Modified RNA demethylase, coding nucleic acid and application thereof, plant cultivation method and product

Abstract

The invention relates to the field of gene engineering and plant cultivation, in particular to modified RNA demethylase, nucleic acid for coding the modified RNA demethylase, application, a plant cultivation method and a product. Compared with the original RNA demethylase derived from algae or invertebrate, the modified RNA demethylase provided by the invention has the advantage that a specific peptide fragment sequence is added to the N terminal or the C terminal of the modified RNA demethylase, so that the modified RNA demethylase is obtained. After the modified RNA demethylase or nucleic acid for coding the modified RNA demethylase provided by the invention is introduced into an initial plant, a target plant of which the character is optimized compared with that of the initial plant can be obtained.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering and plant breeding, and in particular to a modified RNA demethylase and nucleic acid encoding the modified RNA demethylase, and applications, plant breeding methods and products. Background Art

[0002] Artificial intervention breeding methods for plants usually include a variety of methods, such as genetic engineering, cell engineering, microbial engineering, etc. In order to obtain new plant varieties, the above methods are usually adopted; the new variety plants here include the whole plant, plant organs (flowers, fruits, seeds, roots, stems, leaves, etc.), plant tissues, plant cells and other parts that can be obtained from plants.

[0003] The obtained new varieties of plants are usually expected to show more optimized traits, such as optimized growth, increased yield, optimized biomass, optimized structure or optimized cell division, etc. Among the above optimized traits, increased yield can be increased in many ways, such as increased volume or weight of single seeds / thousand seeds, increased number of root tillers, etc., which can affect plant yield, especially increased yield of the part that is expected to be obtained from the plant.

[0004] The above expectation is usually achieved through some transformation means, such as by transforming the DNA or histone of the plant to achieve the purpose of changing the plant traits. Prior to the present application, there has been a method for optimizing the traits of plants by demethylating the 6mA site of plant RNA. Summary of the invention

[0005] The aforementioned approach can indeed obtain plants with optimized traits, especially plants with increased yield. For details, please refer to the document CN108949806A previously applied for by the applicant and authorized by multiple countries; however, from the results of trait optimization, the trait optimization effect of the original RNA demethylase or its encoding DNA from algae or invertebrate sources on plants is significantly lower than that of the original RNA demethylase or its encoding DNA from humans or vertebrates; and from the perspective of audience acceptance, the introduction of the original RNA demethylase from algae or invertebrate sources has a significant negative impact on the plant's trait optimization effect. The NA demethylase or its encoding DNA is significantly higher than the original RNA demethylase or its encoding DNA introduced from humans or other vertebrates; for this reason, the applicant has found through research that by modifying the original RNA demethylase or its encoding DNA from algae or invertebrates using genetic engineering, the modified RNA demethylase or its encoding DNA after specific modification can achieve better trait optimization effects on plants, reaching or even exceeding the trait optimization effects of the original RNA demethylase or its encoding DNA from humans or other vertebrates on plants.

[0006] In view of this, the modified RNA demethylase and the encoding nucleic acid thereof provided by the present invention can optimize the traits of the plant after being introduced into the plant, and are more suitable for popularization.

[0007] Studies have found that during the growth and development of plants, there are specific enzymes that can promote the methylation of their RNA bases. For example, the methyltransferase MTA can promote the 6-methylation of the adenine base of RNA. Here, 6- refers to the N that is connected to the RNA sequence as the starting point, and the N that is ranked 6th in order or in reverse order. The methylated RNA itself or its products can promote the growth and development of plants through a series of processes such as subsequent expression. Experiments have confirmed that the removal of this specific methylation enzyme will affect the growth and development of plants (for example, it will not produce viable seeds or the seeds will not germinate normally). However, studies have found that after the methylation of the base position, the RNA itself or its products are more conducive to the growth and development of plants after removing some of the methyl groups, and promote the optimization of plant traits. The method of removing some methyl groups can be achieved by using a certain induction medium, such as a demethylase.

[0008] The present application has found that after the modified RNA demethylase of the present application is introduced into plants, the properties of the plants themselves are optimized, especially the yield or biomass of the plants is increased.

[0009] This type of RNA demethylase is usually based on RNA that has been methylated at its base position. Its induction chemical mechanism is as follows Figure 1 As shown, the demethylation process of N6-methylated adenine is taken as an example. Through research, it is found that although the specific RNA sequence and specific site location induced by this type of induction medium for demethylation are not clear at present, it is clear that this type of induction medium can indeed demethylate RNA after the base position has been methylated, thereby obtaining plants with optimized traits.

[0010] The scheme of the present application is to modify the original RNA demethylase from algae or invertebrate sources, and to obtain a modified RNA demethylase by adding at least one specific peptide sequence provided in the present application to at least one of its N-terminus or C-terminus. After the modified RNA demethylase or its encoding nucleic acid is introduced into a plant, the properties of the resulting plant can be more optimized, especially in terms of increased yield or increased biomass.

[0011] The specific peptide sequence described in the present application contains at least three amino acids selected from P, K or R. Wherein, P is the abbreviation of the amino acid Pro, K is the abbreviation of the amino acid Lys, and R is the abbreviation of the amino acid Arg. Here, "at least three amino acids selected from P, K or R" means that the amino acids selected from P, K or R may be repeated or may not be repeated, such as a combination of P, K, K, a combination of R, R, R, a combination of P, K, R, and so on. In addition to the above three specifically selected amino acids, the other amino acids in the peptide sequence can be selected from currently available conventional amino acids, and the conventional abbreviations of amino acids are used herein.

[0012] More preferably, at least two of the three amino acids selected from P, K or R in the peptide sequence described in the present application are consecutive, which means that any two of the amino acids selected from P, K or R are consecutive, and the remaining amino acid may or may not be consecutive with the aforementioned two amino acids.

[0013] Optionally, there may be multiple peptide sequences as described in the present application, such as RPRK, RKVIK, RNKKKK, PKKKRKV, KRPAATKKAGQAKKKK, TLLLRETMNNLGVSDHAVLSRKTPQPY, KRTPTAEERERGAKKLRLLEELEDTWLPYL, and the like.

[0014] The term "plant" as used herein includes living whole plants, ancestors and descendants of plants, and parts of plants, including seeds, branches, stems, leaves, roots, flowers, and tissues and organs. The term "plant" also includes plant cells, suspension cultures, callus, embryos, meristem regions, gametophytes, sporophytes, pollen, and microspores. The term "product obtained by processing a plant" is not limited to the aforementioned parts, but can also extend to the harvestable parts of the plant of the present invention, such as but not limited to the whole plant, flowers, fruits, seeds, roots, leaves, stems, etc.

