KASP molecular markers related to anthocyanins in eggplant peel and their applications
By developing the KASP molecular marker at position 76516913 of chromosome 10 in the eggplant genome, the problem of accuracy in eggplant fruit color identification was solved, and efficient and accurate anthocyanin identification was achieved, supporting eggplant breeding.
Patent Information
- Application Number
- CN202410037514.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-01-10
- Publication Date
- 2025-09-16
- Estimated Expiration
- 2044-01-10
AI Technical Summary
In the existing technology, there are few KASP molecular markers related to eggplant fruit color and their accuracy is not high, making it difficult to efficiently identify whether eggplant peel contains anthocyanins.
A KASP molecular marker with a C→G point mutation located at position 76516913 of chromosome 10 in the eggplant genome was developed. PCR amplification was performed using specific KASP primers, and genotyping data were analyzed to identify the presence of anthocyanins in eggplant peel.
It has achieved an accuracy rate of up to 97.35% in the correspondence between genotype and phenotype in natural populations, and can quickly identify the fruit color of eggplant in a high-throughput manner during the seedling stage, supporting molecular marker-assisted selection breeding of eggplant.
Smart Images

Figure CN119506451B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and more particularly, relates to a KASP molecular marker related to anthocyanins in eggplant peel and an application thereof. Background Art
[0002] Anthocyanidins, also known as flower pigments, are a class of water-soluble natural pigments found widely in plants. They are the primary coloring substances in fruits, vegetables, and flowers. Under varying pH conditions within the plant cell vacuole, anthocyanidins give flower petals their vibrant colors. There are six main types of anthocyanidins: geranium pigment, cyanidin, delphinium pigment, peony pigment, morning glory pigment, and malva pigment. In their natural state, anthocyanidins exist as glycosides called anthocyanins, with very few free anthocyanidins present. Anthocyanidins are primarily used for food coloring, but are also found in dyes, medicine, and cosmetics.
[0003] Eggplant (Solanum melongena L., 2n=24), also known as "fallen sorrel" and "Kunlun melon," is an annual herbaceous to subshrub plant in the genus Solanum of the Solanaceae family. Due to its pleasant taste, rich nutrients, and year-round availability, it is a popular vegetable and an important vegetable crop in my country, Southeast Asia, Africa, and many other countries. Eggplant is rich in nutrients, with the fruit containing protein, fat, carbohydrates, carotene, chlorophyll, anthocyanins, various vitamins, and alkaloids. Eggplant fruit offers a variety of ways to eat, a pleasant taste, and is economical, making it a popular choice among consumers.
[0004] As the second origin and secondary evolutionary center of eggplant, China possesses a rich resource of eggplant seeds. Eggplant exhibits a wide variety of agronomic traits, with fruit color being one of its most intuitive. Currently available eggplant varieties include purple-black, purple-red, light purple, green, and white. This rich variety of fruit colors provides consumers with a wide range of choices. Eggplant fruit color is primarily determined by the content of anthocyanins and chlorophyll. In eggplant, anthocyanin content determines the depth of the purple color of the peel; chlorophyll imparts its green color to the peel. When anthocyanins are absent or present at low concentrations, the fruit appears green. When anthocyanins and chlorophyll coexist, the fruit appears purple-black. If neither anthocyanins nor chlorophyll are present, the fruit appears white.
[0005] Many studies have investigated the genes and transcription factors that regulate anthocyanins in eggplant fruit. However, most of these studies have relied on bioinformatics methods such as transcriptome, metabolome, and GWAS (genome-wide association studies), making it difficult to translate these data into effective molecular markers for practical application. Existing studies have shown few KASP molecular markers that are closely linked to the purple trait in eggplant fruit, and the accuracy of the developed KASP markers has been insufficient when validated in natural populations.
[0006] Therefore, it is very meaningful to develop a KASP molecular marker that is closely linked to the anthocyanin traits in eggplant peel and can efficiently and accurately identify whether the eggplant peel contains anthocyanins. Summary of the Invention
[0007] Based on this, the purpose of the present invention is to provide a KASP molecular marker related to anthocyanins in eggplant peel and its application. Using this KASP molecular marker, whether eggplant peel contains anthocyanins can be efficiently identified, and the accuracy of genotype and phenotype correspondence is high when verified in natural populations.
[0008] The technical solutions for achieving the above-mentioned invention objectives include the following.
[0009] In a first aspect, the present invention provides a KASP molecular marker related to anthocyanins in eggplant peel. The KASP molecular marker is located at position 76516913 of chromosome 10 of the eggplant genome, and a C→G point mutation occurs at position 76516913.
