Development and application of molecular marker for identifying female parent of pine tree

Abstract

The invention discloses development and application of a molecular marker for identifying a female parent of a pine tree. The technical problem to be solved is how to identify or assist in identifying the female parent of the pine tree. Specifically, the invention discloses application of substances for detecting SNP40, SNP81, SNP318, SNP443, SNP521 and / or SNP590 in identifying a female parent of a pine to be detected or preparing a product for identifying the female parent of the pine to be detected. The SNP40 is an SNP in pine mitochondria, is the 40th nucleotide of a sequence 1, and is C or T; the SNP81 is an SNP in pine mitochondria, is the 81st nucleotide of a sequence 1, and is A or C; the SNP254 is an SNP in pine mitochondria, is the 254th nucleotide of a sequence 1, and is C or T; the SNP318 is an SNP in pine mitochondria, is the 318th nucleotide of a sequence 1, and is A or C; the SNP443 is an SNP in pine mitochondria, is the 443rd nucleotide of a sequence 1, and is G or T; the SNP521 is an SNP in pine mitochondria, is the 521th nucleotide of a sequence 1, and is G or T; the SNP590 is an SNP in pine mitochondria, is a 590th nucleotide of a sequence 1, and is A or C. The source of a female parent to be detected is determined according to the sequence, and the invention can be used for industrial and agricultural production.

Description

Technical Field

[0001] The present invention specifically relates to the development of a molecular marker for pine maternal parent identification and its application. Background Art

[0002] Traditionally, the classification of pine trees is mainly based on germplasm identification based on phenotypic traits. However, morphological characteristics are not reliable in distinguishing some tree species. This is mainly manifested in the following ways: some species have overlapping areas in natural distribution, and there is no reproductive isolation, but the genetic variation within the species is large, and these species are not easy to distinguish; the offspring produced by hybridization of different tree species usually have morphological characteristics and anatomical traits between the two parents; some pine tree species have large variation in morphological traits within the population, and under different site conditions, the same population has significant morphological variation, which affects the observation results; and some interspecific trait differences are only manifested at a certain stage of growth and development, and it is impossible to judge their maternal origin in the early stages.

[0003] With the development of molecular markers, mature and reliable technologies have been provided for the identification of germplasm with consistent genetic background. Among all molecular markers, microsatellite markers (simple sequence repeat, SSR) and ISSR (inter-simplesequence repeat) technologies are more stable than RAPD (random amplified polymorphic DNA) and AFLPs (amplified fragment length polymorphisms). The former is widely used in the identification of germplasm of closely related species and hybrids and the evaluation of genetic diversity of germplasm, but the disadvantage is that specific primers need to be designed, and the cost of developing a large number of primers is high. In addition, SSR and ISSR can only determine the parent tree species of hybrid offspring, and cannot further distinguish the paternal and maternal parents of hybrid offspring. How to identify the source of the maternal parent of pine trees is a technical problem faced by people in this field. Summary of the invention

[0004] The technical problem solved by the invention is how to provide a method for identifying the origin of the female parent of a pine tree.

[0005] In order to solve the above technical problems, the present invention provides the following applications.

[0006] Use of a substance for detecting SNP40, SNP81, SNP318, SNP443, SNP521 and / or SNP590 in identifying a pine parent to be tested or in preparing a product for identifying a pine parent to be tested;

[0007] The SNP40 is a SNP in pine mitochondria, which is the 40th nucleotide of sequence 1, which is C or T;

[0008] The SNP81 is a SNP in pine mitochondria, which is the 81st nucleotide of sequence 1, and is A or C;

[0009] The SNP254 is a SNP in pine mitochondria, which is the 254th nucleotide of sequence 1, which is C or T;

[0010] The SNP318 is a SNP in pine mitochondria, which is the 318th nucleotide of sequence 1, which is A or C;

[0011] The SNP443 is a SNP in pine mitochondria, which is the 443rd nucleotide of sequence 1, which is G or T;

[0012] The SNP521 is a SNP in pine mitochondria, which is the 521st nucleotide of sequence 1, which is G or T;

[0013] The SNP590 is a SNP in pine mitochondria, which is the 590th nucleotide of sequence 1, and is A or C.

[0014] In the present application, the pine mother plant may be a pine mother plant source.

[0015] In the above, the pine tree mother plant to be tested may be any one of Pinus sylvestris var. mongolica, Pinus densiflora, Pinus tabulaeformis, Pinus koraiensis, Pinus pentaphyllum, Pinus armandii, Pinus bungeana or Pinus thunbergii.

[0016] In order to solve the above technical problems, the present invention also provides the following applications.

[0017] The application is any of the following:

[0018] 1) Application of a substance for detecting SNP40 in the preparation of a product for identifying whether the pine tree parent to be tested is from Pinus armandii;

[0019] 2) Use of a substance for detecting SNP81 in preparing a product for identifying whether the pine tree parent to be tested is from North American pine;

[0020] 3) Use of a substance for detecting SNP318 in preparing a product for identifying whether the pine tree parent to be tested is from white pine;

[0021] 4) Use of a substance for detecting SNP521 in preparing a product for identifying whether the pine tree parent to be tested is from Korean pine;

[0022] 5) Application of substances for detecting SNP40 and SNP590 in the preparation of products for identifying whether the pine tree parent to be tested is from Xinjiang five-needle pine;

[0023] 6) Use of substances for detecting SNP254 and SNP443 in preparing products for identifying whether the pine tree parent to be tested is from Pinus tabulaeformis;

[0024] 7) Use of a substance for detecting SNP443 in preparing a product for identifying whether a pine tree parent to be tested is from pine tree A, wherein the pine tree A component is Pinus sylvestris and Pinus densiflora;

[0025] The SNP40 is a SNP in pine mitochondria, which is the 40th nucleotide of sequence 1, which is C or T;

[0026] The SNP81 is a SNP in pine mitochondria, which is the 81st nucleotide of sequence 1, and is A or C;

[0027] The SNP254 is a SNP in pine mitochondria, which is the 254th nucleotide of sequence 1, which is C or T;

[0028] The SNP318 is a SNP in pine mitochondria, which is the 318th nucleotide of sequence 1, which is A or C;

[0029] The SNP443 is a SNP in pine mitochondria, which is the 443rd nucleotide of sequence 1, which is G or T;

[0030] The SNP521 is a SNP in pine mitochondria, which is the 521st nucleotide of sequence 1, which is G or T;

[0031] The SNP590 is a SNP in pine mitochondria, which is the 590th nucleotide of sequence 1, and is A or C.

[0032] In the above, the sequence 1 is a mitochondrial DNA sequence, which includes an intron sequence. In the actual detection process, SNP40, SNP81, SNP254, SNP318, SNP443, SNP521, and SNP590 can be detected and analyzed by detecting the nucleotide sequence of the mRNA transcribed from the sequence 1, the cDNA reversely transcribed from the mRNA, or the amino acid sequence of the protein encoded by the sequence 1.

[0033] In order to solve the above technical problems, the present invention also provides the following method.

[0034] The method is any of the following:

[0035] M1) A method for identifying or assisting in identifying whether the mother parent of a pine tree to be tested is derived from Pinus armandii, comprising detecting SNP40 in the mitochondria of the pine tree to be tested, and determining whether the mother parent of the pine tree to be tested is derived from Pinus bungeana based on the detection result, wherein the SNP40 is derived from the above-mentioned SNP40;

[0036] If the SNP40 of the pine tree to be tested is T, the maternal parent of the pine tree to be tested is from Pinus armandii; if the SNP40 of the pine tree to be tested is C, the maternal parent of the pine tree to be tested is not from Pinus armandii;

[0037] M2) A method for identifying or assisting in identifying whether the maternal parent of a pine tree to be tested is from North American pine, comprising detecting SNP81 in the mitochondria of the pine tree to be tested, and determining whether the maternal parent of the pine tree to be tested is from North American pine according to the detection result, wherein the SNP81 is the above-mentioned SNP81;

[0038] If the SNP81 of the pine tree to be tested is A, the maternal parent of the pine tree to be tested is from North American pine; if the SNP81 of the pine tree to be tested is C, the maternal parent of the pine tree to be tested is not from North American pine;

[0039] M3) A method for identifying or assisting in identifying whether the mother parent of a pine tree to be tested is from white pine, comprising detecting SNP318 in the mitochondria of the pine tree to be tested, and determining whether the mother parent of the pine tree to be tested is from white pine according to the detection result, wherein the SNP318 is the above-mentioned SNP318;

[0040] If the SNP318 of the pine tree to be tested is C, the maternal parent of the pine tree to be tested is from Pinus thunbergii; if the SNP318 of the pine tree to be tested is A, the maternal parent of the pine tree to be tested is not from Pinus thunbergii;