[0015] Plants that can be particularly used in the method of the present application include algae, ferns and all plants belonging to the superfamily of the plant kingdom, especially monocotyledons and dicotyledons, including plants selected from the following use classifications: food crops (such as rice, corn, soybeans, etc.), feed crops (such as alfalfa, etc.), fiber crops (such as cotton, hemp, etc.), oil crops (such as sesame, peanuts, etc.), sugar crops (such as sugarcane, sugar beets, etc.), beverage crops, spice crops, seasoning crops, medicinal crops (such as ginseng, ganoderma, Fritillaria, etc.), dye crops, ornamental crops, fruit crops, vegetable crops, etc.; or selected from any one of the following specific plants: at least one of rapeseed (Brassica napus L.), tomato (Lycopersicon esculentum Mill.), lettuce (Lactuca sativa L. var. ramosa Hort.), and sugar beet (Beta vulgaris L.); or preferably selected from rice (Oryza sativa L.), corn (Zea mays L.), soybean (Glycine max (Linn.) Merr.), potato (Solanumtuberosum), wheat (Triticum aestivum L.), millet (Setaria italica var. germanica (Mill.) Schred.), sugarcane (Saccharum officinarum), sorghum (Sorghum bicolor (L.) Moench), cassava (Manihot esculenta Crantz); or preferably at least one selected from tobacco (Nicotiana tabacum L.), alfalfa (Medicago Sativa Linn), rubber grass (Taraxacum kok-saghyz Rodin), cotton (Gossypiumspp), flax (Linum usitatissimum L.), sunflower (Helianthus annuusL.), flax mustard (Camelinasativa (L.) Crantz), sedge (Cyperus esculentus L.), hemp (Cannabis sativa L.), and poplar (PopulusL.).

[0016] The term "initial plant" herein refers to a plant that has not been processed by the cultivation method of the present application, and its structure and species may specifically include any of the aforementioned plants. The source of the "initial plant" may be a plant obtained from the wild or artificial cultivation.

[0017] The term "target plant" herein refers to the plant that is processed by the breeding method of the present application and is expected to be obtained, and its structure and species can also include any of the aforementioned plants.

[0018] The term "product obtained by inactivation processing of plants" used in this article specifically refers to the product obtained after the aforementioned "plants" are processed, which is inactive; it is not limited to various industries, such as industrial, medicinal, edible, etc., nor is it limited to specific ingredient products, such as dry granules, powder, oil, fat, fatty acid, starch or protein, etc., and is also not limited to specific product forms, such as solid, liquid, gaseous or mixed states, etc.

[0019] The term "algae source" herein refers to algae, and the algae refers to a type of eukaryotic organisms in the kingdom Protistae, including many species, such as but not limited to blue algae, green algae, black algae, red algae, brown algae, and the algae used in the embodiments of the present application.

[0020] The term "increased yield" as defined herein means the increased weight of a specific harvested part relative to the initial plant, e.g. for rice, an increase in the weight of rice grains is an increased yield, for potatoes, an increase in the weight of tubers is an increased yield, etc.

[0021] The term "increased biomass" as defined herein refers to the increased weight of the whole plant excluding the above-mentioned yield increase evaluation part; for example, for rice, the increased weight of the remaining part excluding the rice grains is the increased biomass.

[0022] The yield and biomass described in this article are all compared with the dry weight of plants in the same period.

[0023] Therefore, the present invention provides a method for increasing plant yield and biomass, which comprises introducing the modified RNA demethylase or its encoding nucleic acid obtained after modification in the present application into an initial plant, and obtaining a target plant with optimized traits compared to the initial plant.

[0024] The properties of plants can be adjusted and optimized by introducing the modified RNA demethylase of the present application or its encoding nucleic acid. Optionally, the properties of plants can also be adjusted and optimized by using the homologues, variants / combinations of the modified RNA demethylase of the present application or its encoding nucleic acid with equivalent functions.

[0025] The term "modified RNA demethylase or its encoding nucleic acid" as defined herein refers to a medium that can induce demethylation of plant RNA. Specifically, it may refer to, for example, any one of catalysis and participation in a reaction, preferably catalysis. Furthermore, "RNA" includes one or more RNAs of a plant, such as ribosomal RNA (rRNA), messenger RNA (mRNA), transfer RNA (tRNA), non-coding RNA, etc.; "demethylation" refers to the demethylation of an already methylated RNA, which may be demethylation at one or more sites of the RNA, such as the demethylation of an already methylated base of the RNA, such as the demethylation of its N6-methylated base. Here, 6- is the position that defines the methylation, and it may be, for example, the N starting position of the base-linked RNA is the 1-position, and the 6th position is the 6-position when counting clockwise or counterclockwise. Here, "base" generally refers to adenine (A), etc.

[0026] The source of the "original RNA demethylase" can be any one or more sources of algae or invertebrates, such as green algae; the "source" defined in this article can be directly derived from algae or invertebrates, or indirectly derived from algae or invertebrates, such as orthologs or paralogs of algae or invertebrates, preferably orthologs or paralogs of green algae or cystoglossina.

[0027] The term "paralogous" refers to the duplication of genes within the genome of a species, resulting in paralogous genes.

[0028] The term "orthologous" relates to homologous genes in different organisms resulting from speciation.

[0029] The term "homology" herein refers to homologous sequences that have equivalent functions to the "original RNA demethylase"; the term "variant / conjugate" herein refers to variants / conjugates with equivalent functions obtained by mutation, combination, etc. using the "original RNA demethylase".

[0030] The term "introduction" herein includes one or more aspects, such as introduction route, introduction area, introduction amount, and the like.

[0031] There are many ways of introduction, for example, the vector carrying the "original RNA demethylase" can be used to infect plants, insert the "original RNA demethylase" into the DNA of the plants, or insert the vector carrying the "original RNA demethylase" into cells, and there is no limitation on the specific introduction area, such as the nucleus or the cell sap. In addition, the introduction can be a small amount or an excessive amount, which is specifically related to the characteristics of the plant and the introduced gene.

[0032] The "nucleic acid encoding the modified RNA demethylase" described herein is a nucleic acid that can encode the modified RNA demethylase directly after a certain modification of the original nucleic acid, or various nucleic acids that can encode the amino acid sequence of the modified RNA demethylase of the present application obtained by conventional reverse engineering in the art.

