Furan ring compounds

By developing furan ring compounds and their derivatives, the drug resistance and side effects of existing liver injury treatment drugs have been solved, effective treatment and cell repair of liver injury have been achieved, inflammatory factors have been reduced, and liver cell repair has been promoted.

CN119528855BActive Publication Date: 2025-08-12WUHAN UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411222664.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-02
Publication Date
2025-08-12
Estimated Expiration
2044-09-02

AI Technical Summary

Technical Problem

Existing liver injury treatment drugs have drug resistance, low safety and great side effects, making it difficult to treat various pathological conditions caused by liver injury such as insulin resistance, inflammation and oxidative stress.

Method used

The development of furan ring compounds and their related salts, solvates, prodrugs and compositions is used to regulate the lipid synthesis genes PPARγ and FABP1 by inhibiting the inflammatory factors IL-6 and TNF-α, and promote the expression of the cell proliferation gene Ki67, and is used to treat liver damage.

Benefits of technology

Effectively improve APAP and OA/PA-induced liver injury, reduce the level of inflammatory factors, promote cell repair, and provide safer and more effective liver injury treatment plans.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119528855B_ABST
    Figure CN119528855B_ABST
Patent Text Reader

Abstract

The present application relates to furan ring compounds, and to related salts, solvates, prodrugs, and compositions. The compounds can improve APAP and / or OA / PA-induced liver damage, while also improving the upregulation of inflammatory factors IL-6 and TNF-α and lipid synthesis genes PPARγ and FABP1 in liver damage, and promoting the expression of the cell proliferation gene Ki67. These compounds can be used as drugs and lead compounds for the treatment of liver diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present application relates to furan ring compounds, as well as related salts, solvates, prodrugs, and compositions. The compounds improve APAP- and / or OA / PA-induced liver damage, improve the upregulation of inflammatory factors IL-6 and TNF-α and lipid synthesis genes PPARy and FABP1 in liver damage, and promote the expression of the cell proliferation gene Ki67. The compounds can be used as candidate drugs and lead compounds for the treatment of liver disease. Background Art

[0002] Liver injury is a series of clinical syndromes of liver dysfunction caused by viral infection, drug hepatotoxicity, alcoholism, inflammation, oxidative stress and excessive fat accumulation, including acute liver injury, viral liver injury, alcoholic liver injury and fatty liver injury. Worsening liver injury can lead to acute or chronic liver failure, cirrhosis, liver fibrosis and even liver cancer. Currently, the common characteristics of various types of liver injury are liver cell damage, inflammation, oxidative stress and sometimes accompanied by symptoms such as lipid accumulation and insulin resistance. Currently, the main clinical treatments for liver injury are liver protectants, immunosuppressants, antiviral drugs and lipid-lowering drugs. However, long-term use of these drugs will lead to drug resistance, and they have problems such as low safety, large side effects and single therapeutic targets, resulting in poor efficacy. It is difficult to treat various pathological conditions caused by liver injury such as insulin resistance, inflammation, oxidative stress, etc. at the same time. Summary of the Invention

[0003] The present application relates to furan ring compounds, as well as related salts, solvates, prodrugs, and compositions. The compounds improve APAP- and / or OA / PA-induced liver damage, improve the upregulation of inflammatory factors IL-6 and TNF-α and lipid synthesis genes PPARy and FABP1 in liver damage, and promote the expression of the cell proliferation gene Ki67. The compounds can be used as candidate drugs and lead compounds for the treatment of liver disease.

[0004] To this end, the embodiments of the present application at least disclose the following technical solutions:

[0005] In the first aspect, the embodiments disclose compounds represented by formula (I):

[0006]

[0007] In a second aspect, the embodiments disclose a compound represented by formula (II):

[0008]

[0009] In the third aspect, the embodiments disclose optical isomers, labeled compounds, pharmaceutically acceptable salts, solvates or prodrugs of the compounds described in the first or second aspect.

[0010] In a fourth aspect, the embodiments disclose an inflammatory factor inhibitor, comprising the compound described in the first or second aspect, or the pharmaceutically acceptable salt described in the third aspect, or a solvent compound or a prodrug thereof.

[0011] In a fifth aspect, the embodiments disclose a lipid synthesis gene inhibitor, comprising the compound described in the first or second aspect, or the pharmaceutically acceptable salt described in the third aspect, or a solvent compound or a prodrug thereof.

[0012] In the sixth aspect, the embodiments disclose an expression promoter for the cell proliferation genes Ki67 and Pcna, comprising the compound described in the first or second aspect, or the pharmaceutically acceptable salt described in the third aspect, or a solvent compound or a prodrug thereof.

[0013] In a seventh aspect, embodiments disclose a composition comprising the compound of the first or second aspect, or the optical isomer, labeled compound, pharmaceutically acceptable salt, tautomer, solvate, or prodrug of the second aspect, and a pharmaceutically acceptable excipient.

[0014] In an eighth aspect, embodiments disclose a composition comprising the compound of the first or second aspect, the optical isomer, labeled compound, pharmaceutically acceptable salt, tautomer, solvate, or prodrug of the second aspect, wherein the compound, pharmaceutically acceptable salt, solvate, or prodrug, or the composition is used in a medicament.

[0015] In a ninth aspect, the embodiments disclose the use of the compound of the first or second aspect, or the pharmaceutically acceptable salt of the third aspect, or a solvate or prodrug thereof, or the composition of the seventh aspect for preparing a medicament for treating or preventing a disease, condition, or illness selected from:

[0016] (i) Acute liver injury;

[0017] (ii) viral liver damage;

[0018] (iii) alcoholic liver damage;

[0019] (iv) Fatty liver damage.

[0020] In a tenth aspect, embodiments disclose a method for preparing the compound of the first or second aspect. The method comprises: obtaining a crude extract of Malanthes root; and subjecting the crude extract of Malanthes root to at least one of extraction, C18 column chromatography, gel chromatography, or HPLC preparative chromatography. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1The present invention provides a schematic diagram of the process of preparing the crude extract of Malanthus lanatus, extracting and separating, separating by C18 column chromatography, separating by gel column chromatography, and screening the activity of the MTT method at each stage.

[0022] Figure 2 The example provides a schematic diagram of the HPLC separation, structural identification, and MTT activity screening process of Malan Radix E3 components at each stage.

[0023] Figure 3 The invention provides the safe concentration determination and activity detection of the n-butanol component and ethyl acetate component in the extraction process of the embodiment. Figure 3 Middle panel A shows the MTT assay to detect the survival rate of AML-12 cells treated with various concentrations of the n-butanol extract of Malanthus Root. Figure 3 Middle panel B shows the MTT assay to detect the survival rate of AML-12 cells treated with different concentrations of the ethyl acetate extract of Malanthus. Figure 3 Middle panel C shows the cell survival rate of AML-12 cells after treatment with 100 μg / mL n-butanol fraction of Malan root detected by MTT assay, n=5. Figure 3 Middle panel D shows the ALT level in the supernatant of AML-12 cells after treatment with 100 μg / mL n-butanol fraction of Malan root, n=4. Figure 3 Middle panel E shows the cell survival rate of AML-12 cells after treatment with 100 μg / mL ethyl acetate fraction of Malan root detected by MTT assay, n=5. Figure 3 Figure F shows the ALT level in the supernatant of AML-12 cells after treatment with 100 μg / mL of the ethyl acetate fraction of Malan Root (n = 4). *P < 0.05, **P < 0.01, ***P < 0.001.

[0024] Figure 4 Effects of the n-butanol and ethyl acetate fractions in the extraction process provided in the Examples on the TG levels in AML-12 cells stimulated by OA / PA. TG levels in cells of each treatment group, n = 3, *P < 0.05, **P < 0.01, ***P < 0.001.

[0025] Figure 5 The invention provides the safe concentration determination and activity detection of each separated component of ethyl acetate in the extraction process of the embodiment. Figure 5 Panels A and H show the MTT assay for AML-12 cell survival after treatment with the various fractions of A and H, respectively, after ethyl acetate fractionation of Malan rhizome. Panels I: MTT assay for AML-12 cell survival after treatment with the various fractions of A and H. Mean ± SD, n = 3, *P < 0.05, **P < 0.01, ***P < 0.001.

[0026] Figure 6Effects of the ethyl acetate fractions from the extraction process provided in the examples on ALT in the ALI cell model. Ameliorative effects of BH fractions on APAP-induced ALT elevation in the supernatant of AML-12 cells. Mean ± SD, n = 3, *P < 0.05.

