Application of ADSC exosome in regulation and control of IL33 secretion

Abstract

The invention provides an application of an ADSC exosome in regulation and control of IL33 secretion, the exosome of adipose-derived mesenchymal stem cells can regulate and control a polarization process by promoting the IL33 secretion in macrophages, so that inflammatory factors are inhibited, epidermal proliferation and epithelization are promoted, and skin wound healing is promoted. The invention provides a research tool and reference for researching the mechanism of ADSC-Exos for regulating the participation of inflammatory cells in the wound healing process.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to the application of ADSC exosomes in regulating IL33 secretion. Background Art

[0002] The microscopic changes of local wounds are inseparable from the immune microenvironment in which inflammatory cells participate. Innate immunity is crucial in the initiation and effector stages of specific immunity. Due to its plasticity, macrophages are one of the effector cells of innate immunity and play a key regulatory role in the healing of tissue damage. After tissue damage, macrophages are activated by necrotic tissue cells to recruit neutrophils, mast cells and other inflammatory cells. Under the influence of chemokines, neutrophils rapidly migrate to the wound, where they produce antimicrobial substances and secrete cytokines. The secretion of various cytokines further promotes specific immunity, gradually involving T cells, B cells and other immune cells. Initially, macrophages amplify the effects of the inflammatory response. In the later stages of the inflammatory response, macrophages promote the resolution of wound inflammation, tissue remodeling and angiogenesis by producing anti-inflammatory factors IL-10, IL-33 and growth factors such as TGF-β, VEGF and EGF, which promote collagen deposition, angiogenesis and re-epithelialization processes.

[0003] Mesenchymal stem cells (MSCs) are widely used to repair skin damage due to their powerful functions such as anti-inflammatory, angiogenesis and cell proliferation. At the same time, their shortcomings and limitations are also obvious. Mesenchymal stem cells from different sources are heterogeneous, and their isolation and expansion are variable. There is currently a lack of a standardized method to isolate, expand and characterize mesenchymal stem cells, and their safety and effectiveness remain to be verified.

[0004] Exosomes (Exos) refer to small membrane vesicles (30-150nm) containing complex RNA and proteins. Nowadays, they specifically refer to discoid vesicles with a diameter of 40-100nm. They are mainly derived from multivesicular bodies formed by the invagination of intracellular lysosomal particles, and are released into the extracellular matrix after the fusion of the multivesicular outer membrane with the cell membrane. In recent years, it has been found that exosomes, as specifically secreted membrane vesicles, participate in intercellular communication. As natural and stable nano-scale vesicles, they can penetrate biological barriers, protect their contents from degradation, and be efficiently taken up by receptor cells. They can be used as carriers of genes and drugs to participate in disease treatment. Many studies have investigated the role of exosomes in wound healing, focusing on the relationship between mesenchymal stem cell exosomes and epidermal collagen aggregation and angiogenesis. However, little is known about how mesenchymal stem cell exosomes affect wound healing by regulating inflammatory cells. Summary of the invention

[0005] In order to make up for the deficiencies of the prior art, the object of the present invention is to provide a product for regulating the secretion of IL33 by macrophages and its application.

[0006] In order to achieve the above object, the present invention adopts the following technical solution: A first aspect of the present invention provides a product for regulating macrophage IL33 secretion, wherein the product comprises exosomes.

[0007] In one embodiment of the present invention, exosomes are vesicular vesicles secreted by living cells, present in the body fluids of almost all eukaryotic organisms, and are endoplasmic reticulum with a diameter of about 30-100 nm, larger than low-density lipoprotein (LDL) protein, but much smaller than red blood cells. Exosomes can be derived from any cell type in vivo, in vitro and in vitro, including but not limited to primary cells, cell lines, cells present in multicellular organisms, or substantially any other type of cell source. The term should also be understood to refer to exosome mimics, cell membrane-based vesicles obtained by, for example, membrane extrusion, ultrasonic treatment or other techniques, and their contents. It is obvious to those skilled in the art that when describing the medical and scientific uses and applications of exosomes, the present invention generally relates to a plurality of exosomes, that is, exosome populations that can contain thousands, millions, billions or even trillions of exosomes. It is known that exosomes can be released from cells when multivesicular bodies fuse with cell membranes, or directly from cell membranes, and they play important specialized functions, such as coagulation and intercellular signaling.

[0008] In one embodiment of the present invention, the exosomes may be exosomes from any source.

[0009] Furthermore, the exosomes are stem cell-derived exosomes.

[0010] Stem cells, as an undifferentiated cell, refer to cells that have the ability to self-replicate and differentiate into two or more different types of cells. Stem cells can be stem cells from autologous or homologous tissues, can be derived from any type of animal including humans and non-human mammals, can be stem cells derived from adults, or can be stem cells derived from embryos. For example, stem cells can be selected from embryonic stem cells, adult stem cells, induced pluripotent stem cells (iPSCs), mesenchymal stem cells, BxC stem cells, BxC A1 stem cells, BxC I10 stem cells, BxC G63 stem cells, BxC R11 stem cells, and BxC R56 stem cells.

[0011] Furthermore, the exosomes are exosomes derived from mesenchymal stem cells.

[0012] The term "mesenchymal stem cells (MSC)" used in the present invention refers to multipotent stem cells that can differentiate into a variety of mesenchymal cells including bone, cartilage, fat, and muscle cells. Mesenchymal stem cells have the ability to migrate directly to the site of body damage to regenerate damaged tissues and cells, can easily proliferate in vitro, and as multi-differentiated cells that can differentiate into a variety of cell forms, are used as effective targets in gene therapy and cell therapy. The above-mentioned mesenchymal stem cells can be derived from umbilical cord, umbilical cord blood, bone marrow, fat, muscle, nerve, skin, amnion, chorion, decidua or placenta.

[0013] Furthermore, the mesenchymal stem cells are mesenchymal stem cells derived from adipose tissue.

[0014] Furthermore, the particle size of the exosomes ranges from 50 to 150 nm.

[0015] Furthermore, the adipose-derived mesenchymal stem cell-related markers CD73, CD90 and CD105 of the exosomes were positive, and CD14, CD34 and CD45 were negative.

[0016] Furthermore, the exosome-specific protein markers CD63, CD9 and TSG101 were positive.

[0017] Furthermore, the macrophages include mouse macrophages and human macrophages.

[0018] Furthermore, the human macrophages are primary macrophages.