[0010] In a second aspect of the present invention, KASP primers for amplifying the KASP molecular marker associated with anthocyanins in eggplant peel are provided. The KASP primers include an upstream primer F having a sequence as shown in SEQ ID NO: 1. P1 , upstream primer F with a sequence as shown in SEQ ID NO: 2 P2 , and a downstream primer R whose sequence is shown in SEQ ID NO: 3.
[0011] The third aspect of the present invention provides the use of the above-mentioned KASP molecular marker or KASP primer in early identification of eggplant peel color, assisted breeding of eggplant varieties containing anthocyanins in the peel, or preparation of a kit for detecting eggplant peel color.
[0012] A fourth aspect of the present invention provides a kit for detecting the color of eggplant peel, comprising the KASP primers for amplifying the KASP molecular markers associated with anthocyanins in eggplant peel.
[0013] In a fifth aspect, the present invention provides a method for identifying the color of eggplant peel, comprising the following steps: using the DNA of the eggplant to be identified as a template and the above-mentioned KASP primers as amplification primers, performing PCR amplification, and then analyzing the genotyping data.
[0014] The present invention has the following beneficial effects:
[0015] Based on fine-grained mapping, the present invention developed the KASP molecular marker 21QP381 for identifying the presence of anthocyanins in eggplant peel. The applicability of KASP molecular marker 21QP381 was validated using 264 eggplant varieties from across China. The results showed a 97.35% accuracy rate in genotype-phenotype correspondence, demonstrating the molecular marker's superior applicability. Furthermore, KASP molecular marker 21QP381 demonstrated very clear genotyping in F2, F3, F4, and natural populations. Using KASP molecular marker 21QP381, the present invention enables high-throughput, rapid identification of eggplant fruit color during the seedling stage, screening for purple and non-purple eggplants. This provides technical support for molecular marker-assisted selection breeding of eggplant and has significant application value in production. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] Figure 1 The phenotypes of the parents and F1 materials in Example 1 of the present invention, as well as their respective anthocyanin contents.
[0017] Figure 2 This is the fruit color distribution of the F2 population in Example 1 of the present invention.
[0018] Figure 3 This is the visualization result of BSA-seq in Example 1 of the present invention.
[0019] Figure 4 This is the genetic map of the F2 population and the results of progeny identification in Example 1 of the present invention.
[0020] Figure 5 This is the genetic map of the F3 population and the distribution map of molecular marker genotypes and traits in Example 1 of the present invention.
[0021] Figure 6 This is the genetic map and progeny identification diagram of the F4 population in Example 1 of the present invention.
[0022] Figure 7 This is the genotyping of the molecular marker 21QP381 in Example 1 of the present invention in F2, F3, F4, natural populations and advanced inbred lines. DETAILED DESCRIPTION
[0023] To facilitate understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the present disclosure more thorough and comprehensive.
[0024] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art to which this invention pertains. The terms used in this specification are for the purpose of describing specific embodiments only and are not intended to limit the invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.
[0025] In the following examples, the experimental methods without specific conditions are generally carried out under conventional conditions or conditions recommended by the manufacturers. The various commonly used chemical reagents used in the examples are all commercially available products.
[0026] Based on many years of research experience in molecular markers closely linked to eggplant peel color, the inventors of the present invention used "BW2" as the male parent (male, genotype is G / G, and the peel does not contain anthocyanins) and "21E27" as the female parent (female, genotype is C / C, and the peel contains anthocyanins). They hybridized to obtain F1, self-pollinated F1 to obtain a segregating population F2, collected seeds from F2 fruits and sowed them to obtain F3. The same method was used to continue collecting seeds to obtain F4 and F5. Using these as research materials, they sequentially performed BSA pool sequencing, KASP molecular marker development, KASP genotyping, construction of a genetic linkage map, and preliminary and fine mapping of the eggplant purple-black fruit gene. During the fine mapping process, by statistically analyzing the genotypes and phenotypes after molecular marker genotyping, it was found that the molecular marker 21QP381 was closely related to the purple-black fruit gene in F2 and F3. 2:3 、F 3:4 The corresponding genotypes in the population were most closely correlated with the phenotypes, with a 100% correspondence rate. Therefore, molecular marker 21QP381 can be used as a KASP marker for identifying anthocyanin presence in eggplant peel. Further IGV alignment analysis of resequencing sequences from the parents, 21E27 and BW2, revealed that marker 21QP381 harbors a C→G SNP at position 76516913 on chromosome 10 in the HQ-1315 version of the eggplant genome. The genotype at this site in the green eggplant, BW2, is G / G, while that in the purple-black eggplant, C / C. Furthermore, the applicability of KASP marker 21QP381 was validated using 264 eggplant cultivars from across China. The genotype-phenotype correspondence rate reached 97.35%, and KASP marker 21QP381 was clearly genotyped in F2, F3, F4, and natural populations.