[0027] Figure 7 Effects of various ethyl acetate fractions during the extraction process provided in the Examples on TG levels in AML-12 cells stimulated by OA / PA. Ameliorative effects of various BH fractions on OA / PA-induced TG elevation in AML-12 cells. Mean ± SD, n = 3, *P < 0.05.

[0028] Figure 8 The activity of the separated components E and G provided in the examples was detected. Figure 8 Middle panel A shows the detection of ALT in the supernatant of AML-12 cells after treatment with components E and G. Figure 8 Middle panel B shows the MTT assay for detecting the cell death rate of AML-12 cells in the APAP model after treatment with fractions E1-E3 following separation of Malan Root E. Figure 8 Middle panel C shows the detection of ALT in the supernatant of AML-12 cells after treatment with Malan Root E1-E3 components, n=3. Figure 8 The middle panel D shows the MTT assay for detecting the cell death rate of AML-12 cells after treatment with the G1-G5 fractions obtained after separation of the G fraction of Malan Root. Figure 8 Middle panel E shows the detection of ALT in the supernatant of AML-12 cells after treatment with Malan Root G1-G5 fractions. Mean ± SD, *P < 0.05, **P < 0.01, ***P < 0.001. Figure 8 Figure F in the middle shows the improvement effect of Malan Root E component on the increased TG level stimulated by OA / PA.

[0029] Figure 9 The activity test of each fraction of the E3 component provided in the example was carried out by HPLC separation. Figure 9 Middle panel A shows the survival rate of AML-12 cells under APAP treatment after administration of the separated components of E3. Figure 9 Middle panel B shows the detection of ALT in the supernatant of AML-12 cells after treatment with the separated components of E3. Figure 9 Panel C shows the TG levels of AML-12 cells after treatment with the various components of E3. Mean ± SD, n = 3, *P < 0.05.

[0030] Figure 10 The E3 component provided in the example was separated by HPLC for 15-20 min and the activity of each component was detected. Figure 10 Middle panel A shows the survival rate of AML-12 cells after treatment with the 15-20 min components. Figure 10Middle panel B shows the ALT level in the supernatant of AML-12 cells after treatment with the E315-20min fraction. Figure 10 Figure C in the middle shows the effects of the E3-15 min component and the E3-20 min component on the relative expression of intracellular Pcna gene mRNA. Figure 10 Figure D in the middle shows the effects of the E3-15 min fraction and the E3-20 min fraction on the relative expression of intracellular Ki-67 gene mRNA. Figure 10 Figure E in the middle shows the effects of the E3-15 min fraction and the E3-20 min fraction on the relative expression of intracellular TNF-α gene mRNA. Figure 10 Panel F shows the effect of the E3-15 min fraction and the E3-20 min fraction on the relative expression of intracellular IL-1β gene mRNA. Mean ± SD, n = 3, *P < 0.05.

[0031] Figure 11 The E3 component provided in the example was prepared and separated by HPLC for 15-20 min and the activity of the compound on OA / PA stimulated cells was detected. Figure 11 Middle panel A shows the TG levels of AML-12 cells after treatment with the various separated components during the 15-20 min period. Figure 11 Figure B in the middle shows the effect of E3-15 min fraction and E3-20 min fraction on the relative expression level of intracellular fabp1 gene. Figure 11 Panel C shows the effect of the E3-15 min fraction and the E3-20 min fraction on the relative expression of intracellular ppary genes. Mean ± SD, *P < 0.05, **P < 0.01, ***P < 0.001, n = 3.

[0032] Figure 12 The MS results of the E3-15min component provided in the examples have a relative molecular mass of 178.

[0033] Figure 13 The E3-15min component provided in the embodiment 1 H-NMR results (600 MHz, CD3OD).

[0034] Figure 14 The E3-15min component provided in the embodiment 13 C-NMR results (200 MHz, CD3OD).

[0035] Figure 15 NOESY results of the E3-15min component provided in the examples.

[0036] Figure 16The MS results of the E3-20min component provided in the examples have a relative molecular mass of 178.

[0037] Figure 17 The E3-20min component provided in the embodiment 1 H-NMR results (600 MHz, CD3OD).

[0038] Figure 18 The E3-20min component provided in the embodiment 13 C-NMR results (200 MHz, CD3OD).

[0039] Figure 19 COSY results of the E3-20min component provided in the examples.

[0040] Figure 20 HSQC results of the E3-20min component provided in the examples.

[0041] Figure 21 The HMBC results of the E3-20min component are provided in the examples.

[0042] Figure 22 NOESY results of the E3-20min component provided in the examples. DETAILED DESCRIPTION

[0043] In order to make the purpose, technical solutions and advantages of this application more clearly understood, the present application is further described in detail below with reference to the following examples. It should be understood that the specific examples described herein are merely for the purpose of explaining this application and are not intended to limit this application. Reagents not described in detail in this application are all conventional reagents and can be obtained from commercial channels; methods not specifically described in detail are all conventional experimental methods and can be obtained from the prior art.

[0044] Definitions and terms

[0045] References throughout this specification to "some embodiments" or "an embodiment" mean that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment. Thus, the appearances of the phrases "in one embodiment" or "in an embodiment" in various places throughout this specification are not necessarily all referring to the same embodiment. Furthermore, the particular features, structures, or characteristics may be combined in any suitable manner in one or more embodiments. Furthermore, as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the content clearly dictates otherwise. It should also be noted that the term "or" is generally employed in its sense including "and / or," unless the content clearly dictates otherwise.

[0046] Unless otherwise indicated, the following terms as used in this application have the following meanings:

[0047] The term "treatment" refers equally to curative therapy and ameliorative or palliative therapy. The term includes obtaining a beneficial or desired physiological result, which may or may not be clinically determined. Beneficial or desired clinical results include, but are not limited to, detectable or undetectable symptom relief, symptom prevention, alleviation of disease extent, stabilization of the disease (i.e., no exacerbation), delay or slowing of disease / symptom progression / aggravation, improvement or alleviation of disease / symptoms, and regression (whether partial or complete). As used herein, the term "relief" and its variations mean reducing the extent and / or undesirable manifestations and / or slowing or prolonging the time course of progression of a physiological disorder or symptom compared to not administering the compound, salt, solvate, prodrug, or pharmaceutical composition of the present invention. As used herein, the term "prevention" related to a disease, disorder, or illness refers to prophylactic or preventative therapy and therapy that reduces the risk of developing a disease, disorder, or illness. The term "prevention" includes both avoiding the occurrence of a disease, disorder, or illness and delaying the onset of a disease, disorder, or illness. Any statistically significant (p≤0.05) avoidance of occurrence, delay in onset, or reduction in risk as measured by a controlled clinical trial can be considered prevention of a disease, disorder, or condition. Individual subjects suitable for prevention include those subjects whose risk of a disease, disorder, or condition is increased as identified by genetic or biochemical markers.

[0048] Compound

[0049] The embodiment discloses a compound of formula (I)

[0050] The embodiment discloses a compound of formula (II) Optical isomerism of compounds body

[0051] In certain embodiments, the compound described in formula (I) or (II) exists in the form of optical isomers. The compound described in formula (I) or (II) includes all diastereomers, enantiomers and epimers and their corresponding mixtures. In the additional embodiment of the compound and method provided herein, the mixture of enantiomers and / or diastereomers produced by a single preparation step, combination or mutual conversion can be used for the application described herein. In certain embodiments, the compound described in formula (I) or (II) is prepared into their single optical isomers in the following manner: the racemic mixture of the compound is reacted with an optically active resolving agent to form a pair of diastereomeric compounds, the diastereomers are separated, and optically pure enantiomers are recovered. In certain embodiments, dissociable complexes are preferred. In certain embodiments, diastereomers have different physical properties (such as melting point, boiling point, solubility, reactivity, etc.), and are separated by utilizing these dissimilarity. In certain embodiments, by chiral chromatography, or preferably, by separation / splitting techniques based on solubility differences to separate diastereomers.

