Key enzyme vvtSAD4 in wine stone acid biosynthesis and its coding gene and application

Abstract

The present application relates to a wine tartaric acid biosynthesis key enzyme VvTSAD4 and an encoding gene and application thereof, and belongs to the technical field of biological genetic engineering. The amino acid sequence of the wine tartaric acid biosynthesis key enzyme VvTSAD4 is shown as SEQ ID NO. 1. The present application also discloses a recombinant expression vector containing the wine tartaric acid biosynthesis key enzyme VvTSAD4, a recombinant genetic engineering bacterium or a transgenic plant tissue, and the application of the wine tartaric acid biosynthesis key enzyme VvTSAD4. The wine tartaric acid biosynthesis key enzyme VvTSAD4 of the present application can promote the biosynthesis of tartaric acid in grape fruits, increase the content of tartaric acid in grapes, and is easy to popularize and apply.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological genetic engineering, and relates to a key enzyme VvTSAD4 for biosynthesis of wine tartaric acid and a coding gene thereof. BACKGROUND

[0002] Vitis vinifera belongs to one of the four major fruits in the world, has high nutritional value and economic value, is an important fruit tree crop in China, has a long history of cultivation, has a large cultivation area, and has a continuous yield increase.

[0003] In recent years, global warming has attracted great attention of the world viticulture and wine industry, it causes spatial shift of high-quality viticulture area, makes some viticulture suitable areas become sub-suitable areas, greatly affects the distribution of viticulture varieties and wine types. And causes the grape fruit to mature in advance, the acidity to degrade too fast, the aroma accumulation to be insufficient, makes the grape wine alcohol content too high, the taste flat, the quality poor.

[0004] In order to cope with the influence of global warming on the wine industry, the cultivation measures such as covering sunshade net and using antitranspirant are used to inhibit the rapid accumulation of grape sugar and the rapid degradation of organic acid (mainly malic acid), which has achieved certain results.

[0005] The cultivation area of viticulture accounts for more than 75% of Mile and Qiubei counties in Yunnan Province, and faces more serious situation, during the conversion of viticulture (such as crystal), it faces the same season of rain and heat, not only the acidity degrades fast, but also the accumulation of sugar is insufficient. Insufficient acidity will lead to high pH of grape wine fermentation liquor, poor microbial stability, in order to improve the acidity of fermentation liquor and the microbial stability during fermentation, a large amount of tartaric acid is added to adjust the pH in wine making, sometimes sugar is added to make up for the insufficient sugar content of fermentation liquor to increase the alcohol content, which greatly increases the production cost of enterprises.

[0006] Tartaric acid is a characteristic acid of grape, has good stability during the conversion of viticulture, is the most important contributor to the acidity of mature grape and grape wine, accounts for about 70% to 90% of the total amount of organic acid in grape wine, and affects the acid feeling characteristics and antioxidant and anti-corrosion ability of grape wine. Malic acid is another main organic acid of grape fruit, but most of it is catabolized or metabolized during the conversion of grape, and temperature rise will accelerate this metabolic process. Therefore, the content of tartaric acid in grape wine is particularly important for the preservation of acidity of viticulture and grape wine production, the increase of tartaric acid content can prolong the fruiting time of viticulture, promote the accumulation of sugar or flavor substances, so the new strategy of biologically regulating the accumulation of endogenous tartaric acid in grape or directionally cultivating high-tartaric-acid-accumulation-type excellent viticulture varieties is urgently developed.

[0007] However, there is still lack of sufficient theoretical basis for the biological regulation of tartaric acid, and the enzymes in the synthesis pathway have not been completely confirmed. The synthesis of tartaric acid from ascorbic acid is the main pathway of grape tartaric acid biosynthesis. Although the L-galactose pathway from D-mannose to ascorbic acid is very clear, most of the enzymes in the biosynthesis process from ascorbic acid to tartaric acid have not been confirmed, and the biosynthesis process of tartaric acid is still lack of sufficient understanding.

[0008] Therefore, how to overcome the deficiencies of the prior art is a problem that needs to be solved in the field of biological genetic engineering technology at present. SUMMARY

[0009] The purpose of the present application is to solve the deficiencies of the prior art, and provide a grape tartaric acid biosynthesis key enzyme VvTSAD4, a coding gene thereof and an application thereof.