[0027] In some embodiments of the present invention, a KASP molecular marker related to anthocyanins in eggplant peel is disclosed. The KASP molecular marker is located at position 76516913 of chromosome 10 of the eggplant genome, and a point mutation from C to G occurs at base 76516913. When the base at position 76516913 is C, the eggplant peel is purple and contains anthocyanins; when the base at position 76516913 is G, the eggplant peel is green and does not contain anthocyanins.
[0028] In other embodiments of the present invention, KASP primers for amplifying the KASP molecular marker related to anthocyanins in eggplant peel are disclosed. The KASP primers include an upstream primer F as shown in SEQ ID NO: 1. P1 , upstream primer F with a sequence as shown in SEQ ID NO: 2 P2 , and a downstream primer R whose sequence is shown in SEQ ID NO: 3.
[0029] In other embodiments of the present invention, the use of the above-mentioned KASP molecular markers or KASP primers in the early identification of eggplant peel color is disclosed.
[0030] In other embodiments of the present invention, the use of the above-mentioned KASP molecular markers or KASP primers in assisted breeding of eggplant varieties containing anthocyanins in the peel is disclosed.
[0031] In other embodiments of the present invention, the use of the above-mentioned KASP molecular marker or KASP primer in preparing a kit for detecting the color of eggplant peel is disclosed.
[0032] In other embodiments of the present invention, a kit for detecting the color of eggplant peel is disclosed, comprising the above-mentioned KASP primers for amplifying the above-mentioned KASP molecular markers related to anthocyanins in eggplant peel.
[0033] In other embodiments of the present invention, a method for identifying eggplant peel color is disclosed, comprising the following steps: using the DNA of the eggplant to be identified as a template and the above-mentioned KASP primers as amplification primers, performing PCR amplification, and then analyzing genotyping data.
[0034] In some embodiments, the PCR amplification reaction system includes: KASP MIX 2.5±0.1 μL, 8-12 μM upstream primer F p1 0.075±0.005μL, 8-12μM upstream primer F p2 0.075±0.005μL, 8-12μM downstream primer R0.2±0.05μL, template DNA 2±0.2μL, and ddH2O to 5μL.
[0035] In some embodiments, the reaction procedure of the PCR amplification is:
[0036] Step 1: 94°C for 15 minutes;
[0037] Step 2: 94°C for 20 seconds;
[0038] Step 3: 78℃ for 10s;
[0039] Step 4: 65℃ for 1min;
[0040] Return to step 2, 10 cycles;
[0041] Step 6: 94℃ for 20s;
[0042] Step 7: 57℃ for 1 min;
[0043] Return to step 6 and repeat 30 times.
[0044] In some embodiments, analyzing the genotyping data includes the following steps: when the genotype is G / G, the peel color is green; when the genotype is C / C, the peel color is purple-black; when the genotype is C / G, the peel color is purple-black.
[0045] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.
[0046] Example 1 Development of KASP molecular marker 21QP381 tightly linked to anthocyanins in eggplant fruit
[0047] 1. Experimental Materials
[0048] The experimental materials used in this experiment: the eggplant high-generation inbred line "BW2", the fruit color is green, the high-generation inbred line "21E27", the fruit color is purple-black; "BW2" is the male parent (Male, genotype is G / G, the fruit peel does not contain anthocyanins), "21E27" is the female parent (Female, genotype is C / C, the fruit peel contains anthocyanins), hybridization to obtain F1, F1 self-pollination to obtain the segregating population F2, F2 fruit collection seeds sowing to obtain F3, the same method continues to collect seeds to obtain F4 and F5. Eggplant materials were planted at the Qilin North Experimental Base of South China Agricultural University and carried out routine field management. The phenotypes of the parents and F1 materials, as well as their respective anthocyanin contents are shown in Figure 2. Figure 1 shown.
[0049] 2. Experimental Methods
[0050] 1. Extraction of genomic DNA from eggplant to be tested
[0051] Extract genomic DNA from the eggplant to be tested. Use the modified CTAB method. The formula for 2% CTAB reagent is shown in Table 1.
