DsRNA nucleic acid pesticide for preventing and controlling tetranychus urticae and application thereof

Abstract

The invention belongs to the technical field of agricultural biology, and particularly relates to a nucleic acid pesticide for preventing and controlling tetranychus urticae and application of the nucleic acid pesticide. Research finds that after the expression quantity of the Pb1 gene of the tetranychus urticae is reduced by an RNA interference technology, the growth and development abnormity and the death rate of the tetranychus urticae are obviously improved, the medial lethal concentration of the tetranychus urticae is 4.86 ng / mu L, and the prevention and control effects on eggs, larvae and adults are 92.76%, 84.24% and 96.14% respectively when the double-stranded RNA of Pb1 is sprayed on the surfaces of plants, so that the application of the Pb1 gene of the tetranychus urticae is promoted, and the application of the Pb1 gene of the tetranychus urticae is promoted. Therefore, the target gene has great potential in the prevention and control of the tetranychus urticae, and meanwhile, a new way is provided for the prevention and control of the tetranychus urticae by utilizing the double-stranded RNA.

Description

Technical Field

[0001] The invention belongs to the field of agricultural biotechnology, and mainly relates to a dsRNA nucleic acid pesticide for preventing and controlling two-spotted spider mites and application thereof. Background Art

[0002] The two-spotted spider mite belongs to the genus Tetranychus of the family Tetranychidae. It is widely distributed in my country and other countries in Asia, Europe, and is a global pest mite that mainly harms fruit trees, greenhouse vegetables, and other crops and cash crops. The two-spotted spider mite is small in size, has strong reproductive capacity, and spreads quickly. Long-term use of chemical pesticides for prevention and control has led to its strong resistance.

[0003] RNA interference (RNAi), also known as RNA silencing, is a biological phenomenon in eukaryotic organisms that is induced by double-stranded RNA (dsRNA) or siRNA (small interfering RNA) or miRNA (microRNA), which efficiently and specifically degrades or inhibits the expression of homologous mRNA, thereby preventing the translation of target gene protein. RNAi can be used to interfere with the normal growth of target pests, reduce damage to host plants, and ultimately achieve the purpose of controlling pests and protecting plants.

[0004] RNAi technology has great potential in agricultural pest control. At present, companies such as Bayer and Syngenta have developed a number of RNAi-based pest control products. MON87411 also obtained the GMO biosafety certificate (import and food / feed use) issued by the Ministry of Agriculture and Rural Affairs of China in 2021. In particular, in October 2022, the world's first RNA insecticide obtained the English common name Ledprona temporarily approved by the International Organization for Standardization Technical Committee on Common Names of Pesticides, which is a milestone for spray-type RNAi biopesticides to move towards production and application. RNAi technology has great potential for the control of spider mites, but there are currently few reports on the research on the gene function of the two-spotted spider mite and its target genes for insecticidal activity at home and abroad.

[0005] Using foliar spraying of exogenous dsRNA products to control two-spotted spider mites is easy to use and low-cost. Moreover, due to the gene specificity, it can achieve precise and excellent control effects and is environmentally friendly. It has great application prospects in the control of two-spotted spider mites. Summary of the invention

[0006] The invention overcomes the defects and shortcomings of the existing two-spotted spider mite control technology, provides a nucleic acid pesticide for controlling two-spotted spider mites, can significantly reduce the number of two-spotted spider mite eggs, young mites and adult mites, and reduce the harm of two-spotted spider mite to host plants.

[0007] In order to achieve the above object, the present invention is implemented through the following technical solutions.

[0008] The invention firstly discloses a nucleic acid pesticide for preventing and controlling two-spotted spider mites, which is characterized in that the target gene of the nucleic acid pesticide is Pb1, and the nucleotide sequence thereof is shown as SEQ ID NO.1.

[0009] The invention also discloses a nucleic acid pesticide for preventing and controlling two-spotted spider mites, which is characterized in that the target gene Pb1 of the nucleic acid pesticide is used as a template to synthesize dsRNA, and the nucleotide sequence of the dsRNA is shown in SEQ ID NO:2.