[0019] Furthermore, the human primary macrophages include macrophages derived from peripheral blood.

[0020] Furthermore, the mouse-derived macrophages include immortalized macrophages and primary macrophages.

[0021] Furthermore, the mouse-derived immortalized macrophages include THP-1 cell line and RAW264.7 cell line.

[0022] Furthermore, the mouse primary macrophages include macrophages derived from pluripotent stem cells, macrophages derived from peripheral blood, macrophages derived from bone marrow, macrophages derived from peritoneal cavity, and macrophages derived from tumors.

[0023] Furthermore, the macrophages are RAW264.7 cell line.

[0024] Furthermore, the products include pharmaceutical compositions, drug delivery systems, kits, and medical products.

[0025] Furthermore, the pharmaceutical composition also includes pharmaceutically acceptable excipients.

[0026] In the present invention, the term "pharmaceutical composition" refers to a composition comprising at least one biologically active compound. The pharmaceutical composition of the present invention can be administered orally, parenterally, by inhalation spray, topically, rectally, nasally, buccally, vaginally, or by implanted drug storage devices. In some embodiments, it is preferably administered by injection. The pharmaceutical composition of the present invention may contain any commonly used non-toxic pharmaceutically acceptable carrier, adjuvant or vehicle. In some cases, a pharmaceutical acid, base or buffer may be used to adjust the pH of the formulation to improve the stability of the formulated compound or its dosage form. The term parenteral as used herein includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intraarterial, intrasynovial, intrasternal, intrathecal, intralesional, and intracranial injection or infusion techniques. As long as the target tissue can be reached, the pharmaceutical composition of the present invention may be administered to the receptor by any route.

[0027] In the present invention, the term "drug delivery system" refers to the use of exosomes as drug carriers for drug delivery. The exosomes are preferably ADSC exosomes. As a potential drug delivery system, exosomes are similar to liposomes, with a unique double lipid membrane that wraps a hydrophilic core, which can be loaded with hydrophilic and lipophilic materials; secondly, because exosomes have different lipids, surface proteins, receptors, etc., exosomes have better tissue and cell targeting; furthermore, exosomes are produced by cells themselves, have good biocompatibility, low immunogenicity and low toxicity, and can prevent exogenous proteins, nucleic acids and other drugs from entering the body and being recognized and eliminated by the immune system.

[0028] In some embodiments, the product of the present invention can load drugs that can regulate IL33 secretion or regulate macrophage polarization in ADSC exosomes. The types of drugs loaded by exosomes include small molecule drugs, nucleic acids and proteins. The methods of loading drugs into exosomes include exogenous drug loading, endogenous drug loading and transgenic.

[0029] Furthermore, the kit also includes instructions for explaining the usage.

[0030] In the present invention, the term "medical product" refers to a medical product whose efficacy includes promoting IL33 secretion, promoting macrophage M2 polarization, promoting collagen formation, promoting angiogenesis, promoting keratinocyte proliferation and other effects related to promoting wound healing, and can be used alone or in combination with other products that promote wound healing. As long as the target tissue can be reached, the medical product of the present invention can be administered to the receptor by any route. Its preparation type can be lyophilized powder, solution, emulsion, cream, gel or dressing.

[0031] The second aspect of the present invention provides the application of the product and / or exosomes described in the first aspect of the present invention, and the application includes any one of the following: 1) application in promoting wound healing; 2) application in promoting collagen formation; 3) application in promoting angiogenesis; 4) application in promoting macrophage polarization; 5) application in inhibiting the release of inflammatory factors; 6) application in promoting keratinocyte proliferation.

[0032] The exosomes are exosomes derived from mesenchymal stem cells.

[0033] Furthermore, the mesenchymal stem cells are mesenchymal stem cells derived from adipose tissue.

[0034] Furthermore, the particle size of the exosomes ranges from 50 to 150 nm.

[0035] The adipose-derived mesenchymal stem cell-related markers CD73, CD90 and CD105 of the exosomes were positive, and CD14, CD34 and CD45 were negative.

[0036] The exosome-specific protein markers CD63, CD9 and TSG101 were positive.

[0037] In the present invention, wound healing refers to a natural physiological process, which is essentially an inherent defensive adaptive response of the body to tissue cell damage caused by various harmful factors. The healing response includes: 1) regeneration of original tissue cells, and / or 2) non-specific connective tissue hyperplasia replacing original tissue cells. In some embodiments, wound healing refers to a reduction in wound area, and promoting wound healing means that the time for the wound area to be reduced is shorter than the healing time originally required.

[0038] Furthermore, the wound is an acute wound.

[0039] In the present invention, acute wounds refer to wounds that are formed suddenly and heal quickly. Such wounds usually heal in the first stage, such as elective surgical incisions, second-degree burns and scald wounds, superficial skin trauma, acute first-degree radiation damage to the skin, second-degree pressure sores, etc., which usually have no underlying cause, a short healing time, a normal inflammatory response, and may have an overreaction. They are wounds that are opposite to chronic wounds.

[0040] Macrophages are central innate multifunctional immune cells that play different roles in different stages of wound healing. Macrophages can be induced to polarize into pro-inflammatory (M1) in the wound surface, producing important pro-inflammatory factors such as TNF-α and IL-6, or anti-inflammatory (M2), producing anti-inflammatory factors such as TGF-β and IL-4.

[0041] Furthermore, the promoting macrophage polarization is promoting macrophage M2 polarization.

[0042] Furthermore, the promotion of macrophage M2 polarization refers to causing the expression of one or more of the characteristic genes TGF-β, YM1, ARG-1 and IL-10.

[0043] Furthermore, the inhibition of the release of inflammatory factors is the inhibition of the release of inflammatory factors from macrophages.

[0044] Furthermore, the inhibition of the release of inflammatory factors is to inhibit the expression of one or more of IL-6, TNF-α, iNOS and CXCL10.

[0045] Furthermore, the keratinocytes include human epidermal keratinocytes and mammalian epidermal keratinocytes.

[0046] Furthermore, the mammalian epidermal keratinocytes include mouse epidermal keratinocytes, rat epidermal keratinocytes, and rabbit epidermal keratinocytes.

[0047] The third aspect of the present invention provides a method for promoting macrophage IL33 secretion, the method comprising administering exosomes or the product according to the first aspect of the present invention to a subject.

[0048] The exosomes are exosomes derived from mesenchymal stem cells.

[0049] Furthermore, the mesenchymal stem cells are mesenchymal stem cells derived from adipose tissue.