[0033] The "target plant" mentioned herein may be any subsequent generation of plants grown from the initial plant.

[0034] In the present application method, any improvement or beneficial increase in the traits of the plant is considered to be trait optimization. In addition, the trait optimization degree Y defined herein can also be limited by a specific numerical value, which is based on the same trait of the initial plant at the same time as the basis for comparison.

[0035] The degree of trait optimization Y can be calculated as an increase multiple compared to the initial plant, Y is the increase multiple compared to the initial plant in the same period, Y≥3.50, preferably Y≥3.80, more preferably Y≥4.00. Here, the increase multiple can be, for example, a weight gain multiple.

[0036] The term "DNA and / or protein, homologs or variants / combinations of equivalent functions" as defined herein refers to substances having a certain full sequence identity with DNA and / or protein, and the full sequence identity is, in increasing order of preference, homologous sequences, variants / combinations having equivalent functions compared to the sequences SEQ ID NOs: 1 to 48 in the sequence table. The term also means that it can be a DNA or protein, or a substance mixed with DNA and protein; it even refers to a paralog or ortholog having the aforementioned homology with the DNA or protein, or refers to a corresponding vector, a substance obtained by hybridization or fusion. It should be understood that "DNA and / or protein, homologs or variants / combinations of equivalent functions" are not limited to the sequences listed in the sequence table.

[0037] The "DNA and / or protein, its functionally equivalent homologue or variant / combination" may be any natural or synthetic substance.

[0038] The term "hybridization" as defined herein is the process of mutual return of complementary nucleotide sequences of basic homology. The hybridization process can occur completely in solution, that is, complementary nucleic acids are all in solution. The hybridization process can also be carried out in such a way that one of the complementary nucleic acids is fixed on a matrix such as magnetic beads, agarose beads or any other resin. In addition, the hybridization process can also be carried out in such a way that one of the complementary nucleic acids is fixed on a solid support such as nitrocellulose membrane or nylon membrane, or is fixed on a silica glass support such as by photolithography. In order to make hybridization occur, usually the nucleic acid molecules are thermally denatured or chemically denatured so that the double-stranded chain is melted into two single strands and / or hairpins or other secondary structures are removed from single-stranded nucleic acids. The stringency of hybridization is affected by conditions such as temperature, salt concentration and hybridization buffer composition.

[0039] The nucleic acid molecule or its variant can be from any natural source or artificial source. The nucleic acid / gene or its variant can be isolated from a non-mammalian source. It can be modified from the native form of the nucleic acid in terms of composition and / or genomic environment by rigorous artificial manipulation. The nucleic acid is preferably of algae origin, especially of, for example, green algae origin.

[0040] The term "homolog" covers two special forms of homology, orthologous sequences and paralogous sequences, which relate to evolutionary concepts used to describe the genetic relationships of genes.

[0041] Homologues can also be in the form of "insertion variants" of proteins, i.e., one or more amino acid residues are introduced into a predetermined site in a protein. Insertion can include fusion of the amino terminus and / or carboxyl terminus, and insertion within the sequence of a single or multiple amino acids. Typically, the insertion within the amino acid sequence will be less than the fusion of the amino terminus or carboxyl terminus, being about the number of 1 to 10 residues. Examples of amino terminus or carboxyl terminus fusion proteins or peptides include binding domains or activation domains of transcriptional activators such as for yeast two-hybrid systems, bacteriophage coat proteins, (histidine) 6-tags, glutathione S-transferase-tags, A proteins, maltose binding proteins, dihydrofolate reductase, Tag.100 epitopes, c-myc epitopes, FLAG epitopes, lacZ, CMP (calmodulin binding peptide), HA epitopes, C protein epitopes, and VSV epitopes.

[0042] Functional variants that can be used in the present application's method also include optional nucleic acid molecules or gene splice variants. The term "selectable splice variant" used herein encompasses such nucleotide sequence variants, wherein selected introns and / or exons have been excised, displaced or added. Such variants are those in which the biological activity of the protein remains unaffected, and they can be obtained by selectively retaining the functional fragments of the protein. Such splice variants can be naturally found or can be artificial. The method for producing such splice variants is well known in the art.

[0043] The "N-terminus" or "C-terminus" mentioned in this application specifically refers to the two ends of the original protein.

[0044] The "original protein" mentioned in the present application specifically refers to a protein that has not been processed by the modification method of the present application, and can be a protein of natural origin or an artificially modified protein.

[0045] Therefore, in summary, the solutions that may be provided by the present application include but are not limited to the following solutions, and other solutions that do not deviate from the main idea of ​​the present application may also be obtained by combining and transferring features according to the following solutions:

[0046] The first solution provided by this application is:

[0047] A modified RNA demethylase, compared with the original RNA demethylase derived from algae or invertebrates, adds at least one peptide sequence to at least one of its N-terminus and C-terminus to obtain the modified RNA demethylase.

[0048] Optionally, the peptide sequence has any of the following amino acid sequence characteristics:

[0049] a) contains at least three amino acids selected from the group consisting of H, K and R;

[0050] b) contains PY and at least one amino acid selected from the group consisting of H, K and R.

[0051] Optionally, when the peptide sequence has the amino acid sequence feature of a), at least two amino acids selected from the group consisting of H, K and R are consecutive, or contain V or I.

[0052] Optionally, the peptide sequence has any of the following amino acid sequence characteristics: (K / R)(K / R)X 1-2 (K / R), (K / R)X 1-2 (K / R)(K / R)、(K / R)(K / R)X 10-12 (K / R) 2-5 、(R / K / H)X 2-5 PY, or K(V / I)XKX 1-2 (K / H / R), where X is any amino acid.

[0053] Optionally, the peptide sequence includes at least one of RPRK, RKVIK, RNKKKK, PKKKRKV, KRPAATKKAGQAKKKK, TLLLRETMNNLGVSDHAVLSRKTPQPY, and KRTPTAEERERGAKKLRLLEELEDTWLPYL.

[0054] Optionally, the original RNA demethylase includes at least one of its homologues or variants / combinations with equivalent functions.

[0055] Alternatively, a primary RNA demethylase promotes the demethylation of N6-methyladenine of RNA.

[0056] Optionally, the modified RNA demethylase is shown in sequence listing Seq.ID.No:13 to Seq.ID.No:48.

[0057] Optionally, the invertebrate includes at least one of a long-spined sea star or a cystoglossum.

[0058] Optionally, the algae include at least one of blue algae, red algae, cryptophyte, dinoflagellates, golden algae, yellow algae, diatoms, brown algae, naked algae, green algae, and charophyte.