[0010] The present invention also discloses the use of nucleic acid pesticides for preventing and controlling spider mites in preventing spider mites and / or preparing products for preventing and controlling spider mites. Experimental results show that after reducing the expression of the Pb1 gene of spider mites by RNA interference technology, its growth and development are abnormal, and the mortality rate is significantly increased. The half lethal concentration of spider mites is 4.86 ng / μL. When the double-stranded RNA of Pb1 is sprayed on the surface of plants, the control effects on eggs, young mites and adult mites are 92.76%, 84.24% and 96.14% respectively, indicating that the target gene has great potential in the prevention and control of spider mites, and the use of double-stranded RNA provides a new way for its prevention and control.

[0011] The present invention designs a specific dsRNA molecule with the Pb1 gene of two-spotted spider mite as the target. The dsRNA molecule can significantly reduce the expression of the target gene in the body and has a significant lethal effect on two-spotted spider mite. The lethal half dose LC 50 The dsRNA molecules provided by the present invention are prepared into nucleic acid pesticide sprays and sprayed on the leaves of plants. The control effect on two-spotted spider mites reaches 93.29%. Therefore, the nucleic acid pesticide provided by the present invention has great potential for controlling two-spotted spider mites in reality.

[0012] The present invention is described in more detail as follows: A nucleic acid pesticide for controlling two-spotted spider mites can significantly reduce their survival rate and reduce their harm to host plants. The target gene of the nucleic acid pesticide Pb1 , whose nucleotide sequence is shown in SEQ ID NO.1.

[0013] A nucleic acid pesticide for controlling two-spotted spider mites can significantly reduce their survival rate and reduce their harm to host plants. The target gene of the nucleic acid pesticide Pb1 , using this as a template to synthesize dsRNA, the nucleotide sequence of the dsRNA is shown in SEQ ID NO: 2.

[0014] The preparation of the dsRNA comprises the following steps: S1, using the cDNA sequence of two-spotted spider mite as a template, synthesized Pb1 Gene fragments; S2, Pb1 The gene fragment was used as a template to design a primer sequence pair containing the T7 promoter sequence; S3, obtaining a dsRNA synthesis template by PCR amplification; S4. Synthesize dsRNA in vitro.

[0015] A nucleic acid pesticide for controlling two-spotted spider mites can significantly reduce their survival rate and reduce their harm to host plants. The target gene of the nucleic acid pesticide Pb1 , using this as a template to synthesize dsRNA, and using this dsRNA to treat the two-spotted spider mite, it causes it to shrink, its body surface to turn black, and finally die.

[0016] A nucleic acid pesticide for controlling two-spotted spider mites can significantly reduce their survival rate and reduce their harm to host plants. The target gene of the nucleic acid pesticide Pb1 , and used it as a template to synthesize dsRNA. After using this dsRNA to treat two-spotted spider mites, the expression level of its target gene decreased significantly.

[0017] A nucleic acid pesticide for controlling two-spotted spider mites can significantly reduce their survival rate and reduce their harm to host plants. The target gene of the nucleic acid pesticide is Pb1 , using this as a template to synthesize dsRNA, and spraying it onto the leaf surface of the host plant. Compared with the control, the population of two-spotted spider mites was significantly reduced, and the color damage of the host plant leaves was significantly reduced.

[0018] A nucleic acid pesticide for preventing and controlling two-spotted spider mites, the Pb1 The application of the target gene or the dsRNA, wherein the application comprises any one of the following: 1) the dsRNA or the Pb1 Application of target genes in the control of two-spotted spider mites; 2) the dsRNA or the Pb1 Application of the target gene in preventing pests of two-spotted spider mites and / or preparing products for preventing and controlling two-spotted spider mites; 3) the dsRNA or the Pb1 Application of the target gene in promoting the death of two-spotted spider mites and / or preparing products that promote the death of two-spotted spider mites.

[0019] The present invention mainly solves the problem of effective prevention and control of the agricultural pest two-spotted spider mite. Through an innovative nucleic acid pesticide method, efficient and specific control of the two-spotted spider mite is achieved, the dependence on traditional chemical pesticides is reduced, and environmental pollution and ecological risks are reduced. The effect of dsRNA (double-stranded RNA) in the prevention and control of the two-spotted spider mite is investigated in detail, mainly including the impact on the phenotype and population size. The main difficulty lies in the efficient and specific targeted silencing effect of dsRNA fragments on the Pb1 gene in the two-spotted spider mite.