[0050] Furthermore, the particle size of the exosomes ranges from 50 to 150 nm.

[0051] The adipose-derived mesenchymal stem cell-related markers CD73, CD90 and CD105 of the exosomes were positive, and CD14, CD34 and CD45 were negative.

[0052] The exosome-specific protein markers CD63, CD9 and TSG101 were positive.

[0053] Furthermore, the subject includes cells, tissues, organs, organ systems, mammals or humans.

[0054] In the present invention, the term "subject" includes any individual of interest, preferably a mammal. Mammals include, but are not limited to, domestic animals (e.g., cattle, sheep, cats, dogs and horses), primates (e.g., humans and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats).

[0055] Furthermore, the mammal includes pigs, dogs, cats, mice, rats or rabbits.

[0056] Furthermore, the cells include primary or immortalized cells or cell lines.

[0057] In the present invention, the term "primary" refers to cells grown in a culture dish after animal tissue is digested and dispersed by trypsin or the like to obtain single cells, which retain the basic properties of the original cells and, if normal, still retain the diploid number. Cultured cells from the first to the tenth generation are generally referred to as primary cell cultures. Commonly used primary cell cultures include tissue block culture and dispersed cell culture.

[0058] In the present invention, the term "immortalization" refers to the property of cells that have the ability to continue to grow and proliferate. Immortalized cells have unlimited growth and can be passaged for a long time, and are often accompanied by karyotype changes. Immortalized cell lines have great research significance in the fields of studying the growth and development mechanism of organisms, regulating life activities, and diagnosing and treating diseases. In the context of the present invention, immortalization includes commercial immortalized cells and immortalized cells cultured by self-induction.

[0059] The fourth aspect of the present invention provides a method for promoting acute wound healing, the method comprising administering exosomes or the product according to the first aspect of the present invention to a subject.

[0060] The exosomes are exosomes derived from mesenchymal stem cells.

[0061] Furthermore, the mesenchymal stem cells are mesenchymal stem cells derived from adipose tissue.

[0062] Furthermore, the particle size of the exosomes ranges from 50 to 150 nm.

[0063] The adipose-derived mesenchymal stem cell-related markers CD73, CD90 and CD105 of the exosomes were positive, and CD14, CD34 and CD45 were negative.

[0064] The exosome-specific protein markers CD63, CD9 and TSG101 were positive.

[0065] Advantages and beneficial effects of the present invention: The present invention proves that ADSC exosomes can affect the function of macrophages and regulate the expression of inflammatory factors by promoting IL33 expression. IL33 plays a key role in epidermal proliferation and epithelialization, and the present invention provides products containing ADSC exosomes and can be used to regulate IL33 secretion and their applications, which provides a reference for studying the mechanism of ADSC-Exos regulating inflammatory cells to participate in the wound healing process. BRIEF DESCRIPTION OF THE DRAWINGS

[0066] Figure 1Figure 2 is a diagram of the separation and characterization of ADSCs and exosomes, where a is a schematic diagram of the ADSCs extraction process, b is a diagram of the identification of ADSCs-related markers by flow cytometry, c is a diagram of the induction of ADSCs for adipogenic differentiation, osteogenic differentiation and chondrogenic differentiation, d is a schematic diagram of the ADSC-Exos extraction process, e is a diagram of the ADSC-Exos particle size detected by NTA, f is a diagram of the morphology of ADSC-Exos evaluated by projection electron microscopy, and g is a diagram of the expression of ADSC-Exos-specific protein markers verified by Western blotting.

[0067] Figure 2 The figures are the results of ADSC-Exos promoting wound healing, where a is a schematic diagram of the process of constructing a full skin defect wound model in mice, b is a diagram of the changes in the skin wounds on the back of mice observed on days 0, 3, 7, 10, and 14 after treatment, c is a statistical analysis of the wound area, d is a diagram of HE staining results on days 7 and 14 of treatment (I: control group; II: PBS; III: ADSC-CM; IV: ADSC-Exos), e is a diagram of Masson staining results on days 7 and 14 of treatment (I: control group; II: PBS; III: ADSC-CM; IV: ADSC-Exos), f is a diagram of the expression of related factors verified by Western Blotting, and g is a diagram of the expression of related factors verified by immunofluorescence staining.

[0068] Figure 3 Figure 2 is the effect of ADSC-Exos on macrophages, a is the expression of IL-6 and TNF-α in wound tissue verified by immunohistochemical staining on the 7th day, b is the statistical analysis of IL-6 expression, c is the statistical analysis of TNF-α expression, d is the effect of ADSC exons on the expression of IL-6, TNF-α, iNOS and CXCL10 under M1 polarization of RAW264.7 cells detected by qPCR, e is the effect of ADSC exons on the expression of TGF-β, YM1, ARG-1 and IL-10 encoding genes under M2 polarization in RAW264.7 cells determined by qRT-PCR, f is the immunofluorescence staining result of CD86 after 7 days, and g is the immunofluorescence staining result of CD206 in wound tissue on the 7th day.

[0069] Figure 4 The results of ADSC-Exos upregulating IL33 are shown in Figure 1, a is the principal component analysis (PCA) diagram, b is the DEGs volcano diagram, c is the downregulation GO function analysis enrichment diagram, d is the upregulation GO function analysis enrichment diagram, e is the expression diagram of IL-6, TNF-α and IL33 in RAW264.7 cells detected by QPCR, and f is the secretion result diagram of IL-6, TNF-α and IL33 in the conditioned medium of RAW264.7 cells detected by ELISA.

[0070] Figure 5 Figure 1 shows the delayed wound healing results of IL33 deficiency. a is IL33 - / - A full skin defect wound model was constructed in KO mice, and the results are shown in Figure 1. (b) The changes in the size of the skin wound on the back of mice on days 0, 3, 7, 10, and 14 after treatment. (c) The statistical analysis of the relative wound areas of the three groups. (d) The HE staining results of mice on days 7 and 14 after treatment (I: WT, II: Il33 - / - , III:Il33 - / - +r IL33), e is the Masson staining results of mice on the 7th and 14th days after treatment (I: WT, II: Il33 - / - , III:Il33 - / - +r IL33), f is Western blot used to verify the expression of α-SMA, type I collagen and type III collagen, g is the statistical analysis of Western blot results, h is the immunohistochemical staining results of iNOS in wound tissue on the 7th day, i is the immunohistochemical staining results of ARG-1 in wound tissue on the 7th day, j is the statistical analysis of iNOS, and k is the statistical analysis of ARG-1.