[0052] Labeled compounds

[0053] In some embodiments, the compounds described in formula (I) or (II) exist in their isotopically labeled form. In some embodiments, the methods disclosed herein include methods of treating diseases by administering such isotopically labeled compounds. In some embodiments, the methods disclosed herein include methods of treating diseases by administering such isotopically labeled compounds in the form of pharmaceutical compositions. Therefore, in some embodiments, the compounds disclosed herein include isotopically labeled compounds that are identical to those described herein, except that one or more atoms are replaced by atoms having an atomic mass or mass number different from the atomic mass or mass number typically found in nature. Examples of isotopes that can be incorporated into the compounds disclosed herein include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, fluorine, and chlorine, such as 2 H. 3 H. 13 C. 14 C. 15 N. 18 O. 17 O. 31 P. 32 P. 35 S. 18 F and 36 Cl. Compounds of formula (I) or (II) and pharmaceutically acceptable salts, solvates or optical isomers thereof containing the above-mentioned isotopes and / or other isotopes of other atoms are within the scope of this application. Certain isotopically labeled compounds, for example radioactive isotopes such as 3 H and14 Those into which C is incorporated can be used in drug and / or substrate tissue distribution assays. 3 H) and carbon-14 (i.e. 14 C) isotopes are particularly preferred due to their ease of preparation and detectability. In addition, heavy isotopes such as deuterium (i.e. 2 H) substitutions may result in certain therapeutic advantages resulting from greater metabolic stability, such as increased in vivo half-life or reduced dosage requirements.

[0054] In some embodiments, the compounds described by Formula (I) or (II) are labeled by other means, including but not limited to the use of chromophores or fluorescent moieties, bioluminescent labels, or chemiluminescent labels.

[0055] Pharmaceutically acceptable salts

[0056] In some embodiments, the compounds described in formula (I) or (II) exist in the form of their pharmaceutically acceptable salts. In some embodiments, the methods disclosed herein include methods for treating diseases by administering such pharmaceutically acceptable salts. In some embodiments, the methods disclosed herein include methods for treating diseases by administering such pharmaceutically acceptable salts in the form of pharmaceutical compositions.

[0057] In some embodiments, the compound described in formula (I) or (II) has an acidic or basic group and therefore reacts with any of a number of inorganic or organic bases and inorganic and organic acids to form pharmaceutically acceptable salts. In some embodiments, these salts are prepared in situ during the final separation and purification of the compounds disclosed herein or their solvates or optical isomers, or by using the purified compound in its free form alone to react with a suitable acid or base and separating the salt thus formed.

[0058] Examples of pharmaceutically acceptable salts include those prepared by reaction of a compound described by formula (I) or (II) with a mineral acid, an organic acid, or an inorganic base, such salts include acetate, acrylate, adipate, alginate, aspartate, benzoate, benzenesulfonate, bisulfate, bisulfite, bromide, butyrate, butyne-1,4-dioate, camphorate, camphorsulfonate, hexanoate, octanoate, chlorobenzoate, chloride, citrate, cyclopentanepropionate, decanoate, digluconate, dihydrogen phosphate, dinitrobenzoate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucoheptanoate, glycerophosphate, glycolate, hemisulfate, heptanoate, hexanoate, hexyne-1,6-dioate, hydroxybenzoate, γ-hydroxybenzoate, benzoate, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt, benzoic acid salt,

[0059] In addition, the compounds described in formula (I) or (II) can be prepared into pharmaceutically acceptable salts by reacting the free base form of the compound with a pharmaceutically acceptable inorganic or organic acid, wherein the pharmaceutically acceptable inorganic or organic acid includes but is not limited to inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, metaphosphoric acid, and the like; and organic acids such as acetic acid, propionic acid, hexanoic acid, cyclopentanepropionic acid, glycolic acid, pyruvic acid, lactic acid, malonic acid, succinic acid, malic acid, maleic acid, fumaric acid, p-toluenesulfonic acid, tartaric acid, trifluoroacetic acid, citric acid, benzoic acid, Acid, 3-(4-hydroxybenzoyl)benzoic acid, cinnamic acid, mandelic acid, arylsulfonic acid, methanesulfonic acid, ethanesulfonic acid, 1,2-ethanedisulfonic acid, 2-hydroxyethanesulfonic acid, benzenesulfonic acid, 2-naphthalenesulfonic acid, 4-methylbicyclo-[2.2.2]oct-2-ene-1-carboxylic acid, glucoheptonic acid, 4,4'-methylenebis-(3-hydroxy-2-ene-1-carboxylic acid), 3-phenylpropionic acid, trimethylacetic acid, tert-butylacetic acid, lauryl sulfuric acid, gluconic acid, glutamic acid, hydroxynaphthoic acid, salicylic acid, stearic acid and muconic acid. In some embodiments, other acids such as oxalic acid, although not pharmaceutically acceptable themselves, are used to prepare salts that can be used as intermediates in obtaining the compounds disclosed herein, their solvates or optical isomers, and their pharmaceutically acceptable acid addition salts.

[0060] In some embodiments, compounds described herein that contain free acid groups are reacted with a suitable base, such as a pharmaceutically acceptable hydroxide, carbonate, bicarbonate, sulfate of a metal cation; with ammonia; or with a pharmaceutically acceptable organic primary, secondary, tertiary, or quaternary amine. Representative salts include alkali metal or alkaline earth metal salts, such as lithium, sodium, potassium, calcium, and magnesium salts, as well as aluminum salts. Illustrative examples of bases include sodium hydroxide, potassium hydroxide, choline hydroxide, sodium carbonate, N+(C1-4 alkyl)4, and the like.

[0061] Representative organic amines that can be used to form base addition salts include ethylamine, diethylamine, ethylenediamine, ethanolamine, diethanolamine, piperazine, etc. It should be understood that the compounds described in formula (I) or (II) also include quaternization of any basic nitrogen-containing groups they contain. In certain embodiments, water- or oil-soluble or dispersible products are obtained by such quaternization.

[0062] Solvates

[0063] In some embodiments, the compound described in formula (I) or (II) exists in the form of a solvate. The application provides a method for treating a disease by administering such a solvate. The application also provides a method for treating a disease by administering such a solvate in the form of a pharmaceutical composition.

[0064] Solvates contain stoichiometric or non-stoichiometric amounts of solvents, and in some embodiments, are formed during the process of crystallization with pharmaceutically acceptable solvents such as water, ethanol, etc. When the solvent is water, a hydrate is formed, or when the solvent is alcohol, an alcoholate is formed. Solvates of compounds described in formula (I) or (II) can be conveniently prepared or formed during the process described herein. By way of example only, hydrates of compounds described in formula (I) or (II) can be conveniently prepared by recrystallizing from an aqueous / organic solvent mixture using an organic solvent including but not limited to dioxane, tetrahydrofuran or methanol. In addition, compounds provided herein can exist in unsolvated forms as well as solvated forms. In general, for the purposes of compounds and methods provided herein, solvated forms are considered to be equivalent to unsolvated forms.

[0065] Tautomers

[0066] In some cases, compounds exist as tautomers. The compounds described in formula (I) or (II) include all possible tautomers within the formula described in the present application. Tautomers are compounds that can be converted to each other by the migration of hydrogen atoms, and the migration is accompanied by the conversion of single bonds and adjacent double bonds. In the bonding arrangement in which tautomerism is likely to occur, there will be a chemical equilibrium of tautomers. All tautomeric forms of compounds disclosed in the present application are considered. The exact ratio of tautomers depends on several factors, including temperature, solvent and pH.

[0067] Prodrug

[0068] Some embodiments provide prodrugs of compounds described in formula (I) or (II). Prodrugs are compounds that are converted in whole or in part into compounds of the present invention when administered to a subject (e.g., a human). In most embodiments, prodrugs are pharmacologically inert chemical derivatives that can be converted into active drug molecules in vivo to exert a therapeutic effect. Any compound described herein can be administered in the form of a prodrug to increase the activity, bioavailability, or stability of the compound or to otherwise alter the properties of the compound. Typical examples of prodrugs include compounds having biologically labile protecting groups on the functional portion of the active compound. Prodrugs include, but are not limited to, compounds that can be oxidized, reduced, aminated, deaminated, hydroxylated, dehydroxylated, hydrolyzed, dehydrated, alkylated, dealkylated, acylated, deacylated, phosphorylated, and / or dephosphorylated to produce an active compound. The present application also encompasses salts and solvates of the prodrugs described above.

[0069] The compounds, salts, solvates and prodrugs of the present application may contain at least one chiral center. Therefore, the compounds, salts, solvates and prodrugs may exist in at least two isomeric forms. The present application encompasses racemic mixtures of compounds, salts, solvates and prodrugs of the present application and enantiomerically enriched and substantially enantiomerically pure isomers. For the purposes of the present application, an isomer of a "substantially enantiomer" of a compound contains less than 5% of other isomers of the same compound by weight, more typically less than 2%, and most typically less than 0.5%.