[0020] The nucleic acid pesticide for controlling two-spotted spider mites disclosed in the present invention and its application have the following positive effects compared with the prior art: The present invention utilizes nucleic acid pesticide to control two-spotted spider mite by Pb1 Gene synthesis of dsRNA for the control of two-spotted spider mites, which can target and silence the two-spotted spider mites Pb1 The eggs are soaked in dsRNA solution to allow dsPb1 to enter the body of the two-spotted spider mite. The dsRNA can silence / inhibit the two-spotted spider mite Pb1 Gene expression leads to phenotypic abnormalities in the two-spotted spider mite and subsequent death, thereby achieving the purpose of preventing and controlling the two-spotted spider mite.

[0021] The present invention can achieve efficient prevention and control of two-spotted spider mites by spraying dsRNA on leaves, and protect the healthy growth of host plants. The method is easy to operate, has good effectiveness and sensitivity, high insecticidal efficiency, is environmentally friendly and has many advantages, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The effect of soaking eggs in the dsRNA solution in Example 2 on the phenotype of spider mites; Figure 2 The effect of dsRNA solution soaking eggs on the mortality of spider mites in Example 2, lowercase letters a and b represent significant differences; Figure 3 After the eggs were soaked in the dsRNA solution in Example 3, Pb1 Changes in gene expression, lowercase letters a and b represent significant differences; Figure 4 The effect of spraying dsRNA on the growth of potted plants in Example 4; A: plants in the CK group on the 19th day; B: plants in the negative control group on the 19th day; C: plants in the test group on the 19th day; D: plants in the CK group on the 26th day; E: plants in the negative control group on the 26th day; F: plants in the test group on the 26th day; Figure 5 The control effect of spraying dsRNA on two-spotted spider mites in potted plants in Example 4, lowercase letters a and b represent significant differences. DETAILED DESCRIPTION

[0023] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present invention clearer, the present invention is further described in detail in conjunction with the embodiments and the accompanying drawings. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention. The technical solutions of the present invention are described in detail below in conjunction with the embodiments and the accompanying drawings, but the scope of protection is not limited thereto.

[0024] Unless otherwise specified, the reagents, methods and equipment used in the following examples are conventional reagents, methods and equipment in the art. Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0025] The spider mites used in the following examples were raised by the College of Plant Protection of Shanxi Agricultural University. The spider mites were inoculated on peach seedlings and placed in an artificial climate box (temperature 25±1°C, humidity 50%-60%, photoperiod L:D=16:8) for reproduction (can be provided free of charge for external scientific experiments).

[0026] RNA was extracted using the TRIzol extraction method (Invitrogen, USA). The reverse transcription reagent (PrimeScriptTM RTreagent Kit with gDNA Eraser) was purchased from TAKARA Biotechnology Co., Ltd., the dsRNA synthesis kit (T7RiboMAX™ Express RNAi System) was purchased from Promega, USA. The kit used for the PCR reaction system (GoTaq® Green Master Mix) was purchased from Promega, USA. The DNA purification and recovery kit (Universal DNA Purification Kit) was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0027] The data processing method of the following embodiment is as follows: the results of the bioassay of spider mites were analyzed by the egg immersion method, and the mortality of spider mites was counted on the 12th day (the second day of adult mites) starting from the 0th day of the egg, and the data were subjected to T test using SPSS19.0 software. The expression of the target gene was analyzed on the 8th day (molting from the anterior nymph to the posterior nymph), and the qPCR data were calculated using the 2-△△Ct method (Ct represents the number of cycles), and the data were subjected to T test using SPSS 19.0 software. Example

[0028] Two-spotted spider mite target gene Pb1 acquisition and utilization Pb1 Gene synthesized dsRNA (dsPb1) According to the transcriptome library of two-spotted spider mite, we screened Pb1The gene fragment is shown in SEQ ID NO.1.

[0029] 1. Extraction of total RNA from Tetranychus urticae and synthesis of the first-strand cDNA.

[0030] 100 adult spider mites were placed in a 1 mL centrifuge tube, and the total RNA of the spider mites was extracted using the TRIzol method. The concentration and quality of the RNA were determined using NanoDrop, and reverse transcription was performed using a reverse transcription kit (PrimeScript™ RT reagent Kit with gDNA Eraser, TAKARA) according to the instructions to synthesize the first chain of cDNA.