[0052] Table 1
[0053] Reagents Usage Tris 12.12g NaCl 82g EDTA 7.44g PVP 2g CTAB 20g <![CDATA[dd H2O]]> Up to 1000mL
[0054] The prepared CTAB was sterilized in an autoclave at 121°C for 20 min, and after cooling, 1 / 1000 of β-mercaptoethanol was added (operated in a fume hood).
[0055] The specific steps for extracting eggplant genomic DNA are as follows:
[0056] a. Sampling: Place young eggplant leaves in a 2 mL centrifuge tube;
[0057] b. Freeze-drying: Uncap the 2 mL centrifuge tube containing the leaves and place it in a freeze dryer at -80°C and 1 mbar for 48 h.
[0058] c. Tissue disruption: Add two steel balls to a 2 mL centrifuge tube, grind in a tissue grinder at 60 Hz for 1 min, and then centrifuge at 10,000 rpm for 30 s.
[0059] d. Extraction: Add 750 μL of 2% CTAB extraction solution and shake vigorously to allow the sample to fully react with it. Place the centrifuge tube in a constant temperature metal bath at 65°C for 45 minutes, shaking once every 20 minutes during the process.
[0060] e. Phase separation: In a fume hood, add 750 μL of a mixture of chloroform and isoamyl alcohol (24:1) to a 2 mL centrifuge tube, shake vigorously to mix thoroughly, and then centrifuge at 10,000 rpm for 6 min.
[0061] f. Precipitate DNA: After centrifugation, take 375 μL of the supernatant and place it in a new 1.5 mL centrifuge tube. Add 750 μL of pre-cooled anhydrous ethanol, shake gently to mix, and place in a -20°C freezer for 1 hour.
[0062] g. Purification: Place the centrifuge tube in a centrifuge and centrifuge at 12,000 rpm for 6 minutes. Discard the supernatant and rinse twice with 750 μL of 70% ethanol. Blot the liquid on the surface of the centrifuge tube with a paper towel and place it in a 65°C oven for 1 to 2 hours to dry.
[0063] h. Dissolution and storage: Add 100 μL of sterile ultrapure water to each centrifuge tube to dissolve, place on a horizontal shaker at 30 rpm at room temperature for 12 hours, and finally store in a -20°C freezer.
[0064] 2. Extraction and determination of anthocyanin content in eggplant peel
[0065] The anthocyanin content of eggplant exocarp was determined by spectrophotometric pH difference method, and the specific operation was as follows:
[0066] Working solution: pH = 1.0 buffer (50mM KCl and 150mM HCl), pH = 4.5 buffer (400mM sodium acetate and 204mM HCl)
[0067] a. Grind 100 mg of eggplant sample into powder in liquid nitrogen;
[0068] b. Add 100 mg of eggplant sample into 2 mL of working solution;
[0069] c. Centrifuge the mixture at 14,000 rpm for 10 min at 4°C;
[0070] d. Take the supernatant and measure it with a 510 nm wavelength spectrophotometer;
[0071] Calculation formula: Total anthocyanins (mg / g FW) = (A1-A2) × 484.8 / 24.825 × dilution factor
[0072] Note: A1 represents the reading of the supernatant in pH = 1.0 buffer at a wavelength of 510 nm; A2 represents the reading of the supernatant in pH = 4.5 buffer at a wavelength of 510 nm; 484.8 is the molecular weight of cyanidin-3-O-glucoside; 24.825 is the molar absorbance at a wavelength of 510 nm.
[0073] 3. BSA pool sequencing
[0074] Fruit color in the F2 population was statistically analyzed. Based on the fruit color distribution, 20 extreme green eggplant plants and 20 extreme purple-black eggplant plants were selected. Equal amounts of DNA from these two populations were mixed to form the green and purple-black eggplant pools, respectively, for BSA sequencing. The parental lines, "Green Eggplant BW2" and "21E27," were resequenced at a 20× sequencing depth for the parental lines and a 30× sequencing depth for the green and purple-black eggplant pools. Using the eggplant HQ-1315 reference genome (https: / / solgenomics.net / ), reliable single nucleotide polymorphisms (SNPs) were identified using BWA, SAM, and GATK software. The SNP-index for each SNP in each pool was then calculated using the parental line, "21E27," as a reference. Based on this data, the SNP-index for the green eggplant pool was subtracted from the SNP-index for the purple-black eggplant pool to obtain the Δ(SNP-index). The SNP-index and Δ(SNP-index) distribution maps were plotted using these data. Based on the eggplant reference genome HQ-1315 published in the Sol Genomics Network database (SGN), the SNP sites of green eggplant "BW2" and "21E27" in the parental resequencing results were compared, and the different SNP sites between the two parents were selected for the development of molecular markers.