[0071] Figure 6 Figure 2 is the result of macrophages secreting IL33 to enhance the role of HaCat in wound healing, a is the result of ELISA detection of IL33 secretion in conditioned medium, b is the result of CCK-8 test confirming the proliferation of HaCat cells, c is the result of EDU staining verifying the role of IL33 in the proliferation of HaCat cells after 48 hours, d is the result of scratch method detection of HaCat cell wound healing rate, e is the statistical analysis of the scratch test results, f is the result of Transwell test confirming that IL33 deficiency inhibits the migration ability of HaCat cells, g is the statistical analysis of Transwell analysis results, h is the result of Transwell test confirming that IL33 recombinant protein promotes the migration ability of HaCat cells, and i is the statistical analysis of Transwell analysis results.

[0072] Figure 7: The figure shows that macrophages secrete IL33 to enhance the effect of HaCat in wound healing. a is an immunostaining diagram of type III collagen levels under the action of ADSC Exos. b is an immunostaining diagram of the effect of ADSC exos on α-SMA levels. c is an immunostaining diagram showing that IL33 significantly increased the level of type III collagen. d is an immunostaining diagram confirming that IL33 significantly increased the level of α-SMA. e is a diagram showing the expression of EGF, TGF-β, type III collagen and α-SMA detected by Western blot. f is a statistical analysis diagram of protein blotting data. g is a protein blotting of the wnt / β-catenin signaling pathway to verify the function of ADSC exos. h is a statistical analysis diagram of protein blotting data. i is a Western blotting of the wnt / β-catenin signaling pathway to verify the function of rIL33. j is a statistical analysis diagram of protein blotting data.

[0073] Figure 8 Schematic diagram of how ADSC-Exos promote wound healing by regulating the expression of IL33 in macrophages.

[0074] Fig. 9 This is the ADSC morphology observed under a microscope.

[0075] Fig.10 Screening of Il33 by agarose gel electrophoresis - / - Mouse results graph. DETAILED DESCRIPTION

[0076] The present invention will be further described in detail below in conjunction with the accompanying drawings and examples. The following examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples, unless otherwise specified, are conventional methods, and the materials and reagents used in the following examples, unless otherwise specified, are all obtained from commercial sources. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art and do not constitute a limitation of the present invention in any way. Simple improvements to the present invention made according to the essence of the present invention all fall within the scope of protection claimed in the present invention.

[0077] Example

[0078] 1. Experimental Methods 1. Cell extraction and culture: Human adipose mesenchymal stem cells (hADSCs) were extracted from adipose tissue of inpatients in the Department of Plastic and Reconstructive Surgery, the Fourth Medical Center of the General Hospital of the Chinese People's Liberation Army. Informed consent was signed and ethical review was passed. No spontaneous differentiation was observed during cell culture expansion. ADSCs were incubated in DMEM / F12, using a medium containing M-CSF. BMDM was extracted from the long bone marrow of mice through a 70μm cell strainer, the collected cell mixture was centrifuged at 2500rpm / min for 5 minutes, the cells were resuspended in bone marrow macrophage induction medium, and cultured in an incubator. RAW264.7 cell line and HaCat cell line (human immortalized keratinocytes) were purchased from the Cell Bank of the Chinese Academy of Sciences. The basal medium for cell culture was RPMI1640 and DMEM / F12, and all culture media consisted of 10% fetal bovine serum (FBS) and 1% penicillin and streptomycin. The cells were kept in an incubator at 37°C and 5% CO2. The culture medium was changed every 2-3 days. When the cells were 80% confluent, they were digested with trypsin (Bio-Channel, BC-CE-005, China) for passaging.

[0079] RAW264.7 cells were stimulated with 50 ng / mL LPS and 20 ng / mL IFN-γ for 24 h to induce M1 polarization; RAW264.7 cells were stimulated with 20 ng / mL IL-4 combined with 20 ng / mL IL-13 for 48 h to induce M2 polarization; RAW264.7 cells were seeded into 12-well plates and stimulated with LPS (500 ng / ml, 1 ml) for transcriptome sequencing analysis.

[0080] 2. Cell proliferation assay: 5×10 cells in logarithmic phase were cultured per well. 3 The cells were seeded into a 96-well plate at a density of 2 × 10 cells / well. After 48 hours, the culture medium was removed, CCK-8 reagent was added, and incubated at 37°C for 2 hours. The absorbance (OD) value of each well was measured at a wavelength of 450 nm. Each sample was replicated three times. In addition, cells were plated at 2 × 10 cells / well. 4 Cells were seeded into 24-well plates at a rate of 1 cell / well. EdU staining was performed according to the manufacturer's instructions (Beyotime, China).

[0081] 3. Immunofluorescence staining and imaging: The collected tissues were fixed with 10% formalin and embedded in paraffin. Then, the samples were washed and incubated with antibodies (anti-CD206 1:1000, #18704-1AP, Proteintech; anti-CD86 1:1000, #26903-1AP, Proteintech; anti-CD31 1:200, Cat.No.80530-1-RR, Proteintech; anti-VEGFA 1:200, Cat.No.19003-1AP, Proteintech) at 4°C overnight. After washing with PBS, the tissues were incubated with anti-rabbit IgG (H+L) F(ab')2 fragment (Alexa Fluor® 488 conjugate) (1:800, #4412s, Cell Signaling Technology) at 25°C for 3 hours and stained with 4,6-diamidino-2-phenylindole (DAPI) for 5 minutes. Coverslips were observed under a confocal microscope (Olympus).

[0082] 4. Cell migration assay: HaCat cells were seeded into 6-well plates. When the cells reached 90% confluence, a 200 μL micropipette tip was used to make wounds, and the old medium was replaced with serum-free medium. Wound photos were taken at 0, 24, and 48 hours after scratching. Then, the wound closure rate was measured by ImageJ software.

[0083] Transwell migration assay was used to evaluate the migration of HaCat cells. A total of 5 × 10 4 Cells / well were resuspended in 200 μL serum-free DMEM medium and seeded into the upper cell chamber of a transwell migration chamber (8 μm size, Corning, USA). In addition, 500 μL of DMEM / F12 medium containing 20% ​​FBS was placed into the bottom cell chamber as an attractant. After 24 hours, the migrating cells on the lower surface of the upper chamber were fixed and stained with 0.5% crystal violet. The number of migrating cells was counted by ImageJ software (National Institutes of Health, USA).