[0070] Pharmaceutically acceptable excipients

[0071] Conventional procedures for selecting and preparing suitable pharmaceutical formulations are described, for example, in “AμLton's Pharmaceutics—The Design and Manufacture of Medicines”, MEAμLton and KMG Taylor, Churchill μL Livingstone Elsevier, 4th edition, 2013.

[0072] Pharmaceutically acceptable excipients (including adjuvants, diluents or carriers) that can be used in the pharmaceutical composition of the present application are those commonly used in the field of drug formulation, and include (but are not limited to) sugars, sugar alcohols, starches, ion exchangers, aluminum oxide, aluminum stearate, lecithin, serum proteins (such as human serum albumin), buffer substances (such as phosphates, glycerol, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes such as protamine, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silicon dioxide, magnesium trisilicate, polyvinyl pyrrolidone, cellulose-based substances, polyethylene glycol, sodium carboxymethyl cellulose, polyacrylates, waxes, polyethylene-polyoxypropylene-block polymers, polyethylene glycol and lanolin).

[0073] treat

[0074] The present application provides a method for preventing or treating liver damage and / or fatty liver in a subject by administering a composition disclosed herein (i.e., a compound of Formula (I) or Formula (II) and / or a composition) to a subject (e.g., a subject in need thereof).

[0075] In some embodiments, the subject may have or be susceptible to liver injury and / or fatty liver. Liver injury can be caused by any patient's condition that causes the cell (that is, hepatocyte) death of the liver or otherwise malfunctions. The example of the patient's condition that can cause liver injury includes, but is not limited to, cancer (for example, liver cancer, bile duct cancer or hepatic adenoma), trauma, inborn errors of metabolism (for example, the inherited metabolic disorder that causes enzyme deficiency), vascular injury, cirrhosis, viral infection (for example, hepatitis A, hepatitis B, hepatitis E), autoimmune disease (for example, autoimmune hepatitis, primary biliary cirrhosis or primary sclerosing cholangitis), hemochromatosis, hyperoxaluria, oxalate deposition disease, Wilson's disease or drug-induced hepatotoxicity (for example, alcohol-induced hepatotoxicity or acetaminophen-induced hepatotoxicity). Fatty liver can be caused by any patient's condition that causes the fat accumulation of liver. These patient's conditions can be, but are not limited to non-alcoholic fatty liver disease or alcoholic liver disease.

[0076] The present application discloses a method for treating or preventing age-related symptoms or diseases, comprising administering a composition disclosed herein. The present application provides a method for reducing the amount of alanine aminotransferase (ALT) and / or aspartate aminotransferase (AST) in a subject, comprising administering a composition provided herein to a subject. AST and ALT are quite sensitive indicators of liver damage or injury from different types of diseases or conditions, and they are typically measured in liver tests or liver blood tests. Elevated levels of AST and ALT are relevant to liver damage and liver dysfunction. In some embodiments, after administration of the composition, ALT is reduced in a subject by at least 0.1 U / L, at least 0.2 U / L, at least 0.3 U / L, at least 0.4 U / L, at least 0.5 U / L, at least 0.6 U / L, at least 0.7 U / L, at least 0.8 U / L, at least 0.9 U / L, at least 1.0 U / L, 1.1 U / L, at least 1.2 U / L, at least 1.3 U / L, at least 1.4 U / L, at least 1.5 U / L, at least 1.6 U / L, at least 1.8 U / L, at least 1.9 U / L, at least 2.0 U / L, at least 2.1 U / L, at least 2.2 U / L, at least 2.3 U / L, at least 2.4 U / L, at least 2.5 U / L, at least 2.6 U / L, at least 2.7 U / L, at least 2.8 U / L, at least 2.9 U / L, at least 2. 0 U / L, at least 1.6 U / L, at least 1.7 U / L, at least 1.8 U / L, at least 1.9 U / L, at least 2.0 U / L, 2.1 U / L, at least 2.2 U / L, at least 2.3 U / L, at least 2.4 U / L, at least 2.5 U / L, at least 2.6 U / L, at least 2.7 U / L, at least 2.8 U / L, at least 2.9 U / L, at least 3.0 U / L, at least 3.5 U / L, 4.0 U / L, at least 4.5 U / L or at least 5.0 U / L. In some embodiments, after administration of the composition, ALT is reduced by at least 0.1 U / L, at least 0.2 U / L, at least 0.3 U / L, at least 0.4 U / L, at least 0.5 U / L, at least 0.6 U / L, at least 0.7 U / L, at least 0.8 U / L, at least 0.9 U / L, at least 1.0 U / L, 1.1 U / L, at least 1.2 U / L, at least 1.3 U / L, at least 1.4 U / L, at least 1.5 U / L, at least 1.6 U / L, / L, at least 1.7 U / L, at least 1.8 U / L, at least 1.9 U / L, at least 2.0 U / L, 2.1 U / L, at least 2.2 U / L, at least 2.3 U / L, at least 2.4 U / L, at least 2.5 U / L, at least 2.6 U / L, at least 2.7 U / L, at least 2.8 U / L, at least 2.9 U / L, at least 3.0 U / L, at least 3.5 U / L, 4.0 U / L, at least 4.5 U / L or at least 5.0 U / L.

[0077] Actual dosage levels and administration regimens of the compositions disclosed herein may be varied to obtain an amount of the compound of Formula (I) or Formula (II) and / or composition that is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient.

[0078] In some embodiments, administering the composition includes administering the composition with one or more dosages. In some embodiments, administering the composition includes administering the composition with one or more, five or more, ten or more, twenty or more, thirty or more, forty or more, fifty or more, one hundred or more, or one thousand or more dosages. In some embodiments, the dosage comprises at least 25 mg, at least 50 mg, at least 75 mg, at least 100 mg, at least 125 mg, at least 150 mg, at least 200 mg, at least 225 mg, at least 250 mg, at least 275 mg, at least 300 mg, at least 325 mg, at least 350 mg, at least 375 mg, at least 400 mg, at least 425 mg, at least 450 mg, at least 475 mg, at least 500 mg, at least 550 mg, at least 600 mg, at least 650 mg, at least 700 mg, at least 750 mg, at least 800 mg or at least 850 mg of formula (I) or compound of formula (II).

[0079] The compositions disclosed herein can be administered over any time period that is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration and is non-toxic to the patient. The time period can be at least 1 day, at least 10 days, at least 20 days, at least 30 days, at least 60 days, at least 3 months, at least 6 months, at least 1 year, at least 3 years, at least 5 years, or at least 10 years. The dosage can be administered as needed, sporadically, or at regular intervals. For example, the dosage can be administered monthly, weekly, twice a week, three times a week, once a day, or twice a day.

[0080] Drug administration

[0081] In certain embodiments, compositions containing one or more compounds described herein are administered for prophylactic and / or therapeutic treatment. In certain therapeutic applications, the composition is administered to a patient already suffering from a disease or disorder in an amount sufficient to cure or at least partially arrest at least one symptom of the disease or disorder. The amount effective for this use depends on the severity and course of the disease or disorder; previous therapy; the patient's health status, weight, and response to the medication; and the judgment of the treating physician. The therapeutically effective amount is optionally determined by methods including, but not limited to, dose escalation and / or dose-ranging clinical trials.

[0082] In preventive applications, a composition containing the compounds described herein is administered to a patient susceptible to or otherwise at risk for a particular disease, condition, or illness. Such an amount is defined as a "prophylactically effective amount or dose." In this use, the precise amount also depends on the patient's health status, weight, etc. When used in a patient, the effective amount for this use will depend on the severity and course of the disease; previous therapy; the patient's health status and response to the drug; and the judgment of the treating physician. In one aspect, preventive treatment comprises administering a pharmaceutical composition comprising a compound described herein, or a pharmaceutically acceptable salt thereof, to a mammal that has previously experienced at least one symptom or risk factor for the disease being treated and is currently in remission to prevent the recurrence of the symptoms of the disease or illness.

[0083] In certain embodiments where the patient's condition does not improve, at the physician's discretion, administration of the compound is continued chronically, that is, for an extended period of time, including for the duration of the patient's life, to ameliorate or otherwise control or limit the symptoms of the patient's disease or disorder.