[0059] Optionally, the modified RNA demethylase promotes N6-methyladenine demethylation of RNA.

[0060] The second solution provided by this application is:

[0061] A nucleic acid encoding the aforementioned modified RNA demethylase.

[0062] Optionally, the nucleic acid is DNA.

[0063] The third solution provided by this application is:

[0064] Use of the modified RNA demethylase or the nucleic acid described above in introducing into plants.

[0065] Optionally, the application includes any one of increasing production and increasing biomass.

[0066] Optionally, the plant includes at least one of rapeseed, tomato, lettuce, beet, rice, corn, soybean, potato, wheat, millet, sugarcane, sorghum, cassava, tobacco, alfalfa, rubber grass, cotton, flax, sunflower, flax mustard, sedge, hemp, and poplar.

[0067] The fourth solution provided by this application is:

[0068] A plant breeding method, comprising introducing the modified RNA demethylase or the nucleic acid into an initial plant, and obtaining a target plant with optimized traits compared to the initial plant.

[0069] Optionally, trait optimization includes at least one of increasing yield and increasing biomass.

[0070] Optionally, compared to the original plant, the aforementioned modified RNA demethylase or the aforementioned nucleic acid is introduced in excess.

[0071] Optionally, the initial plant is selected from at least one of rapeseed, tomato, lettuce, sugar beet, rice, corn, soybean, potato, wheat, millet, sugarcane, sorghum, cassava, tobacco, alfalfa, rubber grass, cotton, flax, sunflower, flax mustard, sedge, hemp, and poplar.

[0072] Optionally, the introduced plant region includes at least one of a plant organ, a plant tissue, and a plant cell.

[0073] Optionally, the introduced plant region is selected from plant meristems.

[0074] Optionally, the introduced plant region includes at least one of a cell nucleus and a cell sap of the plant.

[0075] Optionally, the introduction method includes introducing a vector encapsulating the modified RNA demethylase or the nucleic acid described above into the plant.

[0076] Optionally, compared to the initial plant, the degree of trait optimization is Y, where Y is the multiple increase compared to the initial plant over the same period, Y≥3.50, preferably Y≥3.80, and more preferably Y≥4.00.

[0077] The fifth solution provided by this application is:

[0078] The target plant obtained by the aforementioned plant breeding method includes at least one of a living whole plant, a plant organ, a plant tissue, and a plant cell.

[0079] The sixth solution provided by this application is:

[0080] The product obtained by inactivating the target plant mentioned above. BRIEF DESCRIPTION OF THE DRAWINGS

[0081] Figure 1 is a schematic diagram of the demethylation process of N6-methylated adenine;

[0082] Figure 2 Taking potatoes as an example, the comparison of tubers obtained from the experimental group and the blank group;

[0083] Figure 3 Taking rice as an example, the whole plant comparison pictures of the experimental group and the blank group are shown. DETAILED DESCRIPTION

[0084] In order to enable those skilled in the art to better understand the technical solution of the present invention, the present invention is further described in detail below in conjunction with specific embodiments.

[0085] Sequence modification of native RNA demethylases from algae or invertebrates

[0086] The original RNA demethylase obtained from various algae or invertebrates is sequenced, screened, and amplified to obtain the corresponding sequence samples. The sequences of the original RNA demethylases from specific algae sources are shown in the sequence table SEQ.ID.NO:1-12. Each sequence shown is directly subjected to PCR and recombined into the p1307-FLAG vector to obtain p1307-RNA demethylase-FLAG. Thereafter, the RNA demethylase-FLAG fragment is amplified and recombined into the pGEX-His vector to obtain pGEX-RNA demethylase-FLAG-His, which can be used for subsequent in vitro experiments and peptide sequence introduction. The plasmid pGEX-RNA demethylase-FLAG-His is recombined after the ring P using primers with peptide sequences, and finally the modified gene fragment is introduced into the p1307-FLAG vector again. In this way, the modified RNA demethylase of the present application is obtained, and the specific sequence can be shown in the sequence table SEQ.ID.NO:13-48. Specifically, the modified RNA demethylase obtained can introduce a peptide sequence at at least one of the N-terminus or C-terminus of the original protein. For example, to introduce a peptide sequence at the N-terminus, the NLS sequence can be inserted between the N-terminus of the original protein, that is, the first amino acid M and the second amino acid. For example, to introduce a peptide sequence at the C-terminus, the NLS sequence can be added after the C-terminus of the original protein, that is, the last amino acid.

[0087] Example 1: Method for obtaining target plants by infecting callus with Agrobacterium

[0088] 1. Inducing callus using plant seeds as test materials

[0089] 1) Disinfection:

[0090] Take mature seeds of the plant, shell them manually, select plump, smooth and sterile seeds, put the seeds in a 100 ml sterile beaker, pour in 70% alcohol for disinfection for 2 minutes; pour out the alcohol, add 20% sodium hypochlorite (NaClO) solution, and soak for 30 minutes; pour out the sodium hypochlorite solution, wash the seeds with sterile distilled water for 4 to 5 times, and finally soak the seeds in sterile distilled water for 30 minutes.

[0091] 2) Induction culture (sterile operation required):

[0092] After the sterilized seeds are placed on sterile filter paper to absorb the surface moisture, they are placed in NB medium (PH5.8) containing 2.0 mg / L 2,4-D, with 12 to 14 seeds per dish; to ensure the induction rate, it is best to keep the germination direction of the seeds parallel to the culture medium or slightly downward during inoculation, and do not let the germination direction be upward or vertically downward. After the operation is completed, seal the culture dish with a sealing film, and induce and culture in the dark in a light incubator at 30°C and a humidity of about 50% for 20 to 30 days until obviously loose callus tissue appears, and then subculture or pre-culture transformation is performed.

[0093] 3) Subculture (sterile operation required):

[0094] Open the culture dish on the clean bench, pick up naturally split, vigorous growth, hard texture, tender yellow color, and callus with a particle diameter of about 3mm with tweezers, and place it in NB medium (PH5.8) containing 2.0mg / L 2,4-D and 0.5mg / L 6-BA, and place 10 callus in each dish, and culture in the dark at 30℃; if the callus is found to be seriously softened, it is recommended to subculture under light. The subculture time is about 10 to 15 days (the next subculture time is determined according to the growth of the callus), and the total subculture is two times. Note: If there is a lot of water on the lid during the flat dish culture process, it is not suitable, which may cause the culture to fail. The reason is that the bottom of the culture dish is heated, and the cover temperature is lower than the culture medium temperature, causing water vapor to condense on the cover of the culture dish.