[0031] SEQ ID NO.1 ATGTTTAAGGAAATGCAAAGCTTGGCTAATGTCAGATGACTGACGCGTCTCCTCATAAGGTCGCAGGTTTCTATCCTTATGCTGACAATGGAGGAACTCTGGCCGCTATCGCTGGTGATGGATTTGTTGTAATTGGTGGTGATACAAGATTAACCACTGGATATCAAATT TATTCTAGAGAAGCATCAAAGCTCACCAAACTTACTGATAAAACTATTATTGGTTCCTGTGGATGTTGGTGTGACAGTTTAACGTTTACTAAAGGACTTCATATACGTTTACAATATTATCTGTATGAAAACAACAAGCCAATCTCAACTAATGCTACCGCTCAATTGGTA TCTAATATGCTGTATCAGAAGCGATTCTTCCCTTACTATGTTAGTACTATAGTTGCTGGGTTAGATGCTGATAATCAAGGAGCTGTTTACTCTTATGACCCAGTTGGATCTACTGAACGTCATCGATATCGGGCTCAAGGGACAGCTGGATCTCTAATTCAACCTTCCTT GATTGTGTGCTCGGACGAGGTAACCAGACAGCTCCTGAGCCAGAAAAACTGACAAAAGAGCAGGCTATGATTTATCTAAAAGATGCCTTTATGTCCGCCGCTGAAAGAGAAATAGGTTGTGGTGACTTTTTGCAAATTATGATTGTTACACCACAAGGAGTGGAAGAAGAA CG TTTCAAATTGAGAAAAGATTAA 2. Primer design The transcriptome data of spider mites obtained by our research group were used to screen the two-spotted spider mites. Pb1 The NCBI primer design software Primer-BLAST (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ) was used to design the primers for the gene sequences. Pb1 The full-length primer P1 and dsRNA (sequence number SEQ ID NO. 2) primer P2 (Table 1) of the gene were used to identify the β-glucuronidase gene (GUS). GUS The dsRNA primer P3 of GUS gene (Table 1) was used to amplify the target gene. Pb1 , internal reference gene CycA qPCR primers P4-5 (Table 1).

[0032] SEQ ID NO.2 CGCGTCTCCTCATAAGGTCGCAGGTTTCTATCCTTATGCTGACAATGGAGGAACTCTGGCCGCTATCGCTGGTGATGGATTTGTTGTAATTGGTGGTGATACAAGATTAACCACTGGATATCAAATTTATCTAGAGAAGCATCAAAGCTCACCAAACTTACTGATAAAACTATTATTGGTTCCTGTGGATGTTGGTGTGACAGTTTAACGTTTACTAAAGGACTTCATATACGTTTACAATATTATCTG TATGAAAACAACAAGCCAATCTCAACTAATGCTACCGCTCAATTGGTATCTAATATGCTGTATCAGAAGCGATTCTTCCCTTACTATGTTAGTACTATAGTTGCTGGGTTAGATGCTGATAATCAAGGAGCTGTTTACTCTTATGACCCAGTTGGATCTACTGAACGTCATCGATATCGGGCTCAAGGGACAGCTGGATCTCTAATTCAACCTTTCCTTGATTGTGTGCTCGGACGAGGTAACCAGACAG.

[0033]

[0034] 3. Kit synthesis Pb1 dsRNAs of β-actin and GUS PCR amplification was performed using primers P1 and P2 in Table 1. The reaction system for PCR amplification was RNase Free water 9.5 μL, Go Taq® Green Master Mix 12.5 μL, 10 μM forward primer 1 μL, 10 μM reverse primer 1 μL, and cDNA / GUS plasmid 1 μL. The reaction program for PCR amplification was 94°C pre-denaturation for 3 min; 94°C denaturation for 30 s, 55°C annealing for 30 s, 72°C extension for 1 min, for a total of 30 cycles; 72°C extension for 5 min. The amplified product was stored at 4°C. After the program reaction was completed, the amplification results were detected by agarose gel electrophoresis.

