plasmid template, and the reaction conditions are 37℃ for 1h. Pipette 10uL of the above mixture and transfer it into DH5a competent cells, culture overnight, perform colony PCR verification, and send for sequencing to obtain the successful mutation transformant (containing pACYC184-miox1(P295Q)-udh expression plasmid).

[0127] The plasmid was extracted to obtain the pACYC184-miox1(P295Q)-udh expression plasmid.

[0128] The pACYC184-miox1(P295Q)-udh expression plasmid contains the mutant miox1(P295Q) encoding gene shown in sequence 6 and the udh protein encoding gene shown in sequence 2.

[0129] 6. pACYC184-miox1(G63V)-udh

[0130] Miox1(G63V)-F:aggagaagagtcgttgaggaattttacagagtcaatcacattg

[0131] Miox1(G63V)-R:tcctcaacgactcttctcctttcactctcagcatcataat

[0132] Using pACYC184-miox1-udh plasmid as vector and Miox1(G63V)-F / Miox1(G63V)-R as primers, PCR amplification of pACYC184-miox1(G63V)-udh fragment was performed. The PCR reaction system was: ddH2O 19uL, primers Miox1(G63V)-F / Miox1(G63V)-R 2.5uL, pACYC184-miox1-udh plasmid template 1uL, Kangwei 2×pfx high-fidelity enzyme 25uL; PCR reaction program was: step 1: 98℃, 3min; step 2: 98℃, 10s; 55℃, 10s; 72℃, 1min; this step was repeated for 30 cycles; step 3: 72℃, 5min. Step 4: stored at 4℃. Then add 1uL DpnI nuclease to digest the plasmid template, and the reaction conditions are 37℃ for 1h. Pipette 10uL of the above mixture and transfer it into DH5a competent cells, culture overnight, perform colony PCR verification, and send for sequencing to obtain the successful mutation transformant (containing pACYC184-miox1(G63V)-udh expression plasmid).

[0133] The plasmid was extracted to obtain the pACYC184-miox1(G63V)-udh expression plasmid.

[0134] The pACYC184-miox1(G63V)-udh expression plasmid contains the mutant miox1(G63V) encoding gene shown in sequence 7 and the udh protein encoding gene shown in sequence 2.

[0135] 7. pACYC184-miox1(S58H)-udh

[0136] Miox1(S58H)-F:agcatgaaaggagaagaggtgttgaggaattttacagagtcaatc

[0137] Miox1(S58H)-R:acctcttctcctttcatgctcagcatcataatccctgaag

[0138] Using pACYC184-miox1-udh plasmid as vector and Miox1(S58H)-F / Miox1(S58H)-R as primers, PCR amplification of pACYC184-miox1(S58H)-udh fragment was performed. The PCR reaction system was: ddH2O 19uL, primers Miox1(S58H)-F / Miox1(S58H)-R 2.5uL, pACYC184-miox1-udh plasmid template 1uL, Kangwei 2×pfx high-fidelity enzyme 25uL; PCR reaction program was: step 1: 98℃, 3min; step 2: 98℃, 10s; 55℃, 10s; 72℃, 1min; this step was repeated for 30 cycles; step 3: 72℃, 5min. Step 4: stored at 4℃. Then add 1uL DpnI nuclease to digest the plasmid template, and the reaction conditions are 37℃ for 1h. Pipette 10uL of the above mixture and transfer it into DH5a competent cells, culture overnight, perform colony PCR verification, and send for sequencing to obtain the successful mutation transformant (containing pACYC184-miox1(S58H)-udh expression plasmid).

[0139] The plasmid was extracted to obtain the pACYC184-miox1(S58H)-udh expression plasmid.

[0140] The pACYC184-miox1(S58H)-udh expression plasmid contains the mutant miox1(S58H) encoding gene shown in sequence 8 and the udh protein encoding gene fragment shown in sequence 2.

[0141] 8. pACYC184-miox1(R92K)-udh

[0142] Miox1(R92K)-F:taaaacggagatgagcatttgggaatgttgcgagcttctg

[0143] Miox1(R92K)-R:atgctcatctccgttttatttagcttctcgtattcttctctc

[0144] Using pACYC184-miox1-udh plasmid as vector and Miox1(R92K)-F / Miox1(R92K)-R as primers, PCR amplification of pACYC184-miox1(R92K)-udh fragment was performed. The PCR reaction system was: ddH2O 19uL, primers Miox1(R92K)-F / Miox1(R92K)-R 2.5uL, pACYC184-miox1-udh plasmid template 1uL, Kangwei 2×pfx high-fidelity enzyme 25uL; PCR reaction program was: step 1: 98℃, 3min; step 2: 98℃, 10s; 55℃, 10s; 72℃, 1min; this step was repeated for 30 cycles; step 3: 72℃, 5min. Step 4: stored at 4℃. Then add 1uL DpnI nuclease to digest the plasmid template, and the reaction conditions are 37℃ for 1h. Pipette 10uL of the above mixture and transfer it into DH5a competent cells, culture overnight, perform colony PCR verification, and send for sequencing to obtain the successful mutation transformant (containing pACYC184-miox1(R92K)-udh expression plasmid).