[0095] 2. Agrobacterium culture

[0096] Experimental group: The vector carrying the modified DNA or modified protein of the present application and the hygromycin resistance gene Hygromycin is transferred into the parasitic bacteria, for example, the pCAMBIA 1307 vector carrying the modified DNA or modified protein of the present application and the hygromycin resistance gene Hygromycin is transferred into Agrobacterium LBA4404 and inoculated onto a YEP solid culture medium containing 20 mg / L rifampicin (Rif) and 50 mg / L kanamycin (Kan).

[0097] Control group: The original DNA or original protein and the vector of hygromycin resistance gene Hygromycin are transferred into the parasitic bacteria, for example, the pCAMBIA 1307 vector of hygromycin resistance gene Hygromycin is transferred into Agrobacterium LBA4404, and inoculated onto YEP solid culture medium containing 20 mg / L rifampicin (Rif) and 50 mg / L kanamycin (Kan).

[0098] Blank group: The vector of hygromycin resistance gene Hygromycin was transferred into parasitic bacteria, for example, the pCAMBIA 1307 vector of hygromycin resistance gene Hygromycin was transferred into Agrobacterium LBA4404, and inoculated onto YEP solid medium containing 20 mg / L rifampicin (Rif) and 50 mg / L kanamycin (Kan).

[0099] After the control group, experimental group and blank group were cultured at 28°C for 2 days, single clones of Agrobacterium were picked for colony PCR to verify whether the induction medium had been transferred into Agrobacterium, and positive single clones were selected and cultured in 4 ml YEP (containing 50 mg / L Kan and 20 mg / L Rif) culture medium at 28°C and 220 rpm for 20 to 36 h until the OD600 of the bacterial solution was 0.8 to 1.0.

[0100] 3. Infection and co-cultivation

[0101] 1) The cultured Agrobacterium culture was centrifuged at 4°C, 4000 rpm for 10 min, and the supernatant was removed. A suspension was prepared using AAM culture medium containing 100 umol / L acetosyringone, so that the final concentration of the culture solution OD600 was about 0.2.

[0102] 2) Pick out rice callus that has grown to a certain size and infect it with Agrobacterium suspension for 20 to 30 minutes.

[0103] 3) Remove the callus tissue and place it on sterile filter paper to drain for 20 to 30 minutes to prevent excessive growth of Agrobacterium during co-cultivation and excessive damage to the callus tissue.

[0104] 4) The callus was placed in NB medium (pH 5.2) containing 2.0 mg / L 2,4-D and 100 umol / L acetosyringone and cultured in the dark at 25°C for 48 to 72 h.

[0105] Note: The co-culture should be followed up and observed. If Agrobacterium is obviously seen, it means that the infection is over-infected and it is easy to grow bacteria in subsequent screening.

[0106] 4. Screening of resistant callus

[0107] Take out the callus and wash it with sterile water for 5-6 times, shaking it continuously. Then place the callus on sterile filter paper to air dry, and evenly place it on NB medium (PH 5.8) containing 50mg / L hygromycin for the first round of selection. Culture it in the dark at 28℃. If mold or Agrobacterium growth is found, transfer the callus with bacteria to a new screening plate in time.

[0108] After new callus tissue grows out after about 30 days of screening, transfer it to new NB medium (PH5.8) containing 50 mg / L hygromycin and screen it for another 7 to 10 days. If it grows obviously, it is a positive callus tissue. If it does not grow, it may be a false positive even if it does not turn brown and die.

[0109] 5. Induction of differentiation and rooting of positive callus

[0110] Place the yellow callus particles (to ensure that the callus used for differentiation is flawless) that have strong growth in the second screening on NB medium (PH5.8) containing 2.0mg / L 6-BA, 0.5mg / L kinetin, and 50mg / L hygromycin. Place 2 to 3 positive clones in each bottle. Place a small amount of callus for each clone. The callus placed should be of high quality, not quantity. Cultivate in the dark at 27℃ for 10 days, then illuminate and differentiate for 10 to 20 days. After growing green leaves, rooting can be carried out. The light intensity is 4000lux, 14h / d.

[0111] Place the robust seedlings differentiated from each clone in 1 / 2N6 medium (PH5.8) containing 0.5mg / L naphthaleneacetic acid and 50mg / L hygromycin to induce rooting, with 2-3 seedlings placed in each bottle. Culture under light at 27-30℃, light intensity 4000lux, 14h / d, open the sealing film after 7-10 days and add appropriate amount of sterile water. Transplant after 2-3 days.

[0112] Note: Callus cannot be subcultured during the differentiation process. The time from differentiation to transplanting of target plants is about three months.

[0113] 6. Training and transplanting of target plants

[0114] Pick out the seedlings of the target plant with relatively well-differentiated roots, stems and leaves (when the seedlings grow to the top of the test tube, open the lid in time), open the sealing film, add an appropriate amount of distilled water or sterile water (to prevent bacteria from growing in the culture medium), harden the seedlings for about 3 days to a week, then wash off the agar, transplant them into soil pots in the greenhouse for growth, test, and obtain the target plants.

[0115] 7. Detection and verification of target plants

[0116] 1) PCR detection: design induction mediator primers, such as RNA demethylase-F: ATGAAGCGCACCCCGACTG; RNA demethylase-R: GGGTTTTGCTTCCAGAAGCTGA; PCR reaction program: 95°C 5min, 95°C 15s, 58°C 15s, 72°C 30s, 35 cycles, 72°C extension 10min, 4°C storage. After the reaction, the PCR product was analyzed by 1% agarose gel electrophoresis.

[0117] 2) Method for rapid detection of target plants with hygromycin: Cut and collect fresh green leaves of about 1 cm long from the seedlings to be tested (with incisions at both ends), place them flat on the test culture medium (0.7% agar, 1 ml / L 6-BA, 50 mg / L hygromycin), and culture them at 28°C, 16h light / 8h dark for 48h. Plants with leaves that remain bright green are positive plants, while leaves of negative seedlings show blocky necrosis.

[0118] 8. Evaluation of the effect of induction media in target plants

[0119] Data was collected from the experimental group target plants and the control group target plants at maturity. The measured data mainly focused on the yield increase of each plant, in %. The above data involved weights of dry weight, specifically the data obtained after drying in an oven at 105℃ for 20 minutes and drying in an oven at 80℃ for 20 hours.