[0084] In certain embodiments where the patient's condition improves, the dose of the administered drug is temporarily reduced or temporarily stopped for a period of time (i.e., a "drug holiday"). In specific embodiments, the duration of the drug holiday is between 2 days and 1 year, including, by way of example only, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 12 days, 15 days, 20 days, 28 days, or more than 28 days. By way of example only, the dose reduction during the drug holiday is 10%-100%, including, by way of example only, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, and 100%.

[0085] Once the patient's condition has improved, a maintenance dose is administered as necessary. Subsequently, in specific embodiments, the dosage or frequency of administration, or both, is reduced to a level that maintains the improved disease, condition, or disorder, as a function of symptoms. However, in certain embodiments, after any recurrence of symptoms, the patient requires long-term intermittent or daily treatment.

[0086] The amount corresponding to such an amount for a given agent will vary depending on factors such as the particular compound, the disease state and its severity, the identity (e.g., weight, sex) of the subject or host requiring treatment, and will however be determined in accordance with the particular circumstances surrounding the case, including, for example, the specific agent being administered, the route of administration, the condition being treated, and the subject or host being treated.

[0087] However, in general, dosages for adult treatment are generally in the range of 0.01 mg to 5000 mg per day. In one aspect, dosages for adult treatment are from about 1 mg to about 1000 mg per day. In one embodiment, the desired dosage is conveniently provided in a single dose or in divided doses administered simultaneously or at appropriate intervals, for example, in the form of two, three, four, or more sub-doses per day.

[0088] In one embodiment, the daily dose suitable for the compound described herein or its pharmaceutically acceptable salt is about 0.01 to about 50 mg per kg body weight. In certain embodiments, based on many variables about a single treatment regimen, the amount of active substance in the daily dose or dosage form is lower or higher than the range indicated in the application. In various embodiments, the daily dose and unit dose are changed depending on many variables, including but not limited to the activity of the compound used, the disease or illness to be treated, the mode of administration, the needs of a single subject, the severity of the disease or illness to be treated, and the judgment of the practitioner.

[0089] The toxicity and therapeutic efficacy of such treatment regimens are determined in cell cultures or experimental animals by standard pharmaceutical procedures, including but not limited to determining LD10 and ED90. The dose ratio between toxic effects and therapeutic effects is the therapeutic index, and it is expressed as the ratio between LD10 and ED90. In certain embodiments, the data obtained from cell culture assays and animal studies are used to formulate effective daily dose ranges and / or effective unit doses for the treatment of mammals including humans. In certain embodiments, the daily dose of the compound described herein is within the range of circulating concentrations including ED50 with minimal toxicity. In certain embodiments, depending on the dosage form employed and the route of administration utilized, daily dose ranges and / or unit doses vary within this range.

[0090] Within any of the above-mentioned aspects are further embodiments wherein an effective amount of a compound described herein, or a pharmaceutically acceptable salt thereof, is: (a) administered systemically to a mammal; and / or (b) administered orally to a mammal; and / or (c) administered intravenously to a mammal; and / or (d) administered by injection to a mammal; and / or (e) administered topically to a mammal; and / or (f) administered non-systemically or locally to a mammal.

[0091] Within any of the above-mentioned aspects are further embodiments comprising a single administration of an effective amount of the compound, including further embodiments wherein: (i) the compound is administered once a day; or (ii) the compound is administered to the mammal multiple times over the span of a day.

[0092] In any of the above-mentioned aspects are other embodiments comprising multiple administrations of an effective amount of a compound, including the following other embodiments: wherein (i) the compound is administered continuously or intermittently: such as in a single dose; (ii) the time between multiple administrations is every 6 hours; (iii) the compound is administered to the mammal every 8 hours; (iv) the compound is administered to the subject every 12 hours; (v) the compound is administered to the subject every 24 hours. In further or alternative embodiments, the method comprises a drug holiday, wherein the administration of the compound is temporarily stopped, or the dose of the administered compound is temporarily reduced; at the end of the drug holiday, administration of the compound is resumed. In one embodiment, the duration of the drug holiday varies from 2 days to 1 year.

[0093] Route of administration

[0094] Suitable routes of administration include, but are not limited to, oral, intravenous, rectal, aerosol, parenteral, ocular, pulmonary, transmucosal, transdermal, vaginal, otic, nasal, and topical administration. In addition, parenteral delivery includes, by way of example only, intramuscular, subcutaneous, intravenous, intramedullary injection, as well as intrathecal, direct intraventricular, intraperitoneal, intralymphatic, and intranasal injection.

[0095] In certain embodiments, the compounds as described herein are administered in a local rather than systemic manner, for example, by direct injection of the compound into an organ, typically in the form of a reservoir formulation or sustained release formulation. In specific embodiments, the long-acting formulation is administered by implantation (e.g., subcutaneous or intramuscular implantation) or by intramuscular injection. In addition, in other embodiments, the drug is delivered in a targeted drug delivery system, for example, in a liposome coated with an organ-specific antibody. In such embodiments, the liposome is targeted to the organ and selectively absorbed by the organ. In other embodiments, the compounds as described herein are provided in the form of a rapid release formulation, in the form of an extended release formulation, or in the form of a medium release formulation. In other embodiments, the compounds described herein are administered topically.

[0096] Pharmaceutical compositions / preparations

[0097] The compounds described herein are administered to a subject in need thereof, alone or in combination with a pharmaceutically acceptable carrier, excipient, or diluent, as a pharmaceutical composition according to standard pharmaceutical practice. In one embodiment, the compounds of the present invention can be administered to animals. The compounds can be administered orally or parenterally, including intravenous, intramuscular, intraperitoneal, subcutaneous, rectal, and topical routes of administration.

[0098] In another aspect, the present application provides a pharmaceutical composition comprising a compound or optical isomer, labeled compound, pharmaceutically acceptable salt, tautomer, solvate, or prodrug described herein and at least one pharmaceutically acceptable excipient. The pharmaceutical composition is formulated in a conventional manner using one or more pharmaceutically acceptable excipients that aid in processing the active compound into a pharmaceutically usable formulation. The appropriate formulation depends on the chosen route of administration. A summary of the pharmaceutical compositions described herein can be found, for example, in Remington: The Science and Practice of Pharmacy, 19th ed. (Easton, Pa.: Mack Publishing Company, 1995); Hoover, John E., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pennsylvania 1975; Liberman, H.A. and Lachman, μL., eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, NY, 1980; and Pharmaceutical Dosage Forms and Drug Delivery Systems, 7th ed. (Lippincott Williams & Wilkins 1999), which are incorporated herein by reference for such disclosure.

[0099] In some embodiments, the pharmaceutically acceptable excipient is selected from carriers, binders, fillers, suspending agents, flavoring agents, sweeteners, disintegrants, dispersants, surfactants, lubricants, colorants, diluents, solubilizers, wetting agents, plasticizers, stabilizers, penetration enhancers, wetting agents, defoaming agents, antioxidants, preservatives, and any combination thereof.

[0100] The pharmaceutical compositions described herein are administered to a subject by an appropriate route of administration, including but not limited to oral, parenteral (e.g., intravenous, subcutaneous, intramuscular), intranasal, buccal, topical, rectal, or transdermal administration. Pharmaceutical formulations described herein include but are not limited to aqueous liquid dispersions, liquids, gels, syrups, elixirs, slurries, suspensions, self-emulsifying dispersions, solid solutions, liposomal dispersions, aerosols, solid oral dosage forms, powders, immediate release formulations, controlled release formulations, fast melt formulations, tablets, capsules, pills, powders, dragees, effervescent formulations, lyophilized formulations, delayed release formulations, extended release formulations, pulsatile release formulations, multiparticulate formulations, and mixed immediate and controlled release formulations.

[0101] Pharmaceutical compositions comprising a compound or optical isomer, labeled compound, pharmaceutically acceptable salt, tautomer, solvate or prodrug described herein are manufactured in a conventional manner, such as, by way of example only, by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or compression processes.

[0102] The pharmaceutical composition for oral use is obtained by mixing one or more solid excipients with one or more compounds described herein, optionally grinding the resulting mixture, and processing the mixture of particles to obtain tablets or dragee cores after adding suitable adjuvants when necessary. Suitable excipients include, for example, fillers, such as sugars, including lactose, sucrose, mannitol, or sorbitol; Cellulose preparations, such as corn starch, wheat starch, rice starch, potato starch, gelatin, tragacanth, methylcellulose, microcrystalline cellulose, hydroxypropyl methylcellulose, sodium carboxymethylcellulose; or other excipients, such as polyvinyl pyrrolidone (PVP or povidone) or calcium phosphate. If necessary, disintegrants such as cross-linked sodium carboxymethylcellulose, polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof, such as sodium alginate, are added. In some embodiments, dyes or pigments are added to tablets or dragee coatings for use in identifying or characterizing different combinations of active compound dosages.