[0084] 5. Mouse skin wound model and treatment: A total of 60 C57BL / 6 mice (8 weeks, male) obtained from Spectro Biotech Co., Ltd. were anesthetized with sodium pentobarbital (50 mg / kg). After depilation and disinfection, a full-thickness skin wound was made in the middle of the back of the mouse using an 8 mm puncher (KaiMedical, Germany). Then, the 60 mice were randomly divided into 4 groups by the random function of SPSS software: control group, PBS group, ADSC-CM group, and ADSC-Exos group. Food and water were added to the mice at a fixed time to keep the living environment of each group of mice uniform. A single mouse was defined as an experimental unit. During treatment, the control group was not treated, and the other groups were injected with 25 μl of treatment medium at each of the 4 sites at the edge of the wound. The wound area was photographed and measured on days 0, 3, 7, 10, and 14 after treatment. On days 7 and 14 after modeling, the mice were killed by cervical dislocation, and the mouse tissues were collected for section staining. By Il33 - / - The full-thickness skin injury model was established using C57BL / 6 mice with a genetic background. The experimental mice were divided into Il33 - / - group, WT group and Il33 - / - Combined IL-33 recombinant protein treatment group: The feeding and modeling methods of mice were the same as those in the above experiment.

[0085] 6. Quantitative real-time PCR: Total RNA was extracted from cells by a total RNA isolation kit (Vazyme, Nanjing, China). cDNA was subsequently synthesized by a PrimeScript RT Master Mix Kit (MedChemExpress, Princeton, NJ, USA). qPCR was performed on a StepOnePlus™ Real-Time PCR System using ChamQ SYBR qPCR Master Mix (Vazyme, Nanjing, China). GAPDH was used as an endogenous control. −ΔΔCtDetermination of the specificity of mRNA splicing in mouse-Gapdh-F:CTCTCTGCTC CTCCCTGTTC;mouse-Gapdh-R:TCACACCGACCTTCACCATC;mouse Il6-F:CTGCAAGAGACTTCCATCCAG:mouse-Il6-R:AGTGGTATAGACAGGTCTGTTGG:mouse-Tnf-F:CAGGCGGTGCCTATGTCTC:mouse-Tnf -R:CGATCACCCCGAAGTTCAGTAG:mouse-Nos2-F:GTTCTCAGCCCAACAATACAAGA:mouse-Nos2-R:GTGGACGGGTCGATGTCAC:mouse-Cxcl 10-F:CCAAGTGCTGCCGTCATTTTC:mouse-Cxcl10-R:GGCTCGCAGGGATGATTTCAA:mouse-Chil3-F:CAGGTCTGGCAATTCTTCTGAA:mouse e-Chil3-R:GTCTTGCTCATGTGTGTAAGTGA:mouse-Arg1-F:CTCCAAGCCAAAGTCCTTAGAG;mouse-Arg1-R:GGAGCTGTCATTAGGGACATCA; mouse-Il10-F:CTTACTGACTGGCATGAGGATCA;mouse-Il10-R:GCAGCTCTAGGAGCATGTGG:mouse-Tgfb1-F:CCACCTGCAAGACCATCGAC;m ouse-Tgfb1-R:CTGGCGAGCCTTAGTTTGGAC;mouse-Il33-F:ATTTCCCCGGCAAAGTTCAG;mouse-Il33-R:AACGGAGTCTCATGCAGTAGANhum an-GAPDH-F:ACACCCACTCCTCCACCTTT:human-GAPDH-R:TAGCCAAATTCGTTGTCATACC:human-ACTA2-F:AAAAGACAGCTACGTGGGTGA human-ACTA2-R:GCCATGTTCTATCGGGTACTTC:human-COL3a1-F:GGAGCTGGCTACTTCTCGC:human-COL3a1-R:GGGAACATCCTCCTTCAACAG.

[0086] 7. Western blot: Western blot analysis was performed as described previously. Protein concentration was quantified by BCA protein quantification kit (Tiangen, Beijing, China). Protein extracts were subsequently separated by SDS gel electrophoresis and then transferred to PVDF membranes (Millipore, Boston, MA, USA). The membranes were then incubated with primary antibodies (anti-TGF-β Beyotime AF0297, anti-IGF-1 Beyotime AFP 7179, anti-type III collagen Beyotime AF 6531, anti-EGF Abcam ab184265, anti-IL33 Proteintech catalog number 28035-1AP, anti-E-Cadherin Cell Signaling Technology #4695, anti-α-SMA Cell Signaling Technology #19245) at 4 °C overnight. After washing three times with Tris-buffered saline containing Tween 20 (TBST), the membrane was incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (HRP-goat anti-rabbit IgG H&L, 1:10000, AS014; ABclonal; HRP-goat anti-mouse IgG H&L) for 1 h at room temperature. The membrane was washed again with TBST. Finally, the protein bands were developed using an enhanced chemiluminescence (ECL) Western blotting substrate reaction kit (Solarbio, Beijing, China) and detected by an automated chemiluminescence imaging system (Tanon, China).

[0087] 8. Enzyme-linked immunosorbent assay: To evaluate the levels of inflammatory cytokines, the supernatant was obtained after cell modeling and centrifuged at 1000 × g for 5 min at 4 °C. IL-6, TNF-α, and IL33 levels in the supernatant were determined using ELISA kits (EK0411, EK0930, boster, China; SEKM-0034, solarbio, China). The absorbance was measured at 450 nm according to the instructions.

[0088] 9. RNA sequencing analysis: RNA sequencing analysis was performed in RAW264.7 cells. The control group and ADSC-Exo group were undergoing LPS stimulation. Total RNA was lysed with Trizol reagent and extracted with RNeasy Mini Kit (QIAGEN, Düsseldorf, Germany). RNA sequencing analysis was performed on a BGISEQ-500 sequencer platform (Beijing, China), and qualified reads were mapped to the mouse reference genome. Normalization was performed, and RESM software was used. Significant differentially expressed genes (DEGs) between groups were defined as log2-fold change ≥ 2 and P value ≤ 0.05. KEGG and GO enrichment analysis was performed using the ClusterProfler R package.