[0145] The plasmid was extracted to obtain the pACYC184-miox1(R92K)-udh expression plasmid.

[0146] The pACYC184-miox1(R92K)-udh expression plasmid contains the mutant miox1(R92K) encoding gene shown in sequence 9 and the udh protein encoding gene shown in sequence 2.

[0147] 9. pACYC184-miox1(N71R)-udh

[0148] Miox1(N71R)-F:aattttacagagtcaggcacattggccaaaccgttgatttc

[0149] Miox1(N71R)-R:tgcctgactctgtaaaattcctcaacacctcttctcctttc

[0150] Using pACYC184-miox1-udh plasmid as vector and Miox1(N71R)-F / Miox1(N71R)-R as primers, PCR amplification of pACYC184-miox1(N71R)-udh fragment was performed. The PCR reaction system was: ddH2O 19uL, primers Miox1(N71R)-F / Miox1(N71R)-R 2.5uL, pACYC184-miox1-udh plasmid template 1uL, Kangwei 2×pfx high-fidelity enzyme 25uL; PCR reaction program was: step 1: 98℃, 3min; step 2: 98℃, 10s; 55℃, 10s; 72℃, 1min; this step was repeated for 30 cycles; step 3: 72℃, 5min. Step 4: stored at 4℃. Then add 1uL DpnI nuclease to digest the plasmid template, and the reaction conditions are 37℃ for 1h. Pipette 10uL of the above mixture and transfer it into DH5a competent cells, culture overnight, perform colony PCR verification, and send for sequencing to obtain the transformant with successful mutation (containing pACYC184-miox1(N71R)-udh expression plasmid).

[0151] The plasmid was extracted to obtain the pACYC184-miox1(N71R)-udh expression plasmid.

[0152] The pACYC184-miox1(N71R)-udh expression plasmid contains the mutant miox1(N71R) encoding gene shown in sequence 10 and the udh protein encoding gene shown in sequence 2.

[0153] 3. Construction of recombinant bacteria expressing mutant proteins

[0154] The expression plasmids pACYC184-miox1-udh, pACYC184-miox1(K151A)-udh, pACYC184-miox1(K253L)-udh, pACYC184-miox1(Q119E)-udh, pACYC184-miox1(P295Q)-udh, pACYC184-miox1(G63V)-udh, pACYC184-miox1(S58H)-udh, pACYC184-miox1(R92K)-udh, and pACYC184-miox1(N71R)-udh prepared above were respectively transferred into BL21 strain to construct recombinant bacteria: BL21 / pACYC184-miox1-udh (named Z0), BL21 / pAC YC184-miox1(K151A)-udh (named Z1), BL21 / pACYC184-miox1(K253L)-udh (named Z2), BL21 / pACYC184-miox1(Q119E)-udh (named Z3), BL21 / pACYC184-miox1(P295Q)-udh (named Z4) BL21 / pACYC184-miox1(G63V)-udh (named Z5), BL21 / pACYC184-miox1(S58H)-udh (named Z6), BL21 / pACYC184-miox1(R92K)-udh (named Z7), BL21 / pACYC184-miox1(N71R)-udh (named Z8).

[0155] The transformation steps are as follows: thaw the chemical competent cells BL21 for cloning on ice. Take each of the above expression plasmids and transfer them into 100 μL BL21 competent cells, put them on ice for 30 minutes, heat shock them at 42°C for 90 seconds, quickly put them on ice for 2 minutes, add 1 mL of pre-cooled LB medium, incubate them at 37°C, 200 rpm, and incubate them for 1 hour. Next, centrifuge the culture medium at 8000 rpm for 1 minute, discard the supernatant, keep about 100 μL of resuspended bacteria, and then spread the bacterial suspension on an LB plate containing 25 μg / mL chloramphenicol resistance, at 37°C for 12 hours, until a single colony grows.

[0156] Colony PCR detection was performed on a single colony, and the primers used were 184-YF and 184-YR. The amplified product obtained was a 3333 bp fragment, which was the positive recombinant bacteria Z0-Z8.