[0103] Pharmaceutical compositions for oral administration include push-fit capsules made of gelatin and soft, sealed capsules made of gelatin and a plasticizer such as glycerol or sorbitol. Push-fit capsules contain a blend of the active ingredient with a filler such as lactose, a binder such as starch, and / or a lubricant such as talc or magnesium stearate, and optionally a stabilizer. In soft capsules, the active compound is dissolved or suspended in a suitable liquid such as a fatty oil, liquid paraffin, or liquid polyethylene glycol. In some embodiments, a stabilizer is added.

[0104] The pharmaceutical composition for parenteral use is formulated into an infusion or injection. In certain embodiments, the pharmaceutical composition suitable for injection or infusion includes a sterile aqueous solution or dispersion or sterile powder comprising a compound or optical isomer, labeled compound, pharmaceutically acceptable salt, tautomer, solvate or prodrug as described herein. In certain embodiments, the pharmaceutical composition includes a liquid carrier. In certain embodiments, the liquid carrier is a solvent or liquid dispersion medium, including, for example, water, saline, ethanol, polyols (such as glycerol, propylene glycol, liquid polyethylene glycol, etc.), vegetable oils, non-toxic glycerides and any combination thereof. In certain embodiments, the pharmaceutical composition also includes a preservative to prevent microbial growth.

[0105] Preparation of compounds of formula (I) or (II)

[0106] The main active substance of Aster indicus μL. root that exerts its efficacy in the treatment of liver diseases is not yet clear. This application uses a series of technical means to first perform a preliminary separation of the chemical substances in Aster indicus root, uses in vitro activity experimental technology to determine the main separated components, and finally separates the monomer compounds. This application uses infiltration method, silica gel column chromatography, gel column chromatography, HPLC and other technical means to isolate two new furan ring compounds from Aster indicus root for the first time, and they have the effect of protecting the liver.

[0107] The embodiment provides a method for preparing a compound of formula (I) or (II), comprising obtaining a crude extract of Malanthes root; and subjecting the crude extract of Malanthes root to at least one of extraction, C18 column chromatography, gel chromatography, or HPLC preparative chromatography.

[0108] 1. Preparation of compounds of formula (I) or (II)

[0109] (1) Preparation of Malan Root Crude Extract

[0110] like Figure 1 As shown, 5kg of dried Malan root medicinal materials (from Anhui Kanghe Chinese Medicine Technology Co., Ltd.) are taken, crushed by a grinder and placed in a 25L soaking barrel for standby use. 15L of methanol is added to the soaking barrel, and the methanol needs to soak the Malan root medicinal materials for 2 weeks. After 2 weeks, the soaking liquid is taken, the Malan root medicinal material residue is filtered, and the soaking liquid is suspended and refrigerated for storage. The methanol is recovered and soaked in the Malan root medicinal materials again, and steps 2 and 3 are repeated three times. The accumulated suspended material is the Malan root crude extract.

[0111] (2) Extraction of Malan Root Crude Extract

[0112] like Figure 1 As shown, the crude extract of Malanthus annuus was subjected to a first extraction using a solvent of ethyl acetate and water in a volume ratio of 3:1; the aqueous phase solution obtained from the first extraction was collected and mixed with n-butanol in a volume ratio of 1:1 for a second extraction; the aqueous phase solution, ethyl acetate phase solution and n-butanol phase solution obtained from the first extraction and the second extraction were screened using the MTT method, and the results showed that the ethyl acetate phase solution contained active ingredients.

[0113] (3) C18 silica gel column separation

[0114] like Figure 1As shown, the ethyl acetate phase solution obtained above was concentrated, spin-dried, and loaded onto a C18 silica gel chromatography column (inner diameter 5 cm, 50 g of 200 mesh silica gel in total). A solvent with a volume ratio of dichloromethane to methanol of 100:1 was used as the mobile phase, and elution was performed for 2 column volumes. The compound components eluted and separated by each gradient mobile phase were collected in a 15 mL test tube. The eluted materials with similar substances were combined and suspended to dryness using the UV-356 nm and UV-254 nm data of the thin layer chromatography plate to obtain eight components, namely A, B, C, D, E, F, G, and H. The MTT assay found that component E contained the active ingredient.

[0115] (4) Gel column chromatography separation of E component

[0116] like Figure 1 As shown, after using the solvent E component with a volume ratio of chloromethane to methanol of 100:1, the sample was loaded onto a gel column Sephadex LH-20 (Pharmacia, Sweden), and a solvent with a volume ratio of dichloromethane to methanol of 100:1 was used as the eluent for elution for 2 column volumes. The eluted substances with similar substances were combined and suspended to dryness using the UV-356nm and UV-254nm data of the thin layer chromatography plate to obtain five fractions E1 to E5. After detection by the MTT method and the TG method, it was found that the E3 fraction had the highest activity.

[0117] (5) HPLC purification of E3 component

[0118] like Figure 2 As shown, the E3 fraction was dissolved in a 2:1 volume ratio of acetonitrile to water and loaded onto a C18 column (5 μm, 10 × 250 mm, Sepax GP-C-18) for HPLC purification. A mobile phase consisting of acetonitrile (A) and water (B) was used for gradient elution over 20 minutes, with the elution program being 20% ​​A → 80% A. Detection was performed at UV-220 nm and UV-300 nm, and the main compounds eluting at 4-9 minutes, 9-15 minutes, and 15-20 minutes were collected. Activity screening revealed that the fraction eluting at 15-20 minutes exhibited activity in ameliorating APAP-induced acute liver injury.

[0119] The effluent from 90 to 20 min was collected and purified again using the same chromatographic column conditions, except that the elution program of the mobile phase was 20% A→80% A and the elution time was 20 min. The eluates from 15 min and 20 min were collected and freeze-dried to obtain compounds E3-15 min and E3-20 min.

[0120] (6) Hydrogen spectrum, carbon spectrum and mass spectrometry identification

[0121] like Figure 12 and Figure 16The E3-15 min and E3-20 min groups were tested by MS. Among them, the predicted relative molecular mass [M+H] of the E3-15 min compound was + =179.07082, measured relative molecular mass [M+H] + =179.07033. E3-20min compound predicted relative molecular mass [M+Na] + =201.05276, measured relative molecular mass [M+Na] + =201.05266.

[0122] like Figure 13 and Figure 17 The E3-15 min and E3-20 min components were detected by hydrogen nuclear magnetic resonance, and the 1H-NMR spectra of the two substances were obtained.

[0123] like Figure 14 and Figure 18 The E3-15 min and E3-20 min groups were respectively subjected to carbon nuclear magnetic resonance detection to obtain the 13C-NMR spectra of the two substances.

[0124] The structural characteristics of component E3-15min are 1 H NMR (600MHz, Methanol-d4) δ7.65(d,J=5.4Hz,1H),6.31(dd,J=5.4,0.8Hz,1H),5.52(td,J=2.5,0.8Hz,1H),3.95(d t,J=12.6,6.3Hz,1H),2.63(ddd,J=17.0,5.5,2.5Hz,1H),2.55(ddd,J=17.0,6.5,2.5Hz,1H),1.28(d,J=6.2Hz,3H); 13 C NMR(201MHz,MeOD)δ170.85,144.88,120.94,95.46,67.25,30.88,22.61; ESI-MS:[M+H] + =179.07082

[0125] The structural characteristics of component E3-20min are 1 H NMR (600MHz, Methanol-d4) δ7.65(d,J=5.4Hz,1H),6.31(d,J=5.4Hz,1H),5.52(t,J=2.5Hz ,1H),3.95(m,1H),2.63(ddd,J=14.7,5.5,2.8Hz,1H),2.55(m,1H),1.28(d,J=6.2Hz,3H); 13C NMR (201MHz, MeOD) δ170.89,158.19,144.84,121.00,101.19,95.48,77.25,67.25,30.88,22.61; [M+Na] + =201.05266

[0126] According to the two compounds E3-15 min and E3-20 min 1 H-NMR results and 13 C-NMR results, processed, obtained both 1 H and 13 C chemical shift ( Figure 13 ,14,17 and 18), and found that both 13 The C signal is exactly the same, 1 There is a certain difference in H signal, indicating that the two compounds have the same C skeleton but different H environments. Figure 15 and Figure 22 ), because the double bond restricts the free rotation of the different groups on either side, cis-trans isomerism occurs, making compounds E3-15 min and E3-20 min cis-trans isomers of each other. In the cis-form of E3-15min, the H at position 3 and H at position 5 are relatively close in space, and both respond in the NOESY spectrum. However, the trans-form of E3-20min lacks this signal. After identification, the molecular structure of component E3-15min is shown in Formula (I), and the molecular structure of component E3-20min is shown in Formula (II).