[0089] 10. Histological examination: Mouse skin wound samples were fixed with 4% formalin solution and embedded in paraffin. Tissue sections were stained with hematoxylin and eosin (HE) and Masson's trichrome to detect wound remyelination and collagen deposition. Immunohistochemistry (IHC) was used to evaluate inflammatory cytokines and angiogenesis. Sections were incubated with antibodies (anti-IL-6 1:800, #6404-1AP, Proteintech, USA; anti-TNF-α1:800, #60291-1-Ig, Proteinteech, USA; anti-iNOS 1:200, ab178945, Abcam, USA; anti-ARG1 1:200, ab91279, Abcam, USA) and then incubated with peroxidase-conjugated secondary antibodies (Cell Signaling Technology, USA). Staining was observed by DAB Peroxidase Substrate Kit (Maxin, China). Digital images were observed under a SOPTOP CX40 microscope (Shanghai, China).

[0090] 11. Statistical analysis: One-way ANOVA and Student-Newman-Keuls post hoc test were used to assess statistical significance. GraphPad software was used for statistical analysis of mean ± SEM. p < 0.05 was considered statistically significant.

[0091] 2. Experimental Results 1. Isolation and identification of ADSCs and exosomes: First, ADSCs were extracted from adipose tissue by collagenase digestion ( Figure 1 a) and showed a typical spindle-shaped phenotype ( Fig. 9 According to the results of flow cytometry, ADSC surface markers CD73, CD90 and CD105 were positive, and CD14, CD34 and CD45 were negative ( Figure 1 b), indicating that ADSCs were successfully extracted and cultured. Alizarin red staining, Oil Red O staining, and Alcian blue staining respectively showed the osteogenic, adipogenic, and chondrogenic abilities of ADSCs after differentiation induction ( Figure 1 c). After ADSC-Exos were extracted by high-speed centrifugation ( Figure 1 d), Nanoparticle tracking analysis (NTA) was used to detect the full range of particle number and diameter distribution of ADSC-Exo ( Figure 1 e), the peak particle number is between 50 and 150 nm. Scanning electron microscopy showed that ADSC Exos were cup-shaped or spherical vesicles ( Figure 1 f). Western blot analysis showed that the expression of exosome-specific biomarkers CD63, CD9, and TSG101 in ADSC Exos was positive ( Figure 1g), indicating that exosomes were successfully extracted from ADSCs.

[0092] 2. ADSC-Exos improve wound healing in vivo: To evaluate the effect of ADSC-Exos on wound healing, a full-thickness skin wound model was established in C57BL / 6 mice. Figure 2 a is a schematic diagram of the modeling process. On days 7, 10, and 14, the wound healing of the ADSC-Exo group was significantly better than that of the other groups ( Figure 2 b). Compared with the control group and PBS group, the relative wound area reduction was greater in the adipose-derived mesenchymal stem cell conditioned medium (ADSC-CM) group and the ADSC-Exos group. The ADSC-Exos group was superior to the ADSC-CM group ( Figure 2 c). HE staining on day 7 showed that the cell density and epithelialization of granulation tissue in the ADSC-Exos group increased significantly, and this difference was more significant on day 14. ( Figure 2 d). In addition, more hair follicles and skin attachments were found in the ADSC-Exos group.

[0093] 3. ADSC-Exos improve wound healing by promoting collagen formation and angiogenesis: Masson staining showed that the degree of collagen deposition in wound tissues of ADSC-CM and ADSC-Exos was greater than that in control tissues, while the degree of collagen deposition in ADSC-Exo was greater ( Figure 2 e). Western blotting was used to verify the indicators related to wound healing in the tissues on day 14 ( Figure 2 f). Compared with other groups, the expression levels of TGF-β and E-Cadherin in the ADSC-Exos group were the highest. The expression of type I and type III collagen in the ADSC-Exos group was greater than that in the control group, PBS group, and ADSC-CM group ( Fig.10 A). These results suggest that ADSC-Exos may accelerate wound healing by promoting collagen formation and intercellular adhesion. In this study, immunofluorescence assays were performed on the mouse wound skin obtained from the in vivo experiment on day 14. The results showed that DAPI staining had no significant effect on the number of cells within the wound tissue, but the number of VEGF-A-positive cells was significantly higher in the ADSC-Exos group. In addition, the number of CD31 and α-SMA-positive cells in the exosome injection group (ADSC-Exos) was significantly higher than that in the other groups ( Figure 2 g). The above results indicate that exosomes derived from ADSCs accelerate the vascularization of wounded mouse skin.

[0094] 4. ADSC-Exos affect macrophage polarization and inflammatory factor release: Immunohistochemical staining revealed the effect of ADSCExos on inflammatory cytokines ( Figure 3a). Compared with the control group and PBS group, the expression of IL-6 in the ADSC-CM group and ADSC-Exos group was lower, and the expression of IL-6 in the ADSC-Exo group was lower than that in the ADSC-CM groups ( Figure 3 b). However, among the four groups, the ADSC-Exos group had the lowest expression of TNF-α ( Figure 3 c). These results indicate that ADSC-Exos have the best inhibitory effect on inflammation.

[0095] QPCR was used to determine the expression levels of characteristic genes in M1 and M2 macrophages. The results showed that ADSC-Exos inhibited the expression of IL-6, TNF-α, iNOS, and CXCL10 in macrophages, especially when they were combined with LPS and IFN-γ to induce macrophage M1 polarization ( Figure 3 d). On the other hand, when macrophages were polarized toward M2 type by stimulation with IL-4 and IL-13, ADSC-Exos increased the expression of TGF-β, YM1, ARG-1, and IL-10 compared with the unpolarized control group ( Figure 3 e). The above results further confirmed that ADSC-Exos inhibited the M1 polarization of RAW264.7 cells and enhanced the M2 polarization. The results of immunofluorescence staining of tissues collected on the 7th day showed that the expression of CD206 was the highest and the expression of CD86 was the lowest in the ADSC-Exo group ( Figure 3 f). In addition, the expression levels of the control group and the PBS group were similar, with CD86 having the highest expression level and CD206 having the lowest expression level ( Figure 3 g). These findings also suggest that ADSC-Exos treatment promotes polarization of macrophages toward the M2 phenotype in animal tissue wounds.