[0075] 4. KASP molecular marker development
[0076] Using the screened SNP sites, we developed molecular markers based on the vcf file and fast file obtained from the BSA analysis. The specific steps are as follows:
[0077] a. Find the SNP site within the target interval in the vcf file. Using the physical location of the site, find the 250bp gene sequence before and after the SNP site in the fast file.
[0078] b. In the SNPPrimer function area of the website http: / / www.snpway.com / , enter the gene sequence of 250bp before and after the corresponding SNP site to generate a front primer F with a FAM fluorescent match at the 5' end and a linker sequence of GAAGGTGACCAAGTTCATGCT. P1 , SNP site F with a linker sequence of GAAGGTCGGAGTCAACGGATT that matches HEX fluorescence P2 , and the rear primer R after the SNP site.
[0079] Primer design must meet the following conditions: the length of the amplified target fragment product is between 60 and 200 bp, and the shorter the better if all conditions are met; the primer Tm value is between 57 and 61°C, and the smaller the difference in Tm values between the front and back primers, the better; the CG content of the primer is between 30% and 80%; a primer cannot have five consecutive identical bases.
[0080] Compare the primers to their specificity using BLAST analysis at https: / / solgenomics.net / tools / blast / . Also, note the changes in secondary structure and dimer stability after adding universal adapters to allele-specific primers.
[0081] Primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd. and purified using PAGE gels. Synthesized primers must be dissolved in ultrapure water. Low-quality water or high-concentration TE buffer can affect genotyping results.
[0082] 5. KASP genotyping
[0083] The amplification reaction of KASP genotyping was performed in a 384-well fluorescence quantitative PCR instrument. Before the program started, the sample number corresponding to each well should be set, and two parents, F1 and blank controls should be set at the same time.
[0084] Dilute the extracted genomic DNA from the sample to be tested to 5 ng / μL to 50 ng / μL as a template for the amplification reaction. Prepare the KASP reaction system on ice, and store the KASP MIX in the dark. After preparation, centrifuge at 1200 rpm for 1 minute. The PCR reaction system is shown in Table 2. The KASP amplification reaction procedure is shown in Table 3.
[0085] Table 2
[0086] Ingredients Usage amount / μL KASP MIX 2X 2.5 <![CDATA[F p1 (10μM)]]> 0.075 <![CDATA[F p2 (10μM)]]> 0.075 R (10 μM) 0.2 Template DNA 2 <![CDATA[ddH2O]]> 0.15
[0087] Table 3
[0088] Program number Operation requirements time 1 94℃ 15min 2 94℃ 20s 3 78℃ 10s 4 65℃(0.5℃ drop per cycle) 1min 5 Return to step 2, 10 cycles 6 94℃ 20s 7 57℃ 1min 8 Return to step 6, 30 cycles 9 Plate reading
[0089] KASP genotyping data analysis: The final fluorescence signals were analyzed using CFX Maestro V4.1, the included analysis software for the C1000 Touch, to generate SNP typing results. Samples with yellow circles clustered on the X-axis (i.e., Allele 1 channel signals reported) indicate the allele type connected to the FAM fluorescent linker. Samples with blue squares clustered on the Y-axis (i.e., Allele 2 channel signals reported) indicate the allele type connected to the HEX fluorescent linker. Samples with signals clustered above the diagonal of the XY axis (i.e., green triangles) indicate heterozygosity for both alleles.
[0090] 6. Construction of genetic linkage map and preliminary gene location
[0091] Using the 95% confidence intervals found by BSA-seq, KASP molecular markers were designed and screened. Genotyping was performed in different segregating populations, and the results were compiled into an Excel spreadsheet. Genotypes identical to the green eggplant parent were replaced with "0," genotypes identical to the purple-black eggplant parent were replaced with "2," heterozygous genotypes were replaced with "1," and undefined or no signal was replaced with "-1." Genetic distances were calculated using the MAP function of QTL Ici Mapping 4.2, and a genetic linkage map was constructed. Recombination frequencies were converted using the Kosambi mapping function to estimate mapping distances in centimeters. QTL analysis for eggplant fruit color traits was then performed using the BIP function of QTL Ici Mapping, using a LOD value of 2.5 as the threshold for identifying QTL presence, to determine gene localization results.