[0041] M4) A method for identifying or assisting in identifying whether the maternal parent of a pine tree to be tested is from Korean pine, comprising detecting SNP521 in the mitochondria of the pine tree to be tested, and determining whether the maternal parent of the pine tree to be tested is from Korean pine according to the detection result, wherein the SNP521 is the above-mentioned SNP521;

[0042] If the SNP521 of the pine tree to be tested is T, the maternal parent of the pine tree to be tested is from Pinus koraiensis; if the SNP521 of the pine tree to be tested is G, the maternal parent of the pine tree to be tested is not from Pinus koraiensis;

[0043] M5) A method for identifying or assisting in identifying whether the mother parent of a pine tree to be tested is from Xinjiang five-needle pine, comprising detecting SNP40 and SNP590 in the mitochondria of the pine tree to be tested, and determining whether the mother parent of the pine tree to be tested is from Xinjiang five-needle pine according to the detection result, wherein the SNP40 is from the SNP40 of claim 1, and the SNP590 is from the above-mentioned SNP590;

[0044] If the SNP40 of the pine tree to be tested is C and the SNP590 is C, then the mother parent of the pine tree to be tested is from Xinjiang five-needle pine, otherwise the mother parent of the pine tree to be tested is not from Xinjiang five-needle pine;

[0045] M6) A method for identifying or assisting in identifying whether the maternal parent of a pine tree to be tested is derived from Pinus tabulaeformis, comprising detecting SNP254 and SNP443 in the mitochondria of the pine tree to be tested, and determining whether the maternal parent of the pine tree to be tested is derived from Pinus tabulaeformis according to the detection result, wherein the SNP254 is the SNP254 described in claim 1, and the SNP443 is derived from the above-mentioned SNP443;

[0046] If SNP254 of the pine tree to be tested is C and SNP443 is T, the maternal parent of the pine tree to be tested is from Pinus tabulaeformis, otherwise the maternal parent of the pine tree to be tested is not from Pinus tabulaeformis;

[0047] M7) A method for identifying or assisting in identifying whether the maternal parent of a pine tree to be tested is derived from pine tree A, comprising detecting SNP443 in the mitochondria of the pine tree to be tested, and determining whether the maternal parent of the pine tree to be tested is derived from pine tree A according to the detection result, wherein the SNP443 is derived from the above-mentioned SNP443, and the pine tree A group is composed of red pine and Scots pine;

[0048] If the SNP443 of the pine tree to be tested is G, the maternal parent of the pine tree to be tested comes from pine tree A, otherwise the maternal parent of the pine tree to be tested does not come from pine tree A;

[0049] The SNP40 is a SNP in pine mitochondria, which is the 40th nucleotide of sequence 1, which is C or T;

[0050] The SNP81 is a SNP in pine mitochondria, which is the 81st nucleotide of sequence 1, and is A or C;

[0051] The SNP254 is a SNP in pine mitochondria, which is the 254th nucleotide of sequence 1, which is C or T;

[0052] The SNP318 is a SNP in pine mitochondria, which is the 318th nucleotide of sequence 1, which is A or C;

[0053] The SNP443 is a SNP in pine mitochondria, which is the 443rd nucleotide of sequence 1, which is G or T;

[0054] The SNP521 is a SNP in pine mitochondria, which is the 521st nucleotide of sequence 1, which is G or T;

[0055] The SNP590 is a SNP in pine mitochondria, which is the 590th nucleotide of sequence 1, and is A or C.

[0056] In the above, if the mother parent of the pine tree to be tested is Pinus densiflora, the sequence of region 1 of the pine tree genome to be tested is sequence 11.

[0057] In the above, if the mother parent of the pine tree to be tested is Pinus sylvestris var. mongolica, the sequence of region 1 of the pine tree genome to be tested is sequence 12.

[0058] In the above, if the mother parent of the pine tree to be tested is Pinus tabulaeformis, the sequence of region 1 of the pine tree genome to be tested is sequence 13.

[0059] In the above, if the mother parent of the pine tree to be tested is white pine, the sequence of region 1 of the pine tree genome to be tested is sequence 14.

[0060] In the above, if the mother parent of the pine tree to be tested is Pinus armandii, the sequence of region 1 of the pine tree genome to be tested is sequence 15.

[0061] In the above, if the mother parent of the pine tree to be tested is Pinus koraiensis, the sequence of region 1 of the genome sequence of the pine tree to be tested is sequence 16.

[0062] In the above text, if the mother parent of the pine tree to be tested is Pinus pentaphyllum, the sequence of region 1 of the pine tree genome to be tested is sequence 17.

[0063] In the above, if the mother parent of the pine tree to be tested is North American pine, the sequence of region 1 of the pine tree genome to be tested is sequence 18.

[0064] In order to solve the above technical problems, the present invention also provides the following

[0065] In order to solve the above technical problems, the present invention also provides the following products.

[0066] The product is any of the following:

[0067] P1) identifying or assisting in identifying whether the pine tree mother to be tested is a product of Pinus armandii, including a substance for detecting a SNP of the pine tree to be tested, wherein the SNP is the SNP40 described in claim 1;

[0068] P2) a product for identifying or assisting in identifying whether the pine tree parent to be tested is a white North American pine, including a substance for detecting a SNP of the pine tree to be tested, wherein the SNP is the SNP81 described in claim 1;

[0069] P3) identifying or assisting in identifying whether the pine tree mother to be tested is a product of white pine, including a substance for detecting the SNP of the pine tree to be tested, wherein the SNP is the SNP318 described in claim 1;

[0070] P4) a product for identifying or assisting in identifying whether the mother parent of the pine tree to be tested is from Korean pine, comprising a substance for detecting the SNP of the pine tree to be tested, wherein the SNP is the SNP521 described in claim 1

[0071] P5) identifying or assisting in identifying whether the pine tree mother parent to be tested is a product of Xinjiang five-needle pine, including a substance for detecting SNPs of the pine tree to be tested, wherein the SNPs are SNP40 and SNP590 as described in claim 1;

[0072] P6) identifying or assisting in identifying whether the pine tree mother to be tested is a product of Pinus tabulaeformis, comprising a substance for detecting SNPs of the pine tree to be tested, wherein the SNPs are SNP254 and SNP443 as described in claim 1;

[0073] P7) Identifying or assisting in identifying whether the pine tree mother to be tested is a product of pine tree A, wherein the pine tree A components include red pine and mongolica pine, and comprising a substance for detecting the SNP of the pine tree to be tested, wherein the SNP is SNP443 as described in claim 1.

[0074] In the above-mentioned applications, methods and products, the products of the substances for detecting SNP40, SNP81, SNP254, SNP318, SNP443, SNP521 and / or SNP590 are as follows D1), D2), D3) or D4):

[0075] D1) contains in vitro nucleic acid amplification primers for specific amplification and detection of the SNP;

[0076] D2) an in vitro nucleic acid amplification reagent containing the in vitro nucleic acid amplification primer described in D1);

[0077] D3) a kit containing the in vitro nucleic acid amplification primers described in D1) or the in vitro nucleic acid amplification reagents described in D2);

[0078] D4) A detection instrument containing the in vitro nucleic acid amplification primers described in D1), the in vitro nucleic acid amplification reagents described in D2) or the kit described in D3).

[0079] The in vitro nucleic acid amplification technology can be polymerase chain reaction (PCR), strand displacement amplification (SDA), ligase chain reaction (LCR) and nucleic acid sequence-dependent amplification (NASBA), rolling circle nucleic acid amplification (RCA), loop-mediated isothermal amplification (LAMP), helicase-dependent isothermal amplification technology (HDA) or Qβ replication technology.

[0080] The present application uses polymerase chain reaction (PCR) as an amplification method to perform polymorphism detection.

[0081] The specific amplification in D1) can detect the nucleotide sequence of the polymorphic sites SNP1-SNP8 by the presence or absence of amplification products or by the presence or absence of amplification products combined with auxiliary reagents such as probes.

[0082] In the above-mentioned applications, methods and products, the in vitro nucleic acid amplification primer may be labeled or not labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be attached to a nucleic acid. Markers include but are not limited to dyes; radioactive labels, such as 32P; binding moieties, such as biotin; haptens, such as digoxin (DIG); luminescent, phosphorescent or fluorescent moieties; and fluorescent dyes alone or in combination with moieties that can inhibit or shift the emission spectrum by fluorescence resonance energy transfer (FRET). The marker can provide a signal that can be detected by fluorescence, radioactivity, colorimetry, weight determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The marker can be a charged moiety (positive or negative charge) or, alternatively, can be charge neutral. The marker can include a nucleic acid or protein sequence or a combination thereof, as long as the sequence containing the marker is detectable. In some embodiments, the nucleic acid is directly detected without a marker.