[0096] 5. ADSC-Exoss increases the expression level of IL33 in macrophages: The bidirectional expression profile of miRNA affected by ADSC Exos was analyzed by RNA-seq. Figure 4 As shown in a, the comparability between the two groups was analyzed by principal component analysis (PCA). Figure 4 As shown in b, the volcano plot showed that 411 miRNAs were downregulated and 988 miRNAs were upregulated. GO analysis showed that the regulation of inflammatory response, cell adhesion, metabolic process, and acute phase response was downregulated, while the regulation of binding, endocytosis, cellular response, and tissue remodeling was upregulated ( Figure 4 d). Double immunofluorescence staining was used to verify the expression of IL-33 in animal tissues. The results showed that the expression of IL-33 in the macrophage-positive area was significantly higher in the ADSC-Exo group than in other groups ( Figure 4e). The expression of IL33 and inflammatory factors was observed. qPCR detection showed that the expression of IL-6 and TNF-α was reduced. However, compared with the control group, the expression of IL33 in the ADSC-Exos group was significantly increased ( Figure 4 f). After modeling, the conditioned medium was collected and the secretion levels of IL33, IL-6 and TNF-α were detected by ELISA. The results showed that the levels of IL-6 and TNF-α secreted by macrophages in the ADSC-Exo group were lower, while the secretion of IL33 was significantly higher ( Figure 4 g). These findings indicate that ADSC-Exos have the ability to inhibit the secretion of IL-6 and TNF-α and promote the secretion of IL33 by RAW264.7 cells.

[0097] 6. IL33 deficiency slows down the wound healing process in C57BL / 6 mice: Based on the above results, ADSC-Exos can inhibit the levels of inflammatory cytokines and upregulate the expression of IL33, which may be a key molecule in promoting wound healing. To verify this hypothesis, IL33 was used - / - A complete skin defect model was established in mice ( Figure 5 a). Agarose gel electrophoresis results showed that Il33 - / - The IL33 gene expression was lost in mice (Figure 11). - / - The wound healing ability of mice in the +rIL33 group (rIL33 dose: 100 ng each) was better than that of mice in the Il33 group. - / - Group( Figure 5 b). Il33 - / - The wound area of ​​the Il33 group was significantly larger than that of the WT group. - / - The wound area of ​​the +rIL33 group was equal to that of the WT group ( Figure 5 c) H&E staining showed that the WT group and Il33 - / - The degree of skin wound re-epithelialization and stratum corneum coverage in the +rIL33 group were better than those in the Il33 group. - / - Group( Figure 5 d). In addition, with Il33 - / - Compared with WT and Il33 - / - More hair follicles and skin attachment were observed in the +rIL33 group. Masson staining showed that on day 14, the difference between WT and Il33 - / - The collagen deposition in the +rIL33 group was higher than that in the Il33 - / - Groups are more ordered ( Figure 5 e). Western blot showed that Il33 - / - The expression of α-SMA, type I and type III collagen in the group was much lower than that in WT and Il33 - / - +r IL33 group ( Figure 5 f). Il33- / - The protein expression of the group was close to that of the WT group ( Figure 5 g). IL33 deficiency suppressed the expression level of α-SMA and prevented the synthesis of type I and type III collagen. These results conclusively indicate that the absence of IL33 is detrimental to wound healing.

[0098] 7. The lack of IL33 affects macrophage polarization: In addition, the results of immunohistochemical staining on day 7 showed that the M1 macrophage marker iNOS in the IL33KO group increased compared with the WT group ( Figure 5 h), M2 marker Arg1 decreased ( Figure 5 i). However, similar to the WT group, Il33 - / - In the +rIL33 group, the expression of iNOS was decreased, the expression of Arg1 was increased, and the expression of Il33 - / - The opposite trend was observed in the Figure 5 j, k). IL33 has been shown to inhibit the polarization of M1 macrophages and promote their M2 phenotype.

[0099] 8.ADSC-Exos affect the proliferation and migration ability of HaCat cells by stimulating macrophages to release IL33: Extraction of IL33 - / - Primary macrophages (BMDM) from mice and WT mice were cultured with ADSC-Exos (1*10 10 / 12-well plate per well). The secretion of IL33 in the ADSC-Exo group was much higher than that in the control group ( Figure 6 a). Collect BMDM conditioned medium and co-culture with HaCat cells. We found that conditioned medium from IL33-deficient BMDM was not conducive to keratinocyte proliferation. ADSC-Exos were able to reverse the negative effect of macrophage IL33 deficiency on keratinocyte proliferation ( Figure 6 b). EdU staining at 48 hours showed that the - / - -MΦ_CM group compared with IL33 - / - -MΦ-Exo_CM group had a significant proliferation effect. However, IL33 - / - -MΦ-Exo_CM group did not improve proliferation as much as WT-MΦ-Exo-CM group ( Figure 6 c). The results showed that ADSC-Exos promoted macrophages to secrete IL33, which is essential for keratinocyte proliferation, and ADSC-Exos promoted the proliferation process through IL33.

[0100] The 48-hour scratch test results showed that - / - -MΦ_CM group compared with IL33 - / --MΦ-Exo_CM group migrated more toward the scratch area, but the migration amount was less than that of WT-MΦ-Exo-CM group ( Figure 6 d, e). Transwell assay confirmed that after 48 hours of culture, IL33 - / - -MΦ-Exo_CM group vs IL33 - / - -MΦ_CM group has more cells migrating from the upper chamber to the lower chamber ( Figure 6 f). The number of migrated cells in the WT-MΦ-Exo_CM group was greater than that in the IL33 - / - -MΦ-Exo_CM group ( Figure 6 g).

[0101] 9. IL33 promotes collagen formation in keratinocytes: Expression of α-SMA and type III collagen after co-culture with CM conditioned by HaCat cells was analyzed by immunostaining ( Figure 7 a, b). In the three groups, IL33 - / - -MΦ_CM group had the lowest expression levels of α-SMA and type III collagen, while IL33 - / - -MΦ-Exo_CM group was lower than WT-MΦ-Exo-CM group. IL33 - / - -MΦ-Exo_CM group had higher gene expression of α-SMA and type III collagen than IL33 - / - -MΦ_CM group, but lower than the WT-MΦ-Exo-CM group ( Figure 7 e,f). These results indicate that the conditioned medium (CM) of IL33-deficient macrophages inhibited the expression of α-SMA and type III collagen in HaCat cells and reduced their migration ability, and ADSC-Exos could improve these effects on HaCat cells. In addition, immunostaining results showed that the levels of α-SMA and type III collagen in the IL33-treated group were significantly higher than those in the control group ( Figure 7 c, d). In this treatment group, the gene expressions of α-SMA and type III collagen were also significantly increased ( Figure 7 g, h).