[0035] The two PCR products obtained above were purified using a DNA purification recovery kit (Universal DNA Purification Kit, TIANGEN) and used as templates for in vitro transcription of dsRNA. The in vitro transcription system of dsRNA was TemplateDNA 1000 ng, Enzyme Mix, T7 Express 2 μL, RiboMAX™ Express T7 2× Buffer 10 μL, and Nuclease free water was added to make up to 20 μL. After flicking and spinning, the following reaction was carried out in a water bath: incubation at 37 °C for 4 h, 70 °C for 10 min, and 25 °C for 20 min. After the reaction, 1 μL DNAase and 1 μL RNAase were added, and after incubation at 37°C for 30 min, 2.2 μL sodium acetate solution and 24.2 μL isopropanol were added, and the dsRNA was fully precipitated at -20 °C overnight. The next day, the supernatant was removed after centrifugation at 14000 g for 10 min. The precipitate was washed twice with 75% ethanol and centrifuged to obtain dsRNA. The alcohol in the tube was removed by blowing in the clean bench and dissolved in Nuclease free water. The integrity was detected by 1.5% agarose gel electrophoresis, and the quantification was performed using NanoDrop 2000. The final concentration was diluted to 250 ng / μL to obtain dsPB1 and dsGUS, respectively. The dsRNA bands were verified by 1.5% agarose gel electrophoresis and stored in a -80°C refrigerator. Example

[0036] Effects of dsRNA (dsPb1) on the phenotype and virulence of Tetranychus urticae 1. Test methods Peach leaves were cut into leaf discs with a diameter of 17 mm using a hole puncher. 30-50 female adult mites were moved to the leaf discs. After the female adult mites laid 50 eggs, they were removed and 20 μL dsRNA (250 ng / μL) Tween solution (dsRNA was evenly mixed in the Tween solution to make the final concentration of the Tween solution 0.005%) was evenly applied to all spider mite eggs using a pipette to completely immerse the spider mite eggs in the dsRNA Tween solution. After the spider mite eggs hatched, they continued to be raised on the peach leaf disc, and dsGUS was used as a negative control. Leaves on the 4th day after hatching were collected for detecting the expression of the target gene. Spider mites on the 8th day after hatching were used to count the phenotypic changes and survival rate of spider mites. Three replicates were set for each group. After dsRNA treatment, they were placed in an artificial climate box (temperature 25±1℃, humidity 50%-60%, photoperiod L:D=16:8).

[0037] The dsRNA was diluted to 500, 400, 300, 150, 75, 37.50, 18.75, 9.38, 4.69, 2.34, 1.17, 0.59, and 0.29 ng / μL. The mortality of two-spotted spider mites was counted and the half-lethal dose (LC50) was calculated according to the above method. 50 .

[0038] 2. Test results According to the statistical results, the two-spotted spider mite showed a melanization phenotype after being treated with dsPb1 compared with the control group ( Figure 1 ), the mortality rate of two-spotted spider mites was 94.09% ( Figure 2 ), the toxicity parameters of different concentrations are shown in Table 2, and their LC 50 It is 4.86ng / μL, indicating that dsPb1 can induce a strong RNAi effect in the body of the two-spotted spider mite, leading to abnormal development and subsequent death of the two-spotted spider mite.

[0039]

[0040] Example 3 dsRNA (dsPb1) inhibits the two-spotted spider mite Pb1 Gene expression 1. Experimental methods 200 spider mites were collected on the 4th day after hatching, and their RNA was extracted. Then 1 μg of total RNA was reverse transcribed into cDNA and diluted 10 times as a template for qPCR. P2 and P4 were used as primers for relative quantitative qPCR analysis. The qPCR system contained 7.76 μL of RNaseFree water, 10 μL of 2×SYBR Green (SYBR® Green Realtime PCR MasterMix), 0.32 μL of 10 μM forward primer, 0.32 μL of 10 μM reverse primer, and 1.6 μL of cDNA template. The qPCR reaction instrument model was Bio-Rad C1000 (Bio-Rad, USA). The reaction conditions were 95℃ 30 s; 40 cycles: 95℃ 5 s, 60℃ 30 s, and 3 technical replicates were analyzed for each biological replicate.

[0041] 2. Experimental results After the eggs were treated with dsPb1 solution, the two-spotted spider mite Pb1 The relative expression of the gene decreased by 56.10% ( Figure 3 ), indicating that dsPb1 solution immersion treatment can induce a strong RNAi effect in the two-spotted spider mite, leading to Pb1 The gene expression level was significantly decreased.