[0083] In the above M1), if the pine tree mother parent to be tested is not from Pinus armandii, then the pine tree mother parent to be tested may be from Pinus sylvestris var. mongolica, Pinus densiflora, Pinus tabulaeformis, Pinus koraiensis, Pinus pentaphyllum, Pinus bungeana, Pinus bungeana or Pinus juniper.

[0084] In the above M2), if the pine tree mother parent to be tested is not from North American pine, then the pine tree mother parent to be tested may be from Pinus sylvestris var. mongolica, Pinus densiflora, Pinus tabulaeformis, Pinus koraiensis, Pinus pentaphyllum, Pinus bungeana, Pinus bungeana or Pinus armandii.

[0085] In the above M3), if the pine tree mother parent to be tested is not Pinus bungeana, then the pine tree mother parent to be tested may be Pinus armandii, Pinus sylvestris, Pinus densiflora, Pinus tabulaeformis, Pinus koraiensis, Pinus pentaphyllum or Pinus thunbergii.

[0086] In the above M4), if the pine tree mother parent to be tested is not from Pinus koraiensis, then the pine tree mother parent to be tested may be from Pinus bungeana, Pinus armandii, Pinus sylvestris var. mongolica, Pinus densiflora, Pinus tabulaeformis, Pinus pentaphyllum or Pinus truncatum.

[0087] In the above M5), if the pine tree mother parent to be tested is not from Pinus pentaphyllum, then the pine tree mother parent to be tested may be from Pinus sylvestris var. mongolica, Pinus densiflora, Pinus tabulaeformis, Pinus koraiensis, Pinus armandii, Pinus bungeana or Pinus juniper.

[0088] In the above M6), if the pine tree mother parent to be tested is not from Pinus tabulaeformis, then the pine tree mother parent to be tested may be from Pinus bungeana, Pinus armandii, Pinus sylvestris var. mongolica, Pinus densiflora, Pinus koraiensis, Pinus pentaphyllum or Pinus truncatum.

[0089] In the above M7), if the pine tree mother parent to be tested is not from Pinus densiflora and Pinus sylvestris var. mongolica, the pine tree mother parent to be tested may be from Pinus bungeana, Pinus armandii, Pinus tabulaeformis, Pinus koraiensis, Pinus pentaphyllum or Pinus sylvestris var. mongolica.

[0090] In the above application, product or method, the in vitro nucleic acid amplification primers include a primer pair d for amplification; the primer pair d consists of primers dF and dR;

[0091] The primer dF is a single-stranded nucleotide molecule whose nucleotide sequence is sequence 10; the primer dR is a single-stranded nucleotide molecule whose nucleotide sequence is sequence 11.

[0092] In order to solve the above technical problems, the present invention also provides the following applications.

[0093] Use of a substance for detecting a pine parent to be tested in identifying a pine parent to be tested or in preparing a product for identifying a pine parent to be tested; the substance for detecting a pine parent to be tested is a substance for detecting SNP40, SNP81, SNP254, SNP318, SNP443, SNP521 and / or SNP590;

[0094] The SNP40 is a SNP in pine mitochondria, which is the 40th nucleotide of sequence 1, which is C or T;

[0095] The SNP81 is a SNP in pine mitochondria, which is the 81st nucleotide of sequence 1, and is A or C;

[0096] The SNP254 is a SNP in pine mitochondria, which is the 254th nucleotide of sequence 1, which is C or T;

[0097] The SNP318 is a SNP in pine mitochondria, which is the 318th nucleotide of sequence 1, which is A or C;

[0098] The SNP443 is a SNP in pine mitochondria, which is the 443rd nucleotide of sequence 1, which is G or T;

[0099] The SNP521 is a SNP in pine mitochondria, which is the 521st nucleotide of sequence 1, which is G or T;

[0100] The SNP590 is a SNP in pine mitochondria, which is the 590th nucleotide of sequence 1, and is A or C.

[0101] In order to solve the above technical problems, the present invention also provides the following applications.

[0102] Application of sequence 1 in the preparation of products for identifying pine tree parent and / or maternal origin.

[0103] Application of sequence 1 in identifying the parental and / or maternal origin of pine trees.

[0104] Beneficial Effects

[0105] The present invention discloses the development of a molecular marker for pine maternal identification and its application. The technical problem to be solved is how to identify or assist in the identification of pine maternal parents. Specifically disclosed is the application of substances for detecting SNP40, SNP81, SNP318, SNP443, SNP521 and / or SNP590 in identifying the pine maternal parent to be tested or in the preparation of a product for identifying the pine maternal parent to be tested; the SNP40 is a SNP in the mitochondria of pine, which is the 40th nucleotide of sequence 1, which is C or T; the SNP81 is a SNP in the mitochondria of pine, which is the 81st nucleotide of sequence 1, which is A or C; the SNP254 is a SNP in the mitochondria of pine, which is the 254th nucleotide of sequence 1, which is C or T; the SNP318 is a SNP in the mitochondria of pine, which is the 318th nucleotide of sequence 1, which is A or C; the SNP443 is a SNP in the mitochondria of pine, which is the 443rd nucleotide of sequence 1, which is G or T; the SNP521 is a SNP in the mitochondria of pine, which is the 521st nucleotide of sequence 1, which is G or T; the SNP590 is a SNP in the mitochondria of pine, which is the 590th nucleotide of sequence 1, which is A or C. The maternal source to be tested is determined according to the sequence, and the present invention can be used for industrial and agricultural production. BRIEF DESCRIPTION OF THE DRAWINGS

[0106] Figure 1 This is a comparison chart of mitochondrial rps4 marker sequences.

[0107] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0108] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0109] In the following examples, the DNA sequence was obtained by using the Sanger sequencing technology. The sequencing results were expressed in the form of four bases, ATCG, and were checked using the Sanger Scanner 2.0 software. A single peak indicated that the sequencing result was accurate.

[0110] In terms of morphological characteristics, tree species with similar distribution areas may be indistinguishable; the morphological characteristics of the same tree species at different ages or under different site conditions may vary significantly; and it is difficult to determine the morphological characteristics of offspring produced by hybridization from those of their parents.

[0111] The commonly used molecular markers SSR and ISSR require the design of specific primers, and the development cost of a large number of primers is high. In addition, the two markers can only determine the parental tree species of the hybrid offspring, and cannot further distinguish the father and mother of the hybrid offspring.

[0112] There is a small genome in the cytoplasm of eukaryotic cells, including mitochondrial DNA and chloroplast DNA, which has a certain degree of genetic autonomy and can relatively independently determine the inheritance of certain traits. In pine trees, mitochondria are maternally inherited. Based on this characteristic of pine trees, the present invention develops specific primers in common northern pine trees to distinguish the mitochondria of different pine trees as much as possible. By comparing the DNA sequences of the target fragments, the maternal or parental parent of the hybrid offspring can be determined while distinguishing the tree species.

[0113] Example 1 Development of labeled primers

[0114] Detection of the source of pine mother tree:

[0115] Based on the mitochondrial genome data of loblolly pine, the needles of common northern pine trees in China, including Pinus densiflora, Pinus sylvestris, Pinus tabuliformis, Pinus bungeana, Pinus koraiensis, Pinus armandii, Pinus strobus, and Pinus sibirica, were selected as materials to screen mitochondrial specific markers by amplification and sequence comparison of single genes. The screening principles are as follows: the selected sequence can distinguish different species as much as possible; the more conservative regions in the sequence are selected to avoid large gap regions; a sequence that is the same for all species must be left at both ends of the selected sequence to set the primers; in order to ensure the stability of the primers, the primer length range is set to 18-25bp, and the annealing temperature is set to 50-60℃; considering the range of Sanger first-generation sequencing technology, the target band range is set to 400-1500bp. According to the screening principles, one primer (rps4) was finally determined, as shown in Table 1. The amplified sequences of different primers in different species are:

[0116] The present invention discovered a sequence with multiple polymorphic sites in mitochondria, which is named rps4. The specific sequence 1 is as follows:

[0117] TAAAACTCGTCGTCCACCTCCGAATACAACGCCGCATTCyCCGAAGATCGAGAAGCAAGAGAAGATCTATTAGGAAAAATmTTTCTCCGAGACAGAATTTTCACAGTTACATCAAATTACAAGCCATACGAAAGTCGCCCCTTTCTCATGGAAATTTACCCATCACAGAGATGCACGGAGGGACAGAACGAGCTTCAyATATACCTTTTCCACTCAATCCAGAAACAAGATCGGACGTCATCCCGGTTCGTCTyCATTTCCGTGAAACTATTCCTCAAGCGAGGCAGCCGATAAGTCACCGAAAGATTCGTGTGAATyATkmAATGGGTAACATAACTCGTTCTAAAGTGTCCCGCGGTGATCyAATATCTATTGAAGAkAATTATGTCAGAACCATGGGGAGAAAAGTGAGGAAATATTCCCATATCGAAATATCAGTAAAkAAAATAGCGGGAAAATTTCCAGATCACCCGGAAAGAATGTGGAGAAGAACCAAAACAAGATGGTTCCGCCTACTGGAkAAAAAAmAAGGGTGCCGCCTCCTACCAAAATCCTGGTTTTCGCAACAGTTGCGTTCTTCCATGCAAGAmAAAkACTTAGAGAGGATAAATCCCTCTAGATCAGAAGGAGTATGCTTAGGCAGCTTATTCGCCGAGCACAACAAAATGAAGAGAAATTCGTATCATTCCGAATTCTTACTATTATTGAAGAGAAGGAACGGAAAAACCCGGATTCCTACTCGAACAATGAGTCTTATTGTTAATAACGGAAATTTATGTAGCGATTCAACTTATTGTTCTGAATCCCCTTATTGCGATACCAGGAAGATAAGAATCAGAGGAATCGAACTACCTACTCATTACTCGGAGGTCAATCATAGAACACCGAAAGCTGTGGTATCTTATGGACCTGACATAGGTCACATCCCTCACGACATAAGACCTTCGGAGCAGGAACGAA(SEQ ID NO: 1). Wherein, y is C or T; k is G or T; m is A or C.