[0102] 10. ADSC-Exos regulate macrophage intercellular communication and activate HaCat cells through the wnt / β-catenin signaling pathway: Western blot results showed that IL33 - / - The expression of α-SMA, type III collagen, EGF, and TGF-β in the -MΦ-Exo_CM group was greater than that of IL33 - / - -MΦ_CM group, but not earlier than the WT-MΦ-Exo-CM group ( Figure 7i, j). These results indicate that the absence of IL33 impedes extracellular matrix synthesis, cell adhesion, and collagen deposition in HaCat cells. ADSC-Exos partially ameliorated the effects of IL33 deficiency on HaCat cells. Transcriptome sequencing analysis showed that ADSC-Exos activated the wnt / β-catenin signaling pathway. - / - -MΦ-Exo_CM group compared with IL33 - / - The expression of β-catenin, C-myc and Cyclin D1 in -MΦ_CM group was weak. - / - The expression level in the MΦ-Exo_CM group was significantly lower than that in the WT-MΦ-Exo_CM group ( Figure 7 k, i). Adding ADSC Exos can enhance the inhibitory effect of IL33 deficiency on the activity of the wnt / β-catenin pathway. Immunoblotting analysis confirmed that the expression of β-catenin, C-myc and Cyclin D1 in the IL33 recombinant protein group was higher than that in the control group ( Figure 7 m, n). IL33 can activate the wnt / β-catenin signaling pathway in keratinocytes.

[0103] Based on the results of the examples, it can be seen that ADSC-Exos can affect the function of macrophages, regulate the secretion of IL33 in macrophages, and promote the healing process of acute skin wounds. ADSC-Exos affect the polarization of macrophages and regulate the expression of inflammatory factors by activating IL33. IL33 plays a key role in epidermal proliferation and epithelialization. ADSC-Exos may regulate the biological metabolic process of keratinocytes through IL33 via the Wnt / β-catenin pathway ( Figure 8 ).

[0104] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. A product for regulating macrophage IL33 secretion, characterized in that: The products include exosomes; Preferably, the exosomes are exosomes derived from mesenchymal stem cells; Preferably, the mesenchymal stem cells are mesenchymal stem cells derived from adipose tissue.

2. The product according to claim 1, characterized in that The particle size of the exosomes ranges from 50 to 150 nm; The adipose-derived mesenchymal stem cell-related markers of the exosomes are positive for CD73, CD90, and CD105, and negative for CD14, CD34, and CD45; The exosome-specific protein markers CD63, CD9 and TSG101 were positive.

3. The product according to claim 1, characterized in that The macrophages include mouse macrophages and human macrophages; Preferably, the human macrophages are primary macrophages; Preferably, the human primary macrophages include macrophages derived from peripheral blood; Preferably, the murine macrophages include immortalized macrophages and primary macrophages; Preferably, the mouse immortalized macrophages include THP-1 cell line and RAW264.7 cell line; Preferably, the mouse primary macrophages include pluripotent stem cell-derived macrophages, peripheral blood-derived macrophages, bone marrow-derived macrophages, peritoneal cavity-derived macrophages, and tumor-derived macrophages; Preferably, the macrophages are RAW264.7 cell line.

4. The product according to claim 1, characterized in that The products include pharmaceutical compositions, drug delivery systems, kits, and medical products; Preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable excipient; Preferably, the kit further comprises instructions for explaining the mode of use.

5. The use of the product and / or exosomes according to any one of claims 1 to 4, characterized in that: The application includes any of the following: 1) Application in promoting wound healing; 2) Application in promoting collagen formation; 3) Application in promoting angiogenesis; 4) Application in promoting macrophage polarization; 5) Application in inhibiting the release of inflammatory factors; 6) Application in promoting keratinocyte proliferation.

6. The use according to claim 5, characterized in that: The exosomes are exosomes derived from mesenchymal stem cells; Preferably, the mesenchymal stem cells are mesenchymal stem cells derived from adipose tissue; Preferably, the particle size of the exosomes is in the range of 50-150 nm; The adipose-derived mesenchymal stem cell-related markers of the exosomes are positive for CD73, CD90, and CD105, and negative for CD14, CD34, and CD45; The exosome-specific protein markers CD63, CD9 and TSG101 were positive.

7. The use according to claim 5, characterized in that: The wound is an acute wound; Preferably, the promoting macrophage polarization is promoting macrophage M2 polarization; Preferably, the promotion of macrophage M2 polarization refers to causing the expression of one or more of the characteristic genes TGF-β, YM1, ARG-1 and IL-10; Preferably, the inhibition of inflammatory factor release is inhibition of macrophage inflammatory factor release; Preferably, the inhibition of the release of inflammatory factors is to inhibit the expression of one or more of IL-6, TNF-α, iNOS and CXCL10; Preferably, the keratinocytes include human epidermal keratinocytes and mammalian epidermal keratinocytes; Preferably, the mammalian epidermal keratinocytes include mouse epidermal keratinocytes, rat epidermal keratinocytes, and rabbit epidermal keratinocytes.

8. A method for promoting macrophage IL33 secretion, characterized in that: The method comprises administering exosomes or the product of any one of claims 1 to 4 to a subject.

9. The method according to claim 8, characterized in that The exosomes are exosomes derived from mesenchymal stem cells; Preferably, the mesenchymal stem cells are mesenchymal stem cells derived from adipose tissue; Preferably, the particle size of the exosomes is in the range of 50-150 nm; The adipose-derived mesenchymal stem cell-related markers of the exosomes are positive for CD73, CD90, and CD105, and negative for CD14, CD34, and CD45; The exosome-specific protein markers CD63, CD9 and TSG101 are positive; Preferably, the subject comprises a cell, a tissue, an organ, an organ system, a mammal or a human; Preferably, the mammal comprises a pig, a dog, a cat, a mouse, a rat or a rabbit; Preferably, the cells comprise primary or immortalized cells or cell lines.

10. A method for promoting acute wound healing, characterized in that: The steps of the method include administering exosomes or the product of any one of claims 1 to 4 to a subject; The exosomes are exosomes derived from mesenchymal stem cells; Preferably, the mesenchymal stem cells are mesenchymal stem cells derived from adipose tissue; Preferably, the particle size of the exosomes is in the range of 50-150 nm; The adipose-derived mesenchymal stem cell-related markers of the exosomes are positive for CD73, CD90, and CD105, and negative for CD14, CD34, and CD45; The exosome-specific protein markers CD63, CD9 and TSG101 were positive.

Images