[0092] 3. Experimental Results
[0093] 1. Analysis of the genetic patterns of eggplant fruit color
[0094] The characteristics of the two parental populations of green eggplant "BW2" and "21E27", and the F1 and F2 segregating populations were investigated and statistically analyzed. The fruit color of the F2 population was assigned a value based on the anthocyanin content: 1 (green eggplant), 2 (light purple), 3 (purple-red), 4 (dark purple), and 5 (purple-black). The results are as follows Figure 2 Among the 175 purple and green eggplant segregating populations, there were 121 purple eggplants (phenotypic values: 2, 3, 4, 5) and 54 green eggplants (phenotypic value: 1), with a broad heritability of 0.97; the fruit color trait of the F2 segregating population met the purple eggplant: green eggplant ratio of 3:1 (x 2 =1.8867, P=0.157), indicating that eggplant fruit color conforms to Mendel's law of inheritance controlled by a single gene, and that eggplant fruit color has a stable genetic effect, with purple eggplant being dominant over green eggplant. At the same time, the purple depth of eggplant fruit in the F2 population varied greatly, suggesting that other loci may regulate the degree of fruit purple.
[0095] 2. Preliminary positioning of the purple-black fruit gene in eggplant
[0096] By crossing the green eggplant "BW2" and "21E27" parental lines, an F1 (BW2×21E27) was obtained. The F1 was self-pollinated to obtain an F2 segregating population. From the 175 F2 populations, 20 green eggplant plants and 20 purple-black eggplant plants were selected to construct the green eggplant pool and the purple-black eggplant pool, respectively. Genomic DNA from the two populations was extracted using a modified CTAB method. Ultimately, BSA-seq mapped the gene controlling eggplant fruit color to the 64.4Mb-81.6Mb interval (95% confidence level) on Chr 10, with a total length of approximately 17.2Mb. Figure 3 shown.
[0097] According to the target region on chr10 in the BSA-seq results, 54 pairs of KASP molecular markers were developed using high-quality SNP sites in the region. After screening and detection of parental and F1 genotypes, 34 pairs of KASP molecular markers were finally selected for population genotyping, and the molecular marker polymorphism accounted for 63%. 175 F2 populations were genotyped using 34 pairs of polymorphic molecular markers, and 17 pairs of fine-positioning key molecular markers were finally selected to construct a genetic map. The names of the molecular marker primers and the corresponding sequences (see the sequence list for details) are 22QP119 (SEQ ID NO: 19-21), 22QP158 (SEQ ID NO: 4-6), 22QP116 (SEQ ID NO: 7-9), 21QP450 (SEQ ID NO: 10-12), 22QP107 (SEQ ID NO: 13-15),
[0098] 22QP113 (SEQ ID NO: 16~18), 21QP381 (SEQ ID NO: 1~3), 22QP152 (SEQ ID NO: 22~24),
[0099] 21QP421 (SEQ ID NO: 25~27), 21QP418 (SEQ ID NO: 28~30), 21QP415 (SEQ ID NO: 31~33),
[0100] 21QP394 (SEQ ID NO: 34~36), 22QP92 (SEQ ID NO: 37~39), 21QP406 (SEQ ID NO: 40~42), 21QP403 (SEQ ID NO: 43~45), 21QP438 (SEQ ID NO: 46~48), 22QP95 (SEQ ID NO:49~51).
[0101] The results of F2 population genotyping were used to calculate genetic distances using the MAP function of QTL Ici Mapping 4.2 to construct a genetic linkage map; combined with the fruit color survey data of each plant, the BIP function of Ici Mapping was used to perform QTL analysis on eggplant fruit color traits. Based on the ICIM method, the LOD value of 2.5 was used as the threshold for judging the presence of QTL, and finally a QTL locus related to the purple color of eggplant fruit was detected between the molecular marker 22QP107 and the molecular marker 21QP421. The LOD value of this QTL locus is 104.1718, the PVE is 89.3262%, the physical distance between the molecular markers at both ends of the positioning interval is 13.6Mb, and the genetic distance is 10.62CM. The accuracy of the initial positioning interval was further verified by progeny identification of key plants. The results are as follows Figure 4 shown.