[0120] Example 2: Method for obtaining target plants by infecting stem tip tissue with Agrobacterium

[0121] 1. Inducing callus using mature plant embryos as test materials

[0122] Take mature seeds and soak them in clean water, change the water every 1 to 2 hours, and wait for 2 days until the seeds burst and turn white, then germinate and root them at 37℃. When the embryo grows to 1.5 to 2.0 cm, use a scalpel to cut off the embryo and coleoptile from the stem ring at the stem tip to expose the stem tip meristem.

[0123] 2. Agrobacterium culture (same as step 2 in Example 2)

[0124] 3. Infection and co-cultivation

[0125] Place the treated plants in AAM resuspension (see Appendix of Example 1), add 200 l / L of surfactant Silwet L-77, vacuum treat for 8 min at 1.5 KPa, pour out the resuspension, place on clean and moist perlite, and culture in the dark at 28°C for 3 days.

[0126] 4. Screening, transplanting and management of target plants

[0127] The plants after dark culture were moved to the plant nursery, and leaves of the transformed plants were collected at the three- to four-leaf stage for transformation seedling PCR detection and identification: gene primers were designed, such as RNA demethylase-F: ATGAAGCGCACCCCGACTG; RNA demethylase-R: GGGTTTTGCTTCCAGAAGCTGA; PCR reaction program was: 95℃5min, 95℃15s, 58℃15s, 72℃30s, 35 cycles, 72℃ extension 10min, and 4℃ storage. After the reaction, the PCR product was analyzed by 1% agarose gel electrophoresis. After 7 days, the surviving plants were transplanted to the greenhouse of the transgenic plant demonstration base and routine fertilizer and water management was carried out. The seeds of the transformed seedlings were harvested.

[0128] 5. Evaluation of target plant traits (same as step 8 in Example 2)

[0129] Example 3: Method for obtaining target plants by infecting with Agrobacterium and inducing meristem production

[0130] 1. Plant cultivation

[0131] The mature seeds were planted in nutrient soil and grown in a 24°C greenhouse environment with 16 h light / 8 h dark until maturity (approximately 63 to 66 days).

[0132] 2. Agrobacterium culture

[0133] DRs (growth regulatory elements) are a type of growth regulatory elements that induce plants to form meristems, and commonly used ones include BBM, ipt, ΔMP, STM, Wus2, etc. The vector carrying the induction medium, hygromycin resistance gene Hygromycin and DRs was transferred into Agrobacterium GV3101, and cultured overnight at 28°C for 12 hours in a growth medium (10mM MES, pH5.6, 20μM acetosyringone, 50mg / L kanamycin, 50mg / L gentamicin), centrifuged at 5000rpm for 10 minutes, and the cells were collected and resuspended in an infiltration medium (10mM MES, 150μM acetosyringone, 10mM MgCl2) to an OD600 value of 0.2-0.3. The Agrobacterium infection solution was placed at room temperature (about 25°C) for 2-4 hours before inoculation.

[0134] 3. Infection and screening of target plants

[0135] Remove visible shoot meristems from all plants, leaving 2-3 nodes and supporting leaves. Immediately inoculate the wound site with an Agrobacterium infection solution using a syringe and a 31G needle. Observe the bud formation of the plant at the cut site 38-48 days after inoculation. Each injection site with newly formed tissue or meristem is counted as a single event. The appearance of bud tissue is identified by genomic PCR (see Example 2, step 7) as an indicator of transgenic presence and expression.

[0136] 4. Transplantation and management of target plants

[0137] The newly generated bud tissue was cut off and transferred to the rooting medium to form complete seedlings. The surviving plants were transplanted to the greenhouse and fertilized and watered as usual. The transformed seedlings were harvested.

[0138] 5. Evaluation of target plant traits (same as step 8 in Example 2)

[0139] Example 4: Method for obtaining target plants by mechanical inoculation of PVX vectors

[0140] 1. Plant cultivation

[0141] The mature seeds were planted in nutrient soil and grown in a 24°C greenhouse environment with 16 h light / 8 h dark until maturity (approximately 63 to 66 days).

[0142] 2. Agrobacterium culture

[0143] The vector pPZPVX carrying the induction medium was transferred into Agrobacterium C58C1, and the cells were collected after being cultured in Luria broth medium and suspended in infection buffer (10 mM MES [pH 5.8], 10 mM MgCl2, 100 μg / mL acetosyringone) to an OD600 value of 0.2 to 0.3. The Agrobacterium infection solution was placed at room temperature (about 25°C) and incubated for 2 to 4 hours before inoculation.

[0144] 3. Infection and screening of target plants

[0145] Use a syringe to infiltrate tobacco leaves with Agrobacterium carrying the induction medium expression plasmid. After 7 days, homogenize the inoculated leaves with 10mM NaPi buffer (pH7.0) (Western blot verifies the expression of the induction medium). After homogenization, centrifuge at 16,000g for 3 minutes and filter the supernatant with a 0.45μm filter. Apply the filtered supernatant and corundum (600 mesh) to the fourth or fifth true leaf and rub it gently by hand to mechanically inoculate PVX. After inoculation, the plants are placed in a 16-hour light / 8-hour dark photoperiod at 16°C for growth, and the formation of new shoots at the inoculation site is observed after 7 to 8 days.

[0146] Note: Western blot detection of induction mediator expression: Take the inoculated leaf tissue powder and mix it with 1×1 oading buffer, heat it at 95℃ for 10 minutes, centrifuge it at 15000rpm for 10 minutes at room temperature, take the supernatant, load it on 10% SDS-PAGE, transfer it to the membrane after electrophoresis, and after blocking, use the induction mediator antibody to detect the induction mediator expression.

[0147] 4. Transplantation and management of target plants

[0148] The newly generated bud tissue was cut off and transferred to the rooting medium to form complete seedlings. The surviving plants were transplanted to the greenhouse and fertilized and watered as usual. The transformed seedlings were harvested.

[0149] 5. Evaluation of target plant traits (same as step 8 in Example 2)

[0150] Example 5: Method for obtaining target plants by haploid induction-editing (HI-Edit) technology

[0151] Haploid induction (HI) technology can induce haploids by appropriate modification of CENTROMERIC HISTONE3 (CENH3) or knockout of MATRILINEAL (MATL) and then double chromosomes, obtain homozygous candidate materials in a short time, and fix the genotype of crops, which is of great significance in crop breeding practice. Haploid induction-editing (HI-Edit) technology combines haploid induction breeding with gene editing technology, and can directly improve a wide range of plants in a short time, including commercial varieties, and get rid of the species and genotype restrictions of the existing gene editing system; since the chromosomes of the donor carrying the gene editing element will be eliminated during the hybridization process after being introduced through the haploid induction line, the hybrid obtained will not contain the genetic information of the father, and there is no need for multiple backcrossing. Only chromosome doubling of the target haploid plant can obtain an improved diploid strain, shortening the breeding cycle; the target crop can be improved through distant hybridization, with a wide range of applications, and transgene-free strains can be obtained.