[0118] The SNP40 is a SNP in pine mitochondria, which is the 40th nucleotide of sequence 1, which is C or T;

[0119] The SNP81 is a SNP in pine mitochondria, which is the 81st nucleotide of sequence 1, and is A or C;

[0120] The SNP254 is a SNP in pine mitochondria, which is the 254th nucleotide of sequence 1, which is C or T;

[0121] The SNP318 is a SNP in pine mitochondria, which is the 318th nucleotide of sequence 1, which is A or C;

[0122] The SNP443 is a SNP in pine mitochondria, which is the 443rd nucleotide of sequence 1, which is G or T;

[0123] The SNP521 is a SNP in pine mitochondria, which is the 521st nucleotide of sequence 1, which is G or T;

[0124] The SNP590 is a SNP in pine mitochondria, which is the 590th nucleotide of sequence 1, and is A or C.

[0125] If the SNP40 of the pine tree to be tested is T, then its mother parent is Pinus armandii, and if the SNP40 of the pine tree to be tested is C, then its mother parent is not Pinus armandii. Then its mother parent can be Pinus sylvestris var. mongolica, Pinus densiflora, Pinus tabulaeformis, Pinus koraiensis, Pinus pentaphyllum, Pinus bungeana or Pinus juniper.

[0126] If the SNP81 of the pine tree to be tested is A, then its mother parent is North American pine, and if the SNP81 of the pine tree to be tested is C, then its mother parent is not North American pine. Then its mother parent can be Pinus sylvestris, Pinus densiflora, Pinus tabulaeformis, Pinus koraiensis, Pinus pentaphyllum, Pinus bungeana or Pinus armandii.

[0127] If the SNP254 of the pine tree to be tested is C, then its mother parent is Pinus densiflora, Pinus sylvestris or Pinus tabulaeformis. If the SNP254 of the pine tree to be tested is T, then its mother parent is not Pinus densiflora, Pinus sylvestris or Pinus tabulaeformis. Then its mother parent may be Pinus truncatus, Pinus koraiensis, Pinus pentaphyllum, Pinus bungeana or Pinus armandii.

[0128] If SNP254 of the pine tree to be tested is C and SNP443 is T, the mother parent of the pine tree to be tested is Pinus tabulaeformis, otherwise the mother parent of the pine tree to be tested is not Pinus tabulaeformis. The mother parent may be Pinus bungeana, Pinus armandii, Pinus sylvestris, Pinus densiflora, Pinus koraiensis, Pinus pentaphyllum or Pinus truncatum.

[0129] If SNP318 of the pine tree to be tested is C, its mother plant is white pine. If SNP318 of the pine tree to be tested is not A, its mother plant is not white pine, but its mother plant may be Armand pine, Larix gmelinii, Pinus densiflora, Pinus tabulaeformis, Pinus koraiensis, Pinus koraiensis, Pinus pentaphyllum or Pinus truncatum.

[0130] If the SNP443 of the pine tree to be tested is G, then its mother parent is Pinus densiflora or Pinus sylvestris; if the SNP443 of the pine tree to be tested is T, then its mother parent is not Pinus densiflora or Pinus sylvestris. Its mother parent can be Pinus tabulaeformis, Pinus bungeana, Pinus koraiensis, Pinus armandii, or Pinus juniper.

[0131] If SNP521 of the pine tree to be tested is T, then its mother parent is Pinus koraiensis, and if SNP521 is G, then its mother parent is not Pinus koraiensis. Then its mother parent is Pinus bungeana, Pinus armandii, Pinus sylvestris, Pinus densiflora, Pinus tabulaeformis, Pinus pentaphyllum or Pinus truncatum.

[0132] If SNP590 of the pine tree to be tested is C, then its mother parent is Pinus armandii or Pinus sylvestris, and if SNP590 is A, then its mother parent is not Pinus armandii or Pinus sylvestris. Then its mother parent may be Pinus bungeana, Pinus sylvestris, Pinus densiflora, Pinus tabulaeformis, Pinus koraiensis or Pinus juncea.

[0133] If the SNP40 of the pine tree to be tested is C, and the SNP590 of the pine tree to be tested is C, then the mother parent of the pine tree to be tested is Pinus sylvestris, otherwise the mother parent of the pine tree to be tested is not Pinus sylvestris. Then its mother parent can be Pinus sylvestris, Pinus densiflora, Pinus tabulaeformis, Pinus koraiensis, Pinus armandii, Pinus bungeana or Pinus juniper.

[0134] As shown above, SNP40 can distinguish Pinus armandii; SNP81 can distinguish Pinus sylvestris; SNP318 can distinguish Pinus bungeana; SNP443 can distinguish Pinus sylvestris var. mongolica and Pinus densiflora / others; SNP521 can distinguish Pinus koraiensis; SNP40 and SNP590 can distinguish Pinus pentaphyllum; SNP254 and SNP443 can distinguish Pinus tabulaeformis.

[0135] The above PCR reaction system, PCR reaction conditions and rps4-F / rps4-R primers were used to amplify and sequence the above-mentioned red pine (Pinus densiflora) DNA, Scotch pine (Pinus sylvestris) DNA, Chinese pine (Pinus tabuliformis) DNA, white pine (Pinus bungeana) DNA, Korean pine (Pinus koraiensis) DNA, Armandi (Pinus armandii) DNA, North American pine (Pinus strobus) DNA and Xinjiang five-needle pine (Pinus sibirica) DNA, and the results are as follows:

[0136] The red pine amplified sequence is sequence 2, which is as follows:

[0137] TAAAACTCGTCGTCCACCTCCGAATACAACGCCGCATTCCCCGAAGATCGAGAAGCAAGAGAAGATCTATTAGGAAAAATCTTTCTCCGAGACAGAATTTTCACAGTTACATCAAATTACAAGCCATACGAAAGTCGCCCCTTTCTCATGGAAATTTACCCATCACAGAGATGCACGGAGGGACAGAACGAGCTTCACATATACCTTTTCCACTCAATCCAGAAACAAGATCGGACGTCATCCCGGTTCGTCTCCATTTCCGTGAAACTATTCCTCAAGCGAGGCAGCCGATAAGTCACCGAAAGATTCGTGTGAATAATTCAATGGGTAACATAACTCGTTCTAAAGTGTCCCGCGGTGATCCAATATCTATTGAAGAGAATTATGTCAGAACCATGGGGAGAAAAGTGAGGAAATATTCCCATATCGAAATATCAGTAAAGAAAATAGCGGGAAAATTTCCAGATCACCCGGAAAGAATGTGGAGAAGAACCAAAACAAGATGGTTCCGCCTACTGGAGAAAAAAAAAGGGTGCCGCCTCCTACCAAAATCCTGGTTTTCGCAACAGTTGCGTTCTTCCATGCAAGAAAAATACTTAGAGAGGATAAATCCCTCTAGATCAGAAGGAGTATGCTTAGGCAGCTTATTCGCCGAGCACAACAAAATGAAGAGAAATTCGTATCATTCCGAATTCTTACTATTATTGAAGAGAAGG AACGGAAAAACCCGGATTCCTACTCGAACAATGAGTCTTATTGTTAATAACGGAAATTTATGTAGCGATTCAACTTATTGTTCTGAATCCCCTTATTGCGATACCAGGAAGATAAGAATCAGAGGAATCGAACTACCTACTCATTACTCGGAGGTCAATCATAGAACACCGAAAGCTGTGGTATCTTATGGACCTGACATAGGTCACATCCCTCACGACATAAGACCTTCGGAGCAGGAACGAA

[0138] The amplified sequence of Pinus sylvestris var. mongolica is sequence 3, which is as follows:

[0139] TAAAACTCGTCGTCCACCTCCGAATACAACGCCGCATTCCCCGAAGATCGAGAAGCAAGAGAAGATCTATTAGGAAAAATCTTTCTCCGAGACAGAATTTTCACAGTTACATCAAATTACAAGCCATACGAAAGTCGCCCCTTTCTCATGGAAATTTACCCATCACAGAGATGCACGGAGGGACAGAACGAGCTTCACATATACCTTTTCCACTCAATCCAGAAACAAGATCGGACGTCATCCCGGTTCGTCTCCATTTCCGTGAAACTATTCCTCAAGCGAGGCAGCCGATAAGTCACCGAAAGATTCGTGTGAATAATTCAATGGGTAACATAACTCGTTCTAAAGTGTCCCGCGGTGATCCAATATCTATTGAAGAGAATTATGTCAGAACCATGGGGAGAAAAGTGAGGAAATATTCCCATATCGAAATATCAGTAAAGAAAATAGCGGGAAAATTTCCAGATCACCCGGAAAGAATGTGGAGAAGAACCAAAACAAGATGGTTCCGCCTACTGGAGAAAAAAAAAGGGTGCCGCCTCCTACCAAAATCCTGGTTTTCGCAACAGTTGCGTTCTTCCATGCAAGAAAAATACTTAGAGAGGATAAATCCCTCTAGATCAGAAGGAGTATGCTTAGGCAGCTTATTCGCCGAGCACAACAAAATGAAGAGAAATTCGTATCATTCCGAATTCTTACTATTATTGAAGAGAAGGAACGGAAAAACCCGGATTCCTACTCGAACAATGAGTCTTATTGTTAATAACGGAAATTTATGTAGCGATTCAACTTATTGTTCTGAATCCCCTTATTGCGATACCAGGAAGATAAGAATCAGAGGAATCGAACTACCTACTCATTACTCGGAGGTCAATCATAGAACACCGAAAGCTGTGGTATCTTATGGACCTGACATAGGTCACATCCCTCACGACATAAGACCTTCGGAGCAGGAACGAA

[0140] The amplified sequence of Pinus tabulaeformis is sequence 4, which is as follows:

[0141] TAAAACTCGTCGTCCACCTCCGAATACAACGCCGCATTCCCCGAAGATCGAGAAGCAAGAGAAGATCTATTAGGAAAAATCTTTCTCCGAGACAGAATTTTCACAGTTACATCAAATTACAAGCCATACGAAAGTCGCCCCTTTCTCATGGAAATTTACCCATCACAGAGATGCACGGAGGGACAGAACGAGCTTCACATATACCTTTTCCACTCAATCCAGAAACAAGATCGGACGTCATCCCGGTTCGTCTCCATTTCCGTGAAACTATTCCTCAAGCGAGGCAGCCGATAAGTCACCGAAAGATTCGTGTGAATAATTCAATGGGTAACATAACTCGTTCTAAAGTGTCCCGCGGTGATCCAATATCTATTGAAGAGAATTATGTCAGAACCATGGGGAGAAAAGTGAGGAAATATTCCCATATCGAAATATCAGTAAATAAAATAGCGGGAAAATTTCCAGATCACCCGGAAAGAATGTGGAGAAGAACCAAAACAAGATGGTTCCGCCTACTGGAGAAAAAAAAAGGGTGCCGCCTCCTACCAAAATCCTGGTTTTCGCAACAGTTGCGTTCTTCCATGCAAGAAAAAGACTTAGAGAGGATAAATCCCTCTAGATCAGAAGGAGTATGCTTAGGCAGCTTATTCGCCGAGCACAACAAAATGAAGAGAAATTCGTATCATTCCGAATTCTTACTATTATTGAAGAGAAGGAACGGAAAAACCCGGATTCCTACTCGAACAATGAGTCTTATTGTTAATAACGGAAATTTATGTAGCGATTCAACTTATTGTTCTGAATCCCCTTATTGCGATACCAGGAAGATAAGAATCAGAGGAATCGAACTACCTACTCATTACTCGGAGGTCAATCATAGAACACCGAAAGCTGTGGTATCTTATGGACCTGACATAGGTCACATCCCTCACGACATAAGACCTTCGGAGCAGGAACGAA

[0142] The amplified sequence of white pine is sequence 5, which is as follows:

[0143] TAAAACTCGTCGTCCACCTCCGAATACAACGCCGCATTCCCCGAAGATCGAGAAGCAAGAGAAGATCTATTAGGAAAAATCTTTCTCCGAGACAGAATTTTCACAGTTACATCAAATTACAAGCCATACGAAAGTCGCCCCTTTCTCATGGAAATTTACCCATCACAGAGATGCACGGAGGGACAGAACGAGCTTCACATATACCTTTTCCACTCAATCCAGAAACAAGATCGGACGTCATCCCGGTTCGTCTTCATTTCCGTGAAACTATTCCTCAAGCGAGGCAGCCGATAAGTCACCGAAAGATTCGTGTGAATCATTCAATGGGTAACATAACTCGTTCTAAAGTGTCCCGCGGTGATCCAATATCTATTGAAGATAATTATGTCAGAACCATGGGGAGAAAAGTGAGGAAATATTCCCATATCGAAATATCAGTAAATAAAATAGCGGGAAAATTTCCAGATCACCCGGAAAGAATGTGGAGAAGAACCAAAACAAGATGGTTCCGCCTACTGGAGAAAAAACAAGGGTGCCGCCTCCTACCAAAATCCTGGTTTTCGCAACAGTTGCGTTCTTCCATGCAAGAAAAAGACTTAGAGAGGATAAATCCCTCTAGATCAGAAGGAGTATGCTTAGGCAGCTTATTCGCCGAGCACAACAAAATGAAGAGAAATTCGTATCATTCCGAATTCTTACTATTATTGAAGAGAAGGAACGGAAAAACCCGGATTCCTACTCGAACAATGAGTCTTATTGTTAATAACGGAAATTTATGTAGCGATTCAACTTATTGTTCTGAATCCCCTTATTGCGATACCAGGAAGATAAGAATCAGAGGAATCGAACTACCTACTCATTACTCGGAGGTCAATCATAGAACACCGAAAGCTGTGGTATCTTATGGACCTGACATAGGTCACATCCCTCACGACATAAGACCTTCGGAGCAGGAACGAA

[0144] The amplified sequence of Pinus armandii is sequence 6, which is as follows:

[0145] TAAAACTCGTCGTCCACCTCCGAATACAACGCCGCATTCTCCGAAGATCGAGAAGCAAGAGAAGATCTATTAGGAAAAATCTTTCTCCGAGACAGAATTTTCACAGTTACATCAAATTACAAGCCATACGAAAGTCGCCCCTTTCTCATGGAAATTTACCCATCACAGAGATGCACGGAGGGACAGAACGAGCTTCATATATACCTTTTCCACTCAATCCAGAAACAAGATCGGACGTCATCCCGGTTCGTCTTCATTTCCGTGAAACTATTCCTCAAGCGAGGCAGCCGATAAGTCACCGAAAGATTCGTGTGAATAATTCAATGGGTAACATAACTCGTTCTAAAGTGTCCCGCGGTGATCTAATATCTATTGAAGAGAATTATGTCAGAACCATGGGGAGAAAAGTGAGGAAATATTCCCATATCGAAATATCAGTAAATAAAATAGCGGGAAAATTTCCAGATCACCCGGAAAGAATGTGGAGAAGAACCAAAACAAGATGGTTCCGCCTACTGGAGAAAAAACAAGGGTGCCGCCTCCTACCAAAATCCTGGTTTTCGCAACAGTTGCGTTCTTCCATGCAAGACAAAGACTTAGAGAGGATAAATCCCTCTAGATCAGAAGGAGTATGCTTAGGCAGCTTATTCGCCGAGCACAACAAAATGAAGAGAAATTCGTATCATTCCGAATTCTTACTATTATTGAAGAGAAGGAACGGAAAAACCCGGATTCCTACTCGAACAATGAGTCTTATTGTTAATAACGGAAATTTATGTAGCGATTCAACTTATTGTTCTGAATCCCCTTATTGCGATACCAGGAAGATAAGAATCAGAGGAATCGAACTACCTACTCATTACTCGGAGGTCAATCATAGAACACCGAAAGCTGTGGTATCTTATGGACCTGACATAGGTCACATCCCTCACGACATAAGACCTTCGGAGCAGGAACGAA

[0146] The amplified sequence of Korean pine is sequence 7, which is as follows:

[0147] TAAAACTCGTCGTCCACCTCCGAATACAACGCCGCATTCCCCGAAGATCGAGAAGCAAGAGAAGATCTATTAGGAAAAATCTTTCTCCGAGACAGAATTTTCACAGTTACATCAAATTACAAGCCATACGAAAGTCGCCCCTTTCTCATGGAAATTTACCCATCACAGAGATGCACGGAGGGACAGAACGAGCTTCACATATACCTTTTCCACTCAATCCAGAAACAAGATCGGACGTCATCCCGGTTCGTCTTCATTTCCGTGAAACTATTCCTCAAGCGAGGCAGCCGATAAGTCACCGAAAGATTCGTGTGAATAATTCAATGGGTAACATAACTCGTTCTAAAGTGTCCCGCGGTGATCCAATATCTATTGAAGAGAATTATGTCAGAACCATGGGGAGAAAAGTGAGGAAATATTCCCATATCGAAATATCAGTAAATAAAATAGCGGGAAAATTTCCAGATCACCCGGAAAGAATGTGGAGAAGAACCAAAACAAGATGGTTCCGCCTACTGGATAAAAAAAAAGGGTGCCGCCTCCTACCAAAATCCTGGTTTTCGCAACAGTTGCGTTCTTCCATGCAAGAAAAAGACTTAGAGAGGATAAATCCCTCTAGATCAGAAGGAGTATGCTTAGGCAGCTTATTCGCCGAGCACAACAAAATGAAGAGAAATTCGTATCATTCCGAATTCTTACTATTATTGAAGAGAAGGAACGGAAAAACCCGGATTCCTACTCGAACAATGAGTCTTATTGTTAATAACGGAAATTTATGTAGCGATTCAACTTATTGTTCTGAATCCCCTTATTGCGATACCAGGAAGATAAGAATCAGAGGAATCGAACTACCTACTCATTACTCGGAGGTCAATCATAGAACACCGAAAGCTGTGGTATCTTATGGACCTGACATAGGTCACATCCCTCACGACATAAGACCTTCGGAGCAGGAACGAA

[0148] The amplified sequence of Xinjiang five-needle pine is sequence 8, which is as follows:

[0149] TAAAACTCGTCGTCCACCTCCGAATACAACGCCGCATTCCCCGAAGATCGAGAAGCAAGAGAAGATCTATTAGGAAAAATCTTTCTCCGAGACAGAATTTTCACAGTTACATCAAATTACAAGCCATACGAAAGTCGCCCCTTTCTCATGGAAATTTACCCATCACAGAGATGCACGGAGGGACAGAACGAGCTTCACATATACCTTTTCCACTCAATCCAGAAACAAGATCGGACGTCATCCCGGTTCGTCTTCATTTCCGTGAAACTATTCCTCAAGCGAGGCAGCCGATAAGTCACCGAAAGATTCGTGTGAATAATTCAATGGGTAACATAACTCGTTCTAAAGTGTCCCGCGGTGATCCAATATCTATTGAAGAGAATTATGTCAGAACCATGGGGAGAAAAGTGAGGAAATATTCCCATATCGAAATATCAGTAAATAAAATAGCGGGAAAATTTCCAGATCACCCGGAAAGAATGTGGAGAAGAACCAAAACAAGATGGTTCCGCCTACTGGAGAAAAAACAAGGGTGCCGCCTCCTACCAAAATCCTGGTTTTCGCAACAGTTGCGTTCTTCCATGCAAGACAAAGACTTAGAGAGGATAAATCCCTCTAGATCAGAAGGAGTATGCTTAGGCAGCTTATTCGCCGAGCACAACAAAATGAAGAGAAATTCGTATCATTCCGAATTCTTACTATTATTGAAGAGAAGGAACGGAAAAACCCGGATTCCTACTCGAACAATGAGTCTTATTGTTAATAACGGAAATTTATGTAGCGATTCAACTTATTGTTCTGAATCCCCTTATTGCGATACCAGGAAGATAAGAATCAGAGGAATCGAACTACCTACTCATTACTCGGAGGTCAATCATAGAACACCGAAAGCTGTGGTATCTTATGGACCTGACATAGGTCACATCCCTCACGACATAAGACCTTCGGAGCAGGAACGAA

[0150] The amplified sequence of North American pine is sequence 9, which is as follows:

[0151] TAAAACTCGTCGTCCACCTCCGAATACAACGCCGCATTCCCCGAAGATCGAGAAGCAAGAGAAGATCTATTAGGAAAAATATTTCTCCGAGACAGAATTTTCACAGTTACATCAAATTACAAGCCATACGAAAGTCGCCCCTTTCTCATGGAAATTTACCCATCACAGAGATGCACGGAGGGACAGAACGAGCTTCACATATACCTTTTCCACTCAATCCAGAAACAAGATCGGAC GTCATCCCGGTTCGTCTTCATTTCCGTGAAACTATTCCTCAAGCGAGGCAGCCGATAAGTCACCGAAAGATTCGTGTGAATAATGAAATGGGTAACATAACTCGTTCTAAAGTGTCCCGCGGTGATCCAATATCTATTGAAGATAATTATGTCAGAACCATGGGGAGAAAAGTGAGGAAATATTCCCATATCGAAATATCAGTAAATAAAATAGCGGGAAAATTTCCAGATCACCCGGAAAGAATGTGGAGAAGAACCAAAACAAGATGGTTCCGCCTACTGGAGAAAAAAAAAGGGTGCCGCCTCCTACCAAAATCCTGGTTTTCGCAACAGTTGCGTTCTTCCATGCAAGAAAAAGACTTAGAGAGGATAAATCCCTCTAGATCAGAAGGAGTATGCTTAGGCAGCTTATTCGCCGAGCACAACAAAATGAAGAGAAATTCGTATCATTCCGAATTCTTACTATTATTGAAGAGAAGGAACGGAAAAACCCGGATTCCTACTCGAACAATGAGTCTTATTGTTAATAACGGAAATTTATGTAGCGATTCAACTTATTGTTCTGAATCCCCTTATTGCGATACCAGGAAGATAAGAATCAGAGGAATCGAACTACCTACTCATTACTCGGAGGTCAATCATAGAACACCGAAAGCTGTGGTATCTTATGGACCTGACATAGGTCACATCCCTCACGACATAAGACCTTCGGAGCAGGAACGAA

[0152] Table 1 Summary of mitochondrial markers

[0153]

[0154] Example 2 Validation of mitochondrial marker primers

[0155] The needles of northern pine trees Pinus densiflora, Pinus sylvestris, Pinus tabuliformis, Pinus bungeana, Pinus koraiensis, Pinus armandii, Pinus strobus, and Pinus sibirica were used to extract genomic DNA using the CTAB method, and the extracted DNA content was adjusted to 30 ng / ml to obtain red pine DNA solution, Pinus sylvestris DNA solution, Pinus tabuliformis DNA solution, Pinus bungeana DNA solution, Pinus koraiensis DNA solution, Pinus armandii DNA solution, Pinus strobus DNA solution, and Pinus sibirica DNA solution. .

[0156] Using rps4-F / rps4-R (upstream primer F / downstream primer R) in Table 1 as primers, using genomic DNA solutions of northern pine trees such as Pinus dendrobii, Pinus sylvestris, Pinus tabulaeformis, Pinus bungeana, Pinus koraiensis, Pinus armandii, Pinus juncea and Pinus elata as templates, PCR reaction was performed under the conditions of pre-denaturation at 94°C for 5 min; denaturation at 94°C for 45 s, annealing at the optimal temperature for 45 s, extension at 72°C for 1 min, 35 cycles; and final extension for 10 min. The reaction system is as follows:

[0157] Genomic DNA (30 ng / ml) 3 μL, upstream primer F (30 ng / ml) 2 μL, downstream primer R (30 ng / ml) 2 μL, 2×Master Mix 25 μL, ddH2O 18 μL.

[0158] The results are as follows Figure 1 As shown, rps4 can distinguish all tree species except red pine and Scots pine, and can be used for pine species identification and maternal or parent identification of hybrid offspring in the future.

[0159] Example 3 Validation of mitochondrial marker primers (hybrid variety validation)

[0160] Hybridization Validation

[0161] The needles of 30 hybrid pine trees (Pinus tabulaeformis ♂×Pinus thunbergii ♀) obtained by artificial controlled pollination (emasculation, bagging and pollination) were taken and genomic DNA was extracted using the CTAB method. The extracted DNA content was adjusted to 30 ng / ml to obtain genomic DNA solutions of 30 hybrid pine trees.