[0127] 2. MTT test

[0128] (1) Preparation of test sample gradient solution

[0129] Prepare 200 mg / mL drug stock solution with DMSO from the aqueous phase fraction (concentrated and dried product of the aqueous phase solution), ethyl acetate phase fraction, n-butanol fraction, fractions A to G, fractions E1 to E5, or fractions G1 to 5. Dilute the stock solution with complete culture medium to a gradient solution of 100 mg / mL, 10 mg / mL, 1 mg / mL, 100 g / mL, and 10 g / mL of the test sample.

[0130] (2) Safety concentration test

[0131] AML-12 cells (SNL-242, Shann Bio) were incubated in a 5% CO2, 37°C incubator and passaged when the cell confluence reached 80%. Trypsin was added for digestion and the cells were resuspended to control the cell density to 1×10 5, cells were seeded into 96-well flat-bottom plates, and 10 μL of cell suspension and 100 μL of complete culture medium were added to each well. After the cells adhered, the culture medium in the 96-well flat-bottom plate was discarded, and the test sample gradient solution was added, 100 μL per well, with 5 replicate wells for each drug concentration. Cultured at 5% CO2 and 37°C for 24 hours and observed under an inverted microscope; after 24 hours, the drug-containing culture medium was discarded, and 100 μL of complete culture medium and 20 μL of MTT solution (5 mg / mL, i.e. 0.5% MTT) were added to each well and cultured for another 4 hours; after 4 hours, the culture was terminated and the culture medium in the well was carefully aspirated; 150 μL of dimethyl sulfoxide was added to each well, and the well was shaken at low speed for 10 minutes to fully dissolve the crystals. The absorbance of each well was measured at 490 nm using an enzyme-linked immunosorbent assay (ELISA) reader.

[0132] (3) Results

[0133] like Figure 3 As shown in A, the concentration of n-butanol component within 1 mg / mL and the concentration of ethyl acetate component within 100 g / mL had no obvious toxic effect on AML-12 cells.

[0134] like Figure 5 As shown in A to H, when the concentrations of components A, B, E, F, and H were <1 mg / mL and the concentrations of components C, D, and G were <10 mg / mL, there was no significant toxic effect on AML-12 cells (*p<0.05, **p<0.01, ***p<0.001).

[0135] like Figure 5 As shown in Tables I, D, E, F and G, except for component A, the other components have an ameliorative effect on APAP-induced cell death (*p<0.05, **p<0.01). Components in Tables D, E, F and G may also have a certain effect of promoting cell proliferation (*p<0.05, **p<0.01).

[0136] 3. Cellular ALT test

[0137] (1) Preparation of test solution

[0138] Preparation of acetaminophen (APAP) solution: Accurately weigh 0.4548 g of APAP and dissolve thoroughly in 30 mL of PBS. Filter through a 0.22 µm sterilizing filter to obtain a 100 mM APAP stock solution. Dilute the 100 mM APAP stock solution 10-fold with complete culture medium to prepare a 10 mM APAP test solution. For other test products, refer to the MTT assay procedure.

[0139] (2) Group test

[0140] AML-12 cells were divided into blank, model, and test groups. In the model and test groups, AML-12 cells were seeded in 96-well plates and incubated with 100 μL / well of complete medium, 10 mM APAP test solution, or 10 mM APAP working solution containing the extract, respectively. The cells were incubated at 37°C with 5% CO₂ for 24 hours. The test group followed the same procedure, using the test solutions of the aforementioned different compositions. The blank group received no treatment.

[0141] (3) ALT detection in cell supernatant

[0142] Centrifuge at 1000 rpm for 10 min, collect 20 μL of the supernatant of the cell culture fluid from each group, add 20 μL of LAT matrix solution (5 μL was added to the blank group), mix well, and react in a 37°C incubator for 30 min; add an equal volume of 2,4-dinitrotoluenehydrazine solution, add 5 μL of the test sample to the blank group, mix well, and react in a 37°C incubator for 20 min; add 200 μL of 0.4 mol / L sodium hydroxide solution, gently shake the 96-well plate, and let it stand at room temperature for 15 min. The absorbance of each well was measured at a wavelength of 510 nm using a full-wavelength microplate reader.

[0143] (4) Results

[0144] like Figure 3 As shown in Figures C and 3E, APAP induced cell death in AML-12 cells compared with the blank group (p<0.01), but the ethyl acetate fraction could reduce the cell death induced by APAP. Figure 3 As shown in Figures D and 3F, compared with the blank group, APAP caused an increase in ALT levels in the cell supernatant (p<0.05), but the ethyl acetate fraction was able to reduce the increase in ALT caused by APAP. Figure 3 As shown in Figures C and 3E, the test solution provided by the test group was able to reduce APAP-induced cell death (p<0.05) and the increase in ALT levels (p<0.05).

[0145] like Figure 6 As shown in the results, compared with the APAP model group, E and G components at safe concentrations could significantly reduce the ALT level in the cell supernatant of AML-12 cells after APAP treatment (p<0.05). The results indicate that E and G components may have the effect of improving ALI.

[0146] like Figure 8 B, AML-12 cells were treated with APAP, and the cell death rates of the model group and the drug-treated group were compared by MTT assay. The results showed that E1-E3 had a certain improvement effect on the cell death induced by APAP (*p<0.05, ***p<0.05, **p<0.01). Figure 8C, Cell supernatants were collected 12 hours after APAP treatment, and the biochemical indicator ALT was used to reflect the level of cell damage. The results showed that E1-E3 significantly reduced ALT levels in the cell supernatants after APAP treatment (**p<0.01, ***p<0.001). These results suggest that E1, E2, and E3 components may have a protective effect against APAP- and OA / PA-induced damage in AML-12 cells.

[0147] like Figure 8 As shown in Figures D and 8E, compared with the APAP model group, the isolated G1, G3, and G4 fractions all showed a significant decrease in the ALT level in the cell supernatant, which had a protective effect on APAP-induced AML-12 cell damage, and the G4 fraction may have a certain pro-proliferation effect on cells.

[0148] like Figure 9 A, compared with the model group, the compounds with peak time of 15-20min can significantly reduce the cell death rate (p<0.05). Figure 9 As shown in B, after 15-20 min of compound treatment, ALT levels were significantly lower than those in the model group ( Figure 9 B, p<0.05).

[0149] like Figure 10 A, Compared with the APAP model group, treatment with E3-15min significantly reduced cell death (p < 0.05), but E-23min had a modest improvement. Therefore, E3-23min is not the primary active substance.

[0150] like Figure 10 B, Compared with the model group, the ALT level in the supernatant of cells treated with E3-15 min compound was significantly decreased (p<0.05).

[0151] This indicates that compounds E3-15min and E3-20min can improve the increase in ALT levels induced by APAP.

[0152] 4. Cellular level TG test

[0153] (1) Preparation of test solution

[0154] Preparation of OA drug (Oleic acid): 0.1mol / L sodium hydroxide solution: Dissolve 0.12μL of sodium hydroxide in 30ml of ultrapure water to make a 0.1mol / L sodium hydroxide solution. 20mM OA solution: Mix 76.17μL of OA and 12ml of (0.1mol / L) sodium hydroxide solution, saponify in a water bath at 75℃ overnight until clear and transparent. 20% BSA solution: Add 2.6g of BSA solution to 13ml of PBS, shake in a 55℃ air bath for 30min, until it turns brown and clear. Preparation of 10mM OA solution: Add 12ml of 20mM OA solution to 12ml of 20% BSA solution, shake in a 55℃ air bath for 30min, filter while hot, and store at 4℃.

[0155] Preparation of PA (Palmitic acid): 20mM PA solution: Add 0.031g PA to 6ml (0.1mol / L) sodium hydroxide solution and saponify overnight in a 75°C waterbath until clear and transparent. 5mM PA preparation: Add 6ml of 20mM PA solution to 18ml of 20% BSA solution, shake at 55°C in an air bath for 30min, filter while hot, and store at 4°C for 1 month.