[0152] 1. Construct an induction medium vector and introduce it into the non-haploid induction inbred line NP2222 to obtain stable transformed plants

[0153] Use 9-day-old immature embryos isolated from inbred line NP2222, and mix the isolated immature embryos with the Agrobacterium strain LBA4404 carrying the carrier of the induction medium. The infected embryos are cultivated on the recovery medium and the callus induction medium. Select callus on the medium containing mannose, and regenerate the resistant callus into the target plant to obtain a stable transformed plant.

[0154] 2. Evaluation of target plant traits (same as step 8 in Example 2)

[0155] The above-mentioned Examples 1 to 5 can all be methods of introducing modified DNA or modified protein into initial plants to obtain target plants, and the degree of trait optimization is measured. The yield and biomass data of the experimental group, control group and blank group are measured respectively. The blank group is used as the standard. The average data of the yield and biomass increase of the experimental group and the control group are respectively relative to the blank group, and the dry weight is used as the standard; the data in the following table are displayed based on the data of Example 1, and the data of the remaining examples are basically no more than 0.05 different from the data of Example 1.

[0156] Table 1—MRP_1-Mono-Green dinoflagellate Ostreococcus lucimarinus

[0157]

[0158]

[0159] The control group data in the above table can be compared with the original RNA demethylase sequence or its encoding nucleic acid shown in Seq.ID.NO:1 and the blank group to calculate the average value, and the experimental group data in the above table can be compared with the modified RNA demethylase sequence or its encoding nucleic acid shown in Seq.ID.NO:13 to 15 and the blank group to calculate the average value. Figure 2 The figure shows the comparison between the experimental group and the blank group of potatoes in Table 1 above. Figure 2 The left picture is the blank group, and the right picture is the experimental group. Figure 3 The figure shows the comparison between the experimental group and the blank group of rice in Table 1 above. Figure 3 The left picture is the blank group, and the right picture is the experimental group.

[0160] Table 2—MRP_2-Mono-Aphanomyces astaci

[0161]

[0162]

[0163] The control group data in the above table can be compared with the original RNA demethylase sequence or its encoding nucleic acid shown in Seq.ID.NO:2 and the blank group to calculate the average value, and the experimental group data in the above table can be compared with the modified RNA demethylase sequence or its encoding nucleic acid shown in Seq.ID.NO:16 to 18 and the blank group to calculate the average value.

[0164] Table 3—MRP_3-Mono-Micromonas commoda

[0165]

[0166]

[0167]

[0168] The control group data in the above table can be compared with the original RNA demethylase sequence or its encoding nucleic acid shown in Seq.ID.NO:3 and the blank group to calculate the average value, and the experimental group data in the above table can be compared with the modified RNA demethylase sequence or its encoding nucleic acid shown in Seq.ID.NO:19 to 21 and the blank group to calculate the average value.

[0169] Table 4—MRP_4-Mono-Micromonas pusilla

[0170]

[0171]

[0172] The control group data in the above table can be compared with the original RNA demethylase sequence or its encoding nucleic acid shown in Seq.ID.NO:4 and the blank group to calculate the average value, and the experimental group data in the above table can be compared with the modified RNA demethylase sequence or its encoding nucleic acid shown in Seq.ID.NO:22 to 24 and the blank group to calculate the average value.

[0173] Table 5—MRP_5-Mono-Polarella glacialis

[0174]

[0175]

[0176] The control group data in the above table can be compared with the original RNA demethylase sequence or its encoding nucleic acid shown in Seq.ID.NO:5 and the blank group to calculate the average value, and the experimental group data in the above table can be compared with the modified RNA demethylase sequence or its encoding nucleic acid shown in Seq.ID.NO:25 to 27 and the blank group to calculate the average value.

[0177] Table 6—MRP_6-Mono-Guillardia theta

[0178]

[0179]

[0180] The control group data in the above table can be compared with the original RNA demethylase sequence or its encoding nucleic acid shown in Seq.ID.NO:6 and the blank group to calculate the average value, and the experimental group data in the above table can be compared with the modified RNA demethylase sequence or its encoding nucleic acid shown in Seq.ID.NO:28 to 30 and the blank group to calculate the average value.

[0181] Table 7—MRP_7-Mono-Ostreococcus tauri

[0182]

[0183]

[0184] The control group data in the above table can be compared with the original RNA demethylase sequence or its encoding nucleic acid shown in Seq.ID.NO:7 and the blank group to calculate the average value, and the experimental group data in the above table can be compared with the modified RNA demethylase sequence or its encoding nucleic acid shown in Seq.ID.NO:31 to 33 and the blank group to calculate the average value.

[0185] Table 8—MRP_11-mono-brown algae Ectocarpus sp.

[0186]

[0187]

[0188] The control group data in the above table can be compared with the original RNA demethylase sequence or its encoding nucleic acid shown in Seq.ID.NO:8 and the blank group to calculate the average value, and the experimental group data in the above table can be compared with the modified RNA demethylase sequence or its encoding nucleic acid shown in Seq.ID.NO:34 to 36 and the blank group to calculate the average value.

[0189] Table 9—MRP_12-mono-filamentous algae Conferva siliculosa

[0190]

[0191]

[0192] The control group data in the above table can be compared with the original RNA demethylase sequence or its encoding nucleic acid shown in Seq.ID.NO:9 and the blank group to calculate the average value, and the experimental group data in the above table can be compared with the modified RNA demethylase sequence or its encoding nucleic acid shown in Seq.ID.NO:37 to 39 and the blank group to calculate the average value.

[0193] Table 10—Fragilariopsis cylindrus

[0194]

[0195]

[0196] The control group data in the above table can be compared with the original RNA demethylase sequence or its encoding nucleic acid shown in Seq.ID.NO:10 and the blank group to calculate the average value, and the experimental group data in the above table can be compared with the modified RNA demethylase sequence or its encoding nucleic acid shown in Seq.ID.NO:40 to 42 and the blank group to calculate the average value.