[0162] Using mitochondrial rps4 (rps4-F / rps4-R) as primers and genomic DNA solutions of 30 hybrid pines as templates, PCR was performed under the conditions of pre-denaturation at 94°C for 5 min; denaturation at 94°C for 45 s, annealing at the optimal temperature (optimum temperature is shown in Table 3) for 45 s, extension at 72°C for 1 min, 35 cycles; and final extension at 72°C for 10 min. The reaction system (50 μL system) is as follows:

[0163] 3 μL of pine DNA (30 ng / ml), 2 μL of upstream primer F (30 ng / ml), 2 μL of downstream primer R (30 ng / ml), 25 μL of 2×Mix enzyme (Novozyme P222-03-AA), 18 μL of ddH2O, a total of 50 μL. The results of gel excision and sequencing are as follows:

[0164] The sequences amplified by the rps4-F / rps4-R primer pair are consistent with the above sequence 5, as follows:

[0165] TAAAACTCGTCGTCCACCTCCGAATACAACGCCGCATTCCCCGAAGATCGAGAAGCAAGAGAAGATCTATTAGGAAAAATCTTTCTCCGAGACAGAATTTTCACAGTTACATCAAATTACAAGCCATACGAAAGTCGCCCCTTTCTCATGGAAATTTACCCATCACAGAGATGCACGGAGGGACAGAACGAGCTTCACATATACCTTTTCCACTCAATCCAGAAACAAGATCGGACGTCATCCCGGTTCGTCTTCATTTCCGTGAAACTATTCCTCAAGCGAGGCAGCCGATAAGTCACCGAAAGATTCGTGTGAATCATTCAATGGGTAACATAACTCGTTCTAAAGTGTCCCGCGGTGATCCAATATCTATTGAAGATAATTATGTCAGAACCATGGGGAGAAAAGTGAGGAAATATTCCCATATCGAAATATCAGTAAATAAAATAGCGGGAAAATTTCCAGATCACCCGGAAAGAATGTGGAGAAGAACCAAAACAAGATGGTTCCGCCTACTGGAGAAAAAACAAGGGTGCCGCCTCCTACCAAAATCCTGGTTTTCGCAACAGTTGCGTTCTTCCATGCAAGAAAAAGACTTAGAGAGGATAAATCCCTCTAGATCAGAAGGAGTATGCTTAGGCAGCTTATTCGCCGAGCACAACAAAATGAAGAGAAATTCGTATCATTCCGAATTCTTACTATTATTGAAGAGAAGGAACGGAAAAACCCGGATTCCTACTCGAACAATGAGTCTTATTGTTAATAACGGAAATTTATGTAGCGATTCAACTTATTGTTCTGAATCCCCTTATTGCGATACCAGGAAGATAAGAATCAGAGGAATCGAACTACCTACTCATTACTCGGAGGTCAATCATAGAACACCGAAAGCTGTGGTATCTTATGGACCTGACATAGGTCACATCCCTCACGACATAAGACCTTCGGAGCAGGAACGAA

[0166] The results showed that in the sequence comparison results of 30 hybrid pine trees and northern pine trees, the pine trees with SNP318 being C had white pine as their mother, which was consistent with the actual situation.

[0167] Hybridization Validation II

[0168] The needles of 30 hybrid pine trees (Pinus sylvestris ♂×Pinus koraiensis ♀) obtained by artificial controlled pollination (emasculation, bagging and pollination) were used to extract genomic DNA using the CTAB method. The extracted DNA content was adjusted to 30 ng / ml to obtain genomic DNA solutions of 30 hybrid pine trees.

[0169] Using mitochondrial rps4 (rps4-F / rps4-R) as primers and genomic DNA solutions of 30 hybrid pines as templates, PCR was performed under the conditions of pre-denaturation at 94°C for 5 min; denaturation at 94°C for 45 s, annealing at the optimal temperature (optimum temperature is shown in Table 3) for 45 s, extension at 72°C for 1 min, 35 cycles; and final extension at 72°C for 10 min. The reaction system (50 μL system) is as follows:

[0170] 3 μL of pine DNA (30 ng / ml), 2 μL of upstream primer F (30 ng / ml), 2 μL of downstream primer R (30 ng / ml), 25 μL of 2×Mix enzyme (Novozyme P222-03-AA), 18 μL of ddH2O, a total of 50 μL. The results of gel excision and sequencing are as follows:

[0171] The sequences amplified by the rps4-F / rps4-R primer pair are consistent with the above sequence 7, as follows:

[0172] TAAAACTCGTCGTCCACCTCCGAATACAACGCCGCATTCCCCGAAGATCGAGAAGCAAGAGAAGATCTATTAGGAAAAATCTTTCTCCGAGACAGAATTTTCACAGTTACATCAAATTACAAGCCATACGAAAGTCGCCCCTTTCTCATGGAAATTTACCCATCACAGAGATGCACGGAGGGACAGAACGAGCTTCACATATACCTTTTCCACTCAATCCAGAAACAAGATCGGACGTCATCCCGGTTCGTCTTCATTTCCGTGAAACTATTCCTCAAGCGAGGCAGCCGATAAGTCACCGAAAGATTCGTGTGAATAATTCAATGGGTAACATAACTCGTTCTAAAGTGTCCCGCGGTGATCCAATATCTATTGAAGAGAATTATGTCAGAACCATGGGGAGAAAAGTGAGGAAATATTCCCATATCGAAATATCAGTAAATAAAATAGCGGGAAAATTTCCAGATCACCCGGAAAGAATGTGGAGAAGAACCAAAACAAGATGGTTCCGCCTACTGGATAAAAAAAAAGGGTGCCGCCTCCTACCAAAATCCTGGTTTTCGCAACAGTTGCGTTCTTCCATGCAAGAAAAAGACTTAGAGAGGATAAATCCCTCTAGATCAGAAGGAGTATGCTTAGGCAGCTTATTCGCCGAGCACAACAAAATGAAGAGAAATTCGTATCATTCCGAATTCTTACTATTATTGAAGAGAAGGAACGGAAAAACCCGGATTCCTACTCGAACAATGAGTCTTATTGTTAATAACGGAAATTTATGTAGCGATTCAACTTATTGTTCTGAATCCCCTTATTGCGATACCAGGAAGATAAGAATCAGAGGAATCGAACTACCTACTCATTACTCGGAGGTCAATCATAGAACACCGAAAGCTGTGGTATCTTATGGACCTGACATAGGTCACATCCCTCACGACATAAGACCTTCGGAGCAGGAACGAA

[0173] The results showed that in the sequence comparison results of 30 hybrid pine trees with northern pine trees, the pine trees with SNP521 being T, had a mother plant of Pinus koraiensis, which was consistent with the actual situation.

[0174] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Use of substances for detecting SNP40, SNP81, SNP318, SNP443, SNP521 and / or SNP590 in identifying the pine parent to be tested or in preparing products for identifying the pine parent to be tested; The SNP40 is a SNP in pine mitochondria, which is the 40th nucleotide of sequence 1, which is C or T; The SNP81 is a SNP in pine mitochondria, which is the 81st nucleotide of sequence 1, and is A or C; The SNP254 is a SNP in pine mitochondria, which is the 254th nucleotide of sequence 1, which is C or T; The SNP318 is a SNP in pine mitochondria, which is the 318th nucleotide of sequence 1, which is A or C; The SNP443 is a SNP in pine mitochondria, which is the 443rd nucleotide of sequence 1, which is G or T; The SNP521 is a SNP in pine mitochondria, which is the 521st nucleotide of sequence 1, which is G or T; The SNP590 is a SNP in pine mitochondria, which is the 590th nucleotide of sequence 1, and is A or C.

2. The application is any of the following: 1) Application of a substance for detecting SNP40 in the preparation of a product for identifying whether the pine tree parent to be tested is from Pinus armandii; 2) Use of a substance for detecting SNP81 in preparing a product for identifying whether the pine tree parent to be tested is from North American pine; 3) Use of a substance for detecting SNP318 in preparing a product for identifying whether the pine tree parent to be tested is from white pine; 4) Use of a substance for detecting SNP521 in preparing a product for identifying whether the pine tree parent to be tested is from Korean pine; 5) Application of substances for detecting SNP40 and SNP590 in the preparation of products for identifying whether the pine tree parent to be tested is from Xinjiang five-needle pine; 6) Use of substances for detecting SNP254 and SNP443 in preparing products for identifying whether the pine tree parent to be tested is from Pinus tabulaeformis; 7) Use of a substance for detecting SNP443 in preparing a product for identifying whether a pine tree parent to be tested is from pine tree A, wherein the pine tree A component is Pinus sylvestris and Pinus densiflora; The SNP40 is a SNP in pine mitochondria, which is the 40th nucleotide of sequence 1, which is C or T; The SNP81 is a SNP in pine mitochondria, which is the 81st nucleotide of sequence 1, and is A or C; The SNP254 is a SNP in pine mitochondria, which is the 254th nucleotide of sequence 1, which is C or T; The SNP318 is a SNP in pine mitochondria, which is the 318th nucleotide of sequence 1, which is A or C; The SNP443 is a SNP in pine mitochondria, which is the 443rd nucleotide of sequence 1, which is G or T; The SNP521 is a SNP in pine mitochondria, which is the 521st nucleotide of sequence 1, which is G or T; The SNP590 is a SNP in pine mitochondria, which is the 590th nucleotide of sequence 1, and is A or C.