[0102] 3. Fine positioning
[0103] In order to further narrow the positioning range, expand F 2:3 The population was expanded to 864 strains, and 106 recombinant strains were screened. New KASP molecular markers were developed within the initial positioning interval in order to further narrow the positioning interval. 2:3 The genetic distances of all molecular marker genotyping results in the population were calculated using the above method to construct a genetic linkage map. Combined with the fruit color survey data of the recombinant individual plants, QTL analysis of eggplant fruit color traits was performed using the BIP function of Ici Mapping. Based on the ICIM method, an LOD value of 2.5 was used as the threshold for determining the presence of QTLs, and the interval was ultimately located between 21QP421 and molecular marker 21QP450. The genetic distance of the interval was 3.71CM, and the physical distance was 13.6Mb. The results are as follows Figure 5 The names of the molecular marker primers and their corresponding sequences (see the sequence listing for details) are 21QP394 (SEQ ID NOs: 34-36), 21QP415 (SEQ ID NOs: 31-33), 21QP418 (SEQ ID NOs: 28-30), 21QP421 (SEQ ID NOs: 25-27), 22QP152 (SEQ ID NOs: 22-24), 22QP107 (SEQ ID NOs: 13-15), 21QP381 (SEQ ID NOs: 1-3), 22QP113 (SEQ ID NOs: 16-18), 21QP450 (SEQ ID NOs: 10-12), and 22QP116 (SEQ ID NOs: 7-9).
[0104] Since the positioning results of the F3 population did not narrow compared to the F2 population positioning interval, we continued to expand the planting of F 3:4The population was finally divided into 864 strains F 3:4 In the population, recombinant plants were screened using molecular markers at both ends of the initial positioning interval, and a total of 52 recombinant plants were screened. Using the above method, new molecular markers were developed to encrypt the initial positioning interval. The key QTL was eventually located between the two markers 23QP578 and 23QP602, with a physical distance of 86kb and a genetic distance of 0.58CM. The accuracy of the positioning interval was further verified by identifying the progeny of the key plants. The results are as follows Figure 6 The names of the molecular marker primers and their corresponding sequences (see sequence listing for details) are 21QP394 (SEQ ID NOs: 34-36), 23QP205 (SEQ ID NOs: 52-54), 23QP202 (SEQ ID NOs: 55-57), 23QP199 (SEQ ID NOs: 58-60), 23QP193 (SEQ ID NOs: 61-63), 23QP190 (SEQ ID NOs: 64-66), 23QP187 (SEQ ID NOs: 67-69), 23QP572 (SEQ ID NOs: 70-72), 22QP152 (SEQ ID NOs: 22-24), 22QP107 (SEQ ID NOs: 13-15), 22QP113 (SEQ ID NOs: 16-18), 23QP581 (SEQ ID NOs: 73-75), 23QP578 (SEQ ID NOs: 76-77), and 23QP587 (SEQ ID NOs: 78-79). NO:76~78), 21QP381 (SEQ ID NO:1~3), 23QP602 (SEQ ID NO:79~81), 23QP459 (SEQ ID NO:82~84), 23QP566 (SEQ ID NO:85~87), 23QP518 (SEQ ID NO:88~90).
[0105] 4. Development of molecular markers tightly linked to purple-black eggplant fruit
[0106] During the fine positioning process, the genotype and phenotype after molecular marker genotyping were statistically analyzed and it was found that the KASP molecular marker 21QP381 was significantly expressed in F2 and F 2:3 、F 3:4 The corresponding genotypes in the population were most closely linked to the phenotypes, with a 100% correspondence rate. The results are shown in Table 4. IGV alignment analysis of the resequencing sequences of the parents, "21E27" and "BW2," revealed that molecular marker 21QP381 harbors a C→G SNP at position 76516913 on chromosome 10 in the HQ-1315 version of the eggplant genome. The genotype at this site in the green eggplant, "BW2," is "G / G," while the genotype at this site in the green eggplant, "21E27," is "C / C."
[0107] In F2, F 2:3 、F 3:4 In the population, after 21QP381 genotyping, when the genotype is consistent with "BW2", the eggplant fruit is green, when the genotype is consistent with "21E27", the eggplant fruit is purple, and when the genotype is heterozygous, the eggplant fruit is purple. The correspondence between genotype and phenotype is shown in Table 4, where A is the "BW2" genotype, that is, G / G, B is the "21E27" genotype, that is, "C / C", and H is the heterozygous genotype, that is, C / G. The genotyping results are shown in Table 4. Figure 7 .
[0108] Table 4 Correspondence between genotype and phenotype of molecular marker 21QP381 in F2, F3 and F4 populations
[0109]
[0110] Therefore, 21QP381 can be used as a KASP molecular marker to identify whether eggplant peel contains anthocyanins. The primers for amplifying this KASP molecular marker include:
[0111] F P1 (SEQ ID NO: 1):
[0112] GAAGGTGACCAAGTTCATGCT CAAAACATCCAAATTTGCCCATGG,
[0113] F P2 (SEQ ID NO: 2):
[0114] GAAGGTCGGAGTCAACGGATT CAAAACATCCAAATTTGCCCATGC,
[0115] R (SEQ ID NO: 3):
[0116] GGGTACACATATACAAGGGTGACA.