[0197] Table 11 - Long-thorned sea star (Acanthaster planci)

[0198]

[0199]

[0200] The control group data in the above table can be calculated by comparing the original RNA demethylase sequence or its encoding nucleic acid shown in Seq.ID.NO:11 with the blank group to obtain the average value, and the experimental group data in the above table can be calculated by comparing the modified RNA demethylase sequence or its encoding nucleic acid shown in Seq.ID.NO:43 to 45 with the blank group to obtain the average value.

[0201] Table 12 - Saccoglossus kowalevskii

[0202]

[0203]

[0204] The control group data in the above table can be compared with the original RNA demethylase sequence or its encoding nucleic acid shown in Seq.ID.NO:12 and the blank group to calculate the average value, and the experimental group data in the above table can be compared with the modified RNA demethylase sequence or its encoding nucleic acid shown in Seq.ID.NO:46 to 48 and the blank group to calculate the average value.

[0205] From the above data, it can be concluded that after the modified RNA demethylase and its encoding nucleic acid from algae or invertebrates of the present application are introduced into plants, new plants with increased yield and biomass can be obtained, and compared with the introduction effect of the RAN demethylase and its encoding nucleic acid from the original source, it is more advantageous.

[0206] The above are only preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be regarded as limiting the present invention, and the protection scope of the present invention should be based on the scope defined by the claims. For ordinary technicians in this technical field, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be regarded as the protection scope of the present invention.

[0207]

[0208]

[0209]

[0210]

[0211]

[0212]

[0213]

[0214]

[0215]

[0216]

[0217]

[0218]

[0219]

[0220]

[0221]

[0222]

[0223]

[0224]

[0225]

[0226]

[0227]

[0228]

[0229]

[0230]

[0231]

[0232]

[0233]

[0234]

[0235]

[0236]

[0237]

[0238]

[0239]

[0240]

[0241]

[0242]

[0243]

[0244]

[0245]

Claims

1. A modified RNA demethylase, characterized in that Compared with the original RNA demethylase derived from algae or invertebrates, at least one peptide sequence is added to at least one of the N-terminus and the C-terminus to obtain the modified RNA demethylase.

2. The modified RNA demethylase according to claim 1, wherein the peptide sequence has any of the following amino acid sequence characteristics: a) contains at least three amino acids selected from the group consisting of H, K and R; b) contains PY and at least one amino acid selected from the group consisting of H, K and R.

3. The modified RNA demethylase according to claim 1, characterized in that When the peptide sequence has the amino acid sequence feature of a), at least two amino acids selected from H, K or R are consecutive, or contain V or I.

4. The modified RNA demethylase according to claim 1, characterized in that The peptide sequence has any of the following amino acid sequence characteristics: (K / R)(K / R)X 1-2 (K / R), (K / R)X 1-2 (K / R)(K / R)、(K / R)(K / R)X 10-12 (K / R) 2-5 、(R / K / H)X 2-5 PY, or K(V / I)XKX 1-2 (K / H / R), where X is any amino acid.

5. The modified RNA demethylase according to claim 1, characterized in that The peptide sequences include RPRK, RKVIK, RNKKKK, PKKKRKV, KRPAATKKAGQAKKKK, At least one of TLLLRETMNNLGVSDHAVLSRKTPQPY, KRTPTAEERERGAKKLRLLEELEDTWLPYL.

6. The modified RNA demethylase according to claim 1, characterized in that The original RNA demethylase includes at least one of its homologues or variants / combinations with equivalent functions.

7. The modified RNA demethylase according to claim 1, characterized in that The original RNA demethylase promotes the demethylation of N6-methyladenine of RNA.

8. The modified RNA demethylase according to claim 1, characterized in that The modified RNA demethylase is shown in the sequence table Seq.ID.No:13 to Seq.ID.No:

48.

9. The modified RNA demethylase according to claim 1, characterized in that The invertebrate comprises at least one of a long-spined sea star or a cystoglossum.

10. The modified RNA demethylase according to claim 1, characterized in that The algae include at least one of blue algae, red algae, cryptophyte, dinoflagellates, golden algae, yellow algae, diatoms, brown algae, naked algae, green algae and charophyte.

11. A nucleic acid encoding the modified RNA demethylase according to claim 1.

12. The nucleic acid according to claim 11, characterized in that The nucleic acid is DNA.

13. Use of the modified RNA demethylase according to claim 1 or the nucleic acid according to claim 11 introduced into plants.

14. The use according to claim 13, characterized in that The application includes any one of increasing production and increasing biomass.

15. The use according to claim 13, characterized in that: The plant comprises at least one of rapeseed, tomato, lettuce, beet, rice, corn, soybean, potato, wheat, millet, sugarcane, sorghum, cassava, tobacco, alfalfa, rubber grass, cotton, flax, sunflower, flax mustard, sedge, hemp, and poplar.

16. A plant cultivation method, characterized in that: The modified RNA demethylase according to claim 1 or the nucleic acid according to claim 11 is introduced into an initial plant, and a target plant with optimized traits compared to the initial plant is obtained.

17. The plant cultivation method according to claim 16, characterized in that Trait optimization includes at least one of increasing yield and increasing biomass.

18. The plant cultivation method according to claim 16, characterized in that Compared to the original plant, the modified RNA demethylase according to claim 1 or the nucleic acid according to claim 11 is introduced in excess.

19. The plant cultivation method according to claim 16, characterized in that The initial plant is selected from at least one of rapeseed, tomato, lettuce, sugar beet, rice, corn, soybean, potato, wheat, millet, sugarcane, sorghum, cassava, tobacco, alfalfa, rubber grass, cotton, flax, sunflower, flax mustard, sedge, hemp, and poplar.

20. The plant cultivation method according to claim 16, characterized in that The introduced plant region includes at least one of a plant organ, a plant tissue, and a plant cell.

21. The plant cultivation method according to claim 16, characterized in that The introduced plant region is selected from the plant meristem.

22. The plant cultivation method according to claim 16, characterized in that The introduced plant region includes at least one of a cell nucleus and a cell sap of the plant.

23. The plant cultivation method according to claim 16, characterized in that The introduction method includes introducing a vector encapsulating the modified RNA demethylase according to claim 1 or the nucleic acid according to claim 11 into a plant.

24. The plant cultivation method according to claim 16, characterized in that Compared with the initial plant, the degree of trait optimization is Y, where Y is the multiple increase compared with the initial plant in the same period, Y≥3.50, preferably Y≥3.80, and more preferably Y≥4.

00.

25. A product obtained by inactivating the target plant obtained by the plant cultivation method according to claim 16.

Images