[0156] Preparation of OA / PA working solution: Prepare OA / PA drug by taking 3.75 ml of 10 mM OA + 3.75 ml of 5 mM PA + 142.5 ml of complete culture medium.

[0157] (2) Group test

[0158] OA / PA working solution was used to treat AML-12 cell lines to simulate the hyperlipidemia in vivo: the drug safety concentration was determined, and the corresponding concentration of drug was prepared using OA / PA working solution as solvent. AML-12 cells were seeded in 6-well plates, and 100 μL / well of complete culture medium, OA / PA working solution, and OA / PA working solution of each component of Malan root extract were added respectively. The cells were cultured at 37°C with 5% CO2 for 24 h and divided into blank group, model group, and test group. (3) The TG content of each cell precipitate was measured.

[0159] Collect the cell culture pellet from each group by centrifugation at 1000 rpm for 10 minutes, wash once or twice with isotonic buffer (e.g., 0.1 mol / L, pH 7-7.4 phosphate buffer), centrifuge at 1000 rpm for 10 minutes, discard the supernatant, and retain the cell pellet. Add 0.2-0.3 mL of homogenization medium (e.g., 0.1 mol / L, pH 7-74 phosphate buffer or normal saline) and ultrasonically disrupt the cells in an ice-water bath (power: 300 W for 3-5 seconds / beat, 30 seconds apart, repeat 3-5 times) or manually homogenize. The prepared homogenate is then assayed directly without centrifugation. Mix thoroughly by shaking the plate, incubate at 37°C for 10 minutes, and measure the absorbance of each group at a wavelength of 500 nm using a microplate reader. The protein concentration of each group is then determined using the BCA assay.

[0160] (4) Results

[0161] AML-12 cells were treated with OA / PA working solution for 12 hours to simulate the high-lipid environment in vivo, and the above-mentioned test solution was used for intervention.

[0162] like Figure 4 As shown in the results, compared with the blank group, the OA / PA group significantly increased the intracellular TG level. Compared with the model group, the ethyl acetate phase solution of the test group significantly reduced the increase in cellular TG level induced by OA / PA.

[0163] like Figure 7 As shown in the results, in AML-12 cells, compared with the OA / PA group, the E and G components at a safe concentration could significantly reduce the increase in ALT levels caused by OA / PA. The results indicate that the E and G components can improve both the acute liver injury caused by APAP and the fatty liver injury caused by OA / PA.

[0164] like Figure 8 F. Meanwhile, AML-12 cells were treated with OA / PA, and the TG assay measured intracellular TG levels. The results showed that E1-E3 all had a certain improvement effect on the increase in cellular TG levels caused by OA / PA. These results suggest that E1, E2, and E3 components may have a protective effect against AML-12 cell damage caused by APA P and OA / PA.

[0165] like Figure 9 C, The three components were tested to improve the TG level under OA / PA stimulation, and it was found that the 15-20 min component had an improving effect on TG (p<0.05).

[0166] like Figure 11 A, Compared with the OA / PA model group, the cellular TG level was significantly decreased after treatment with E3-15min and E3-20min compounds, but the E-23min compound could not improve the TG level.

[0167] like Figure 11 B and Figure 11 C, Compared with the model group, the E3-15min compound can significantly reduce the expression of PPARy and FABP1. Therefore, the E3-15min compound can improve the increase of TG levels induced by OA / PA and reduce the expression of lipid synthesis genes.

[0168] This indicates that both the E3-15min fraction and the E3-20min fraction have an ameliorative effect on APAP- and OA / PA-induced liver injury.

[0169] 5. RT-PCR

[0170] AML-12 cells with APAP and OA / PA-induced liver damage were collected, and total RNA was extracted using the Trizol method. DNA was removed using DNAEraser and transcribed into cDNA. The transcription system consisted of 10 μL RNA, 4 μL 5× primerscript buffer 2, 4 μL RNase Free ddH2O, 1 μL primerscript RT Enzyme mixⅠ, and reaction at 37°C for 15 minutes, then at 85°C for 5 seconds, and stored at -20°C. The obtained cDNA was subjected to fluorescent quantitative PCR. The PCR reaction system included 5 μL TB green, 5 μL upstream primer of the gene to be tested, 0.2 μL downstream primer, 1 μL ROX Reference Dye (50×), 3.4 μL ddH2O, and 1 μL cDNA. The reaction was carried out in a real-time quantitative PCR instrument at 95°C for 10 seconds, then at 95°C for 10 seconds, and at 60°C for 30 seconds, for 40 cycles. GAPDH was used as an internal reference, and 2 -ΔΔCt The relative expression levels of Pcna, Ki-67, IL-6, TNF-α, PPARy, and Fabp1 mRNA were determined. The primers used are shown in the table below.

[0171] Gene Upstream primer Downstream primer Pcna tttgaggcacgcctgatcc,SEQ ID NO:1 ggagacgtgagacgagtccat, SEQ ID NO:2 Ki-67 atcattgaccgctcctttaggt,SEQ ID NO:3 gctcgccttgatggttcct, SEQ ID NO:4 IL-6 ctccaagccaaagtccttagag, SEQ ID NO:5 aggagctgtcattagggacatc, SEQ ID NO:6 TNF-α agaagggagtttcaaacctggt, SEQ ID NO:7 gtcttgctcatgtgtgtaagtga, SEQ ID NO:8 PPARy cacagactcggcactcaat,SEQ ID NO:9 tagaacctgcatctccacc, SEQ ID NO:10 Fabp-1 atgaacttctccggcaagtacc,SEQ ID NO:11 ctgacacccccttgatgtcc,SEQ ID NO:12 GAPDH aactttggcattgtggaagg, SEQ ID NO:13 ggatgcagggatgatgttct, SEQ ID NO:14

[0172] like Figure 10 C and Figure 10 D, The levels of cell proliferation genes Ki67 and Pcna increased. The above results indicate that the E3-15 min fraction not only has anti-inflammatory effects, but also reduces APAP-induced AML-12 cell death and promotes cell proliferation.

[0173] like Figure 10 As shown in E and F, the expression levels of intracellular inflammatory genes Il-1β and Tnf-α were detected. Compared with the model group, the E3-15 min component could significantly reduce the expression levels of the above two inflammatory genes (p<0.05).

[0174] The above is only a preferred specific implementation method of the present application, but the scope of protection of the present application is not limited thereto. Any changes or replacements that can be easily thought of by any technician familiar with this technical field within the technical scope disclosed in this application should be covered by the scope of protection of the present application.

Claims

1. Compound represented by formula (I):

2. Compound represented by formula (II):

3. An optical isomer, labeled compound, pharmaceutically acceptable salt or tautomer of the compound according to claim 1 or 2.

4. An inflammatory factor inhibitor comprising the compound according to claim 1 or 2, or the pharmaceutically acceptable salt according to claim 3.

5. A lipid synthesis gene inhibitor, comprising the compound according to claim 1 or 2, or the pharmaceutically acceptable salt according to claim 3. 6 . An agent for promoting expression of the cell proliferation gene Ki67, comprising the compound according to claim 1 or 2, or the pharmaceutically acceptable salt according to claim 3 .

7. A composition comprising the compound according to claim 1 or 2, or the optical isomer, labeled compound, pharmaceutically acceptable salt or tautomer according to claim 3, and a pharmaceutically acceptable excipient.

8. The compound according to any one of claims 1 to 2, or the optical isomer, labeled compound, pharmaceutically acceptable salt or tautomer according to claim 3, or the composition according to claim 7 for use in a medicament.

9. Use of the compound of claim 1 or 2, or the optical isomer, labeled compound, pharmaceutically acceptable salt or tautomer of claim 3, or the composition of claim 7 for the preparation of a medicament for treating or preventing a disease, disorder or condition selected from: (i) Acute liver injury; (ii) viral liver damage; (iii) alcoholic liver damage; (iv) Fatty liver damage.

10. A method for preparing the compound according to claim 1 or 2, comprising: Obtaining crude extract of Malan root; as well as The crude extract of Malanthes root is subjected to at least one of the following operation steps: extraction, C18 column chromatography, gel chromatography or HPLC preparative chromatography.

Citation Information

Patent Citations

  • Compound for ischemia reperfusion injury and preparation method thereof

    CN109694395A

  • Application of coffee bean alcohol in preparation of medicine for preventing and treating acute lung injury

    CN114948928A