[0157] 184-YF:CAAGAGATTACGCGCAGACC

[0158] 184-YR:ACGACAGGAGCACGATCATGC

[0159] Example 2: Preparation of glucaric acid by shake flask fermentation

[0160] The recombinant bacteria Z1-Z8 prepared in Example 1 and a single colony of the recombinant bacteria Z0 as a control were inoculated into LB liquid test tubes and cultured overnight at 37° C. and 200 r / min to obtain culture fluid;

[0161] The above culture solution was transferred to a shake flask containing 50 mL of fermentation medium at a 1% inoculum volume and cultured at 37°C and 200 r / min until OD 600 =0.6-0.8, add 0.5mM IPTG and 0.5g / L inositol respectively, culture at 30℃, 200r / min for 24h, and collect the fermentation broth.

[0162] 1 mL of the fermentation broth was taken as a sample, and the content of glucaric acid in the fermentation broth was detected by HPLC.

[0163] The conversion rate is the glucaric acid output / inositol dosage.

[0164] The results are shown in Table 2. It can be seen that the content of glucaric acid in the control Z0 is 80 mg / L, and the content of glucaric acid in Z1, Z2 and Z4 is significantly increased, among which Z1 has the highest content of 198 mg / L, which is increased by 1.5 times.

[0165] Therefore, Miox1(K151A) has the highest enzyme activity and can significantly increase the production of glucaric acid.

[0166] Table 2 shows the yield of glucaric acid produced by each mutant

[0167]

[0168]

Claims

1. A protein, which is A1) or A2) or A3) as follows: A1) replacing one or more amino acid residues in positions 151, 253, 119, 295, 63, 92, and 71 of the amino acid sequence of the wild-type inositol oxygenase to obtain an inositol oxygenase mutant having the same function; A2) a protein having the same function obtained by replacing and / or deleting and / or adding one or more amino acid residues in the amino acid residues other than the amino acid residue at position 151, 253, 119, 295, 63, 92 or 71 of the inositol oxygenase mutant shown in A1); A3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in A1) or A2); The amino acid sequence of the wild-type inositol oxygenase is sequence 11.

2. The protein according to claim 1, characterized in that: The replacement is to mutate the amino acid residue; Furthermore, each amino acid residue is mutated as follows: The lysine K at position 151 was mutated to alanine A; The proline P at position 295 was mutated to glutamine Q; Lysine K at position 253 was mutated to leucine L; The glutamine Q at position 119 was mutated to glutamic acid E; The glycine G at position 63 was mutated to valine V; The arginine R at position 92 was mutated to serine K; Asparagine N at position 71 was mutated to arginine R.

3. The protein according to claim 1 or 2, characterized in that: The inositol oxygenase activity of the inositol oxygenase mutant is higher than that of the wild-type inositol oxygenase.

4. A nucleic acid molecule encoding the protein according to any one of claims 1 to 3.

5. An expression cassette, recombinant vector or recombinant microorganism containing the nucleic acid molecule according to claim 4.

6. The recombinant microorganism according to claim 5, characterized in that: The recombinant microorganism is a recombinant microorganism obtained by introducing the nucleic acid molecule according to claim 4 and the aldehyde dehydrogenase encoding nucleic acid into a host bacterium.

7. Use of the protein according to any one of claims 1 to 3 in any one of the following B1) to B5); Or, use of the nucleic acid molecule according to claim 4 in any of the following B2)-B5); Or, use of an expression cassette, a recombinant vector or a recombinant microorganism containing the nucleic acid molecule of claim 4 in any of the following B2)-B5): B1) preparing inositol oxygenase; B2) preparing products for producing glucaric acid; B3) production of glucaric acid; B4) increasing the yield of glucaric acid; B5) Improve the conversion rate of inositol.

8. Use of the protein and aldehyde dehydrogenase according to any one of claims 1 to 3 in any one of B2) to B5): B2) preparing products for producing glucaric acid; B3) production of glucaric acid; B4) increasing the yield of glucaric acid; B5) Improve the conversion rate of inositol.

9. A product for producing glucaric acid, which is any of the following: C1) comprising the protein according to any one of claims 1 to 3 and aldehyde dehydrogenase; C2) a recombinant microorganism expressing the protein according to any one of claims 1 to 3 and aldehyde dehydrogenase; C3) Glucuronic acid produced by using the protein according to any one of claims 1 to 3 or a recombinant microorganism containing the nucleic acid molecule according to claim 4.

10. A method for producing glucaric acid, comprising the steps of: Fermenting and culturing the recombinant microorganism according to claim 5 or 6, collecting the fermentation product, and obtaining glucaric acid; The fermentation system contains inositol; The recombinant microorganism expresses the protein according to any one of claims 1 to 3 and aldehyde dehydrogenase.

Images