3. The method is any of the following: M1) A method for identifying or assisting in identifying whether the maternal parent of a pine tree to be tested is derived from Pinus armandii, comprising detecting SNP40 in the mitochondria of the pine tree to be tested, and determining whether the maternal parent of the pine tree to be tested is derived from Pinus bungeana based on the detection result, wherein the SNP237 is derived from the SNP40 described in claim 1; If the SNP40 of the pine tree to be tested is T, the female parent of the pine tree to be tested is from Pinus armandii; If the SNP237 of the pine tree to be tested is C, the female parent of the pine tree to be tested is not from Pinus armandii; M2) A method for identifying or assisting in identifying whether the maternal parent of a pine tree to be tested is from North American pine, comprising detecting SNP81 in the mitochondria of the pine tree to be tested, and determining whether the maternal parent of the pine tree to be tested is from North American pine according to the detection result, wherein the SNP81 is the SNP81 described in claim 1; If the SNP81 of the pine tree to be tested is A, the female parent of the pine tree to be tested is from North American pine; If the SNP81 of the pine tree to be tested is C, the female parent of the pine tree to be tested is not from North American pine; M3) A method for identifying or assisting in identifying whether the mother parent of a pine tree to be tested is from white pine, comprising detecting SNP318 in the mitochondria of the pine tree to be tested, and determining whether the mother parent of the pine tree to be tested is from white pine according to the detection result, wherein the SNP318 is the SNP318 described in claim 1; If the SNP318 of the pine tree to be tested is C, the maternal parent of the pine tree to be tested is from Pinus thunbergii; if the SNP318 of the pine tree to be tested is A, the maternal parent of the pine tree to be tested is not from Pinus thunbergii; M4) A method for identifying or assisting in identifying whether the maternal parent of a pine tree to be tested is from Korean pine, comprising detecting SNP521 in the mitochondria of the pine tree to be tested, and determining whether the maternal parent of the pine tree to be tested is from Korean pine according to the detection result, wherein the SNP521 is the SNP521 described in claim 1; If the SNP521 of the pine tree to be tested is T, the maternal parent of the pine tree to be tested is from Pinus koraiensis; if the SNP521 of the pine tree to be tested is G, the maternal parent of the pine tree to be tested is not from Pinus koraiensis; M5) A method for identifying or assisting in identifying whether the maternal parent of a pine tree to be tested is from Xinjiang five-needle pine, comprising detecting SNP40 and SNP590 in the mitochondria of the pine tree to be tested, and determining whether the maternal parent of the pine tree to be tested is from Xinjiang five-needle pine according to the detection results, wherein the detected SNP40 is the SNP40 described in claim 1, and the SNP590 is from the SNP590 described in claim 1; If the SNP40 of the pine tree to be tested is C and the SNP590 is C, then the mother parent of the pine tree to be tested is from Xinjiang five-needle pine, otherwise the mother parent of the pine tree to be tested is not from Xinjiang five-needle pine; M6) A method for identifying or assisting in identifying whether the maternal parent of a pine tree to be tested is derived from Pinus tabulaeformis, comprising detecting SNP254 and SNP443 in the mitochondria of the pine tree to be tested, and determining whether the maternal parent of the pine tree to be tested is derived from Pinus tabulaeformis according to the detection result, wherein the detected SNP254 is the SNP254 described in claim 1, and the SNP443 is derived from the SNP443 described in claim 1; If SNP254 of the pine tree to be tested is C and SNP443 is T, the maternal parent of the pine tree to be tested is from Pinus tabulaeformis, otherwise the maternal parent of the pine tree to be tested is not from Pinus tabulaeformis; M7) A method for identifying or assisting in identifying whether the maternal parent of a pine tree to be tested is derived from pine tree A, comprising detecting SNP443 in the mitochondria of the pine tree to be tested, and determining whether the maternal parent of the pine tree to be tested is derived from pine tree A according to the detection result, wherein the SNP443 is derived from the SNP443 of claim 1, and the pine tree A group is red pine and Scots pine; If the SNP443 of the pine tree to be tested is G, the maternal parent of the pine tree to be tested comes from pine tree A, otherwise the maternal parent of the pine tree to be tested does not come from pine tree A; The SNP40 is a SNP in pine mitochondria, which is the 40th nucleotide of sequence 1, which is C or T; The SNP81 is a SNP in pine mitochondria, which is the 81st nucleotide of sequence 1, and is A or C; The SNP254 is a SNP in pine mitochondria, which is the 254th nucleotide of sequence 1, which is C or T; The SNP318 is a SNP in pine mitochondria, which is the 318th nucleotide of sequence 1, which is A or C; The SNP443 is a SNP in pine mitochondria, which is the 443rd nucleotide of sequence 1, which is G or T; The SNP521 is a SNP in pine mitochondria, which is the 521st nucleotide of sequence 1, which is G or T; The SNP590 is a SNP in pine mitochondria, which is the 590th nucleotide of sequence 1, and is A or C.

4. The product is any of the following: P1) identifying or assisting in identifying whether the pine tree mother to be tested is a product of Pinus armandii, including a substance for detecting a SNP of the pine tree to be tested, wherein the SNP is the SNP40 described in claim 1; P2) a product for identifying or assisting in identifying whether the pine tree parent to be tested is a white North American pine, including a substance for detecting a SNP of the pine tree to be tested, wherein the SNP is the SNP81 described in claim 1; P3) identifying or assisting in identifying whether the pine tree mother to be tested is a product of white pine, including a substance for detecting the SNP of the pine tree to be tested, wherein the SNP is the SNP318 described in claim 1; P4) identifying or assisting in identifying whether the pine tree mother to be tested is a product of Korean pine, including a substance for detecting a SNP of the pine tree to be tested, wherein the SNP is the SNP521 described in claim 1; P5) identifying or assisting in identifying whether the pine tree mother parent to be tested is a product of Xinjiang five-needle pine, including a substance for detecting SNPs of the pine tree to be tested, wherein the SNPs are SNP40 and SNP590 as described in claim 1; P6) A product for identifying or assisting in identifying whether the mother parent of the pine tree to be tested is from Pinus tabulaeformis, comprising a substance for detecting SNPs of the pine tree to be tested, wherein the SNPs are SNP254 and SNP443 as described in claim 1. P7) Identifying or assisting in identifying whether the pine tree mother to be tested is a product of pine tree A, wherein the pine tree A components include red pine and mongolica pine, and comprising a substance for detecting the SNP of the pine tree to be tested, wherein the SNP is SNP443 as described in claim 1.

5. The product of the substance for detecting SNP40, SNP81, SNP254, SNP318, SNP443, SNP521 and / or SNP590 is as follows D1), D2), D3) or D4): D1) contains in vitro nucleic acid amplification primers for specific amplification and detection of the SNP; D2) an in vitro nucleic acid amplification reagent containing the in vitro nucleic acid amplification primer described in D1); D3) a kit containing the in vitro nucleic acid amplification primers described in D1) or the in vitro nucleic acid amplification reagents described in D2); D4) A detection instrument containing the in vitro nucleic acid amplification primers described in D1), the in vitro nucleic acid amplification reagents described in D2) or the kit described in D3).

6. The in vitro nucleic acid amplification primers include a primer pair d for amplification; the primer pair d consists of primers dF and dR; The primer dF is a single-stranded nucleotide molecule whose nucleotide sequence is sequence 10; the primer dR is a single-stranded nucleotide molecule whose nucleotide sequence is sequence 11.

7. Use of a substance for detecting a pine parent to be tested in identifying a pine parent to be tested or in preparing a product for identifying a pine parent to be tested; the substance for detecting a pine parent to be tested is a substance for detecting SNP40, SNP81, SNP254, SNP318, SNP443, SNP521 and / or SNP590; The SNP40 is a SNP in pine mitochondria, which is the 40th nucleotide of sequence 1, which is C or T; The SNP81 is a SNP in pine mitochondria, which is the 81st nucleotide of sequence 1, which is A or C; the SNP254 is a SNP in pine mitochondria, which is the 254th nucleotide of sequence 1, which is C or T; The SNP318 is a SNP in pine mitochondria, which is the 318th nucleotide of sequence 1, which is A or C; The SNP443 is a SNP in pine mitochondria, which is the 443rd nucleotide of sequence 1, which is G or T; The SNP521 is a SNP in pine mitochondria, which is the 521st nucleotide of sequence 1, which is G or T; The SNP590 is a SNP in pine mitochondria, which is the 590th nucleotide of sequence 1, and is A or C.

8. Application of sequence 1 in the preparation of products for identifying the maternal or parental origin of pine trees.

9. Application of sequence 1 in the preparation of products for identifying pine tree parent and / or maternal origin.

10. Application of sequence 1 in identifying the parental and / or maternal origins of pine trees.

Images