[0117] Example 2 Validation of KASP Molecular Marker 21QP381 in Natural Eggplant Populations
[0118] The color of purple eggplant peel is closely related to the anthocyanin content. In order to verify the applicability of this molecular marker, a total of 264 eggplant varieties from all over the country and homozygous high-generation inbred lines constructed by the applicant's research group displayed at the 2021 Guangdong Seed Expo were used as materials. The list of eggplant materials is shown in Table 5.
[0119] Table 5 Natural population variety / inbred line information
[0120]
[0121]
[0122]
[0123]
[0124]
[0125]
[0126]
[0127] Eggplant genomic DNA was extracted using a modified CTAB method (see Example 1). Genotyping of the natural population was performed using the molecular marker 21QP381 according to the KASP PCR amplification system and amplification procedure shown in Tables 2 and 3. The correspondence between the genotyping results and the phenotypes is shown in Table 6.
[0128] Table 6 Correspondence between genotype and phenotype of molecular marker 21QP381 in natural populations
[0129]
[0130] As shown in Table 6, there were 22 strains with the "BW2(A)" genotype (2 strains with anthocyanin in the outer peel and 20 strains without anthocyanin), 238 strains with the "21E27(B)" genotype (235 strains with anthocyanin in the outer peel and 3 strains without anthocyanin), 3 strains with heterozygous genotype (1 strain with anthocyanin in the outer peel and 2 strains without anthocyanin), and one strain with incorrect genotyping. The accuracy rate of genotype-phenotype correspondence was 97.35%. The genotyping results are shown in Table 6. Figure 7 .
[0131] Therefore, 21QP381 can be used as a molecular marker to identify whether eggplant peel contains anthocyanins.
[0132] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the patent for this invention shall be determined by the appended claims.
Claims
1. A reagent for detecting KASP molecular markers related to anthocyanins in eggplant peel in detecting anthocyanin content in eggplant peel, characterized in that: The KASP molecular marker is located at position 76516913 of chromosome 10 in the HQ-1315 version of the eggplant genome. A point mutation C→G occurs at the base at position 76516913. When the base at position 76516913 is C, the eggplant peel is purple and contains anthocyanins; when the base at position 76516913 is G, the eggplant peel is green and does not contain anthocyanins.
2. A KASP primer for amplifying the KASP molecular marker related to anthocyanins in eggplant peel according to claim 1, characterized in that: The KASP primers include an upstream primer F as shown in SEQ ID NO:
1. P1 , upstream primer F with a sequence as shown in SEQ ID NO: 2 P2 , and a downstream primer R whose sequence is shown in SEQ ID NO:
3.
3. Use of the KASP primers according to claim 2 in early identification of eggplant peel color.
4. Use of the KASP primer according to claim 2 in assisted breeding of eggplant varieties containing anthocyanins in the peel.
5. Use of the KASP primers according to claim 2 in preparing a kit for detecting eggplant peel color.
6. A kit for detecting the color of eggplant peel, characterized in that: The invention comprises the KASP primers for amplifying the KASP molecular marker related to anthocyanins in eggplant peel as described in claim 2.
7. A method for identifying the color of eggplant peel, characterized in that: The method comprises the following steps: using the DNA of the eggplant to be identified as a template, using the KASP primers described in claim 2 as amplification primers, PCR amplifying the KASP molecular markers described in claim 1, and analyzing the genotyping data; when the genotype is G / G, the peel color is green; when the genotype is C / C, the peel color is purple; and when the genotype is C / G, the peel color is purple.
8. The method for identifying eggplant peel color according to claim 7, wherein The PCR amplification reaction system includes: KASP MIX 2.5±0.1μL, 8~12μM upstream primer F p1 0.075±0.005μL, 8-12 μM upstream primer F p2 0.075±0.005μL, 8-12 μM downstream primer R 0.2±0.05μL, template DNA 2±0.2μL, and ddH2O to 5μL.
9. The method for identifying eggplant peel color according to claim 7, wherein The reaction procedure of the PCR amplification is: Step 1: 94°C for 15 min; Step 2: 94°C for 20 seconds; Step 3: 78°C for 10 s; Step 4: 65℃ for 1 min; Return to step 2, 10 cycles; Step 6: 94°C for 20 s; Step 7: 57°C for 1 min; Return to step 6 and repeat 30 times.
Citation Information
Patent Citations
SNP (Single Nucleotide Polymorphism) molecular marker closely linked with eggplant fruit color and application
CN114703312A
KASP molecular marker related to eggplant fruit color and application of KASP molecular marker
CN116640872A