[0042] Example 4 Control effect of spraying dsRNA (dsPb1) on two-spotted spider mite 1. Experimental methods Ten adult female two-spotted spider mites were transferred to peach seedlings of the same growth, and the whole plant was covered with 400-mesh gauze to prevent the spread of two-spotted spider mites. On the 5th and 12th days after the transfer of two-spotted spider mites, the peach seedlings were sprayed with H2O, dsGUS and dsPb1 solutions using a handheld pressurized oxygen spray pen. Three replicates were set up in each group. After dsRNA treatment, the peach seedlings were placed in an artificial climate chamber (temperature 25±1℃, humidity 50%-60%, photoperiod L:D=16:8). On the 19th and 26th days, twelve leaves of different sizes were randomly collected from four different directions as samples, and the number of eggs, larvae and adults in them was counted.

[0043] 2. Experimental results On day 26 after the transfer of T. urticae, the plants treated with H2O and dsGUS (control group) showed severe feeding damage, including leaf yellowing, spots, and plant wilting. In contrast, the plants treated with dsPb1 showed minimal leaf yellowing, fewer feeding spots, and overall healthy growth ( Figure 4 ).

[0044] On the 19th day (7 days after the second spraying), the average number of eggs, larvae and adult mites on the dsPb1-treated plants was 7.0, 45.0 and 1.7, respectively; while the average number of the control (H2O) was 414.3, 296.3 and 20, respectively; the average number of the three on the dsGUS-treated plants was 452.7, 217.0 and 17.3, respectively. Compared with the water control group, the number of eggs, larvae and adult mites decreased by 98.31%, 84.81% and 91.67% after dsPb1 treatment ( Figure 5 ).

[0045] On the 26th day (14 days after the second spraying), the average number of eggs, larvae and adults on the plants treated with dsPb1 was 51.7, 56.3 and 4.0, respectively; while the average number of the control group (H2O) was 713.7, 357.3 and 1.03.7, respectively; the average number of the three on the plants treated with dsGUS was 717.7, 456.3 and 172.7, respectively. Compared with the control group, the number of eggs, larvae and adults decreased significantly, with the number of eggs decreased by 92.76%, the number of larvae decreased by 84.24%, and the number of adults decreased by 96.14% ( Figure 5 ).

[0046] The above example is based on the transcriptome library of Tetranychus urticae, and screens out a gene that is highly lethal and affects growth and development: Pb1genes, and developed the use of Pb1 The dsRNA (dsPb1) of the gene was used to control the two-spotted spider mite by soaking the eggs and spraying the leaves. In this example, the eggs of the two-spotted spider mite were soaked in 20 μL of dsPb1 and dsGUS solutions of different concentrations until the solution was absorbed and dried. The eggs were left on the leaves of peach trees until they hatched, and the mortality of the two-spotted spider mite was observed and recorded. Subsequently, the fluorescence quantitative PCR (qPCR) method was used to detect and analyze the Pb1 The expression levels of genes in two-spotted spider mites were changed after treatment with dsPb1 and dsGUS. Finally, dsPb1 was sprayed on the surface of potted plants. The number of two-spotted spider mites at different developmental stages on the leaves of the plants was statistically analyzed and the growth of the plants was evaluated. The results showed that soaking eggs in exogenous dsPb1 solution significantly reduced the expression level of target genes in two-spotted spider mites, affecting their abnormal growth and development and leading to death. Spraying exogenous dsPb1 solution has a significant lethal effect and excellent control effect on two-spotted spider mites.

[0047] The above content is a further detailed description of the present invention in combination with a specific preferred embodiment. It cannot be determined that the specific embodiments of the present invention are limited to this. For ordinary technicians in the technical field to which the present invention belongs, several simple deductions or substitutions can be made without departing from the present invention, which should be regarded as belonging to the present invention and the scope of patent protection determined by the submitted claims.

Claims

1. A dsRNA nucleic acid pesticide for controlling two-spotted spider mites, characterized in that The target gene of the nucleic acid pesticide is Pb1, and its nucleotide sequence is shown in SEQ ID NO.

1.

2. A dsRNA nucleic acid pesticide for controlling two-spotted spider mites, characterized in that The target gene Pb1 of the nucleic acid pesticide is used as a template to synthesize dsRNA, and the nucleotide sequence of the dsRNA is shown in SEQ ID NO:

2.

3. Use of the dsRNA nucleic acid pesticide for controlling two-spotted spider mites according to claim 1 or 2 in preventing two-spotted spider mites and / or preparing products for controlling two-spotted spider mites.

4. Use of the dsRNA nucleic acid pesticide for controlling two-spotted spider mites according to claim 1 or 2 in reducing the survival rate of two-spotted spider mites and reducing their harm to host plants.

Images