[0010] To achieve the above-mentioned purpose, the technical scheme adopted by the present application is as follows:

[0011] The present application provides a grape tartaric acid biosynthesis key enzyme VvTSAD4 in the first aspect, and the amino acid sequence of the grape tartaric acid biosynthesis key enzyme VvTSAD4 is shown in SEQ ID NO. 1.

[0012] The present application provides a gene encoding the above-mentioned grape tartaric acid biosynthesis key enzyme VvTSAD4 in the second aspect.

[0013] Further, preferably, the coding sequence of the gene is the nucleotide sequence shown in SEQ ID NO. 2.

[0014] The present application provides a recombinant vector containing the above-mentioned gene in the third aspect.

[0015] The present application provides a recombinant genetically engineered bacterium or transgenic plant tissue obtained by transformation of the above-mentioned recombinant vector in the fourth aspect.

[0016] The present application provides the application of the above-mentioned grape tartaric acid biosynthesis key enzyme VvTSAD4 in improving the tartaric acid content of grape fruit in the fifth aspect.

[0017] Based on the research and development of the present application, the inventors speculate that the grape tartaric acid biosynthesis key enzyme VvTSAD4 of the present application can catalyze the generation of tartaric acid from tartaric aldehyde.

[0018] The amino acid sequence of the grape tartaric acid biosynthesis key enzyme VvTSAD4 is shown in SEQ ID NO. 1, which contains 531 amino acids, belongs to stable protein, hydrophilic protein, non-secretory protein and non-transmembrane protein, and contains 62 phosphorylation sites.

[0019] The application proves that the VvTSAD4 gene plays a role in wine tartaric acid biosynthesis through gene transient overexpression and heterologous tomato genetic transformation.

[0020] Compared with the prior art, the application has the beneficial effects that:

[0021] The application provides a wine tartaric acid biosynthesis key enzyme VvTSAD4, expression of which can promote mass accumulation of tartaric acid, and plays an important role in improving grape fruit quality. Overexpression of VvTSAD4 in grape fruits can increase the TA content by 18.8%. Overexpression of VvTSAD4 in tomatoes can increase the TA content by about 4.7 times. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 is a research technical roadmap of the wine tartaric acid biosynthesis key enzyme VvTSAD4 of the application;

[0023] Figure 2 is a column chart of tartaric acid contents in different periods of grape fruit development; wherein, all the average numbers are arranged in descending order, and the largest average number is marked with a letter a; and the average number is compared with each of the following average numbers, and if the difference is not significant, the letter a is marked; until an average number which is significantly different from the letter b is marked; and the average number marked with b is taken as a standard to compare with each of the above average numbers which is greater than it, and if the difference is not significant, the letter b is marked; and the largest average number marked with b is taken as a standard to compare with each of the following average numbers which is not marked, and if the difference is not significant, the letter b is marked; until an average number which is significantly different from the letter c is encountered, and the process is repeated; if there is one same letter marked, the difference is not significant, and if there are different letters marked, the difference is significant; the significant level alpha is 0.05;

[0024] Figure 3 is a chart of expression amounts of the wine tartaric acid biosynthesis key enzyme VvTSAD4 in different periods of grape fruit development; wherein, the significant level alpha is 0.05;

[0025] Figure 4 is a domain analysis chart of the wine tartaric acid biosynthesis key enzyme VvTSAD4 of the application;

[0026] Figure 5 is an identification chart of the VvTSAD4 cloned in the embodiment of the application; wherein, M represents DL250bp DNA Marker, and 1-2 are both VvTSAD4 CDS full-length electrophoresis products;

[0027] Figure 6The identification figure of VvTSAD4 cloned for the embodiment of the application connected to the identification figure of overexpression vector; wherein, M represents DL250bp DNA Marker, 1-5 are all PCR electrophoretic products of bacterial liquid with pC1300-VvTSAD4 recombinant plasmid;

[0028] Figure 7 The figure of tartaric acid content after VvTSAD4 gene is transformed into grape fruit; wherein, the significant level α=0.05;

[0029] Figure 8 The figure of expression amount after VvTSAD4 gene is transformed into grape fruit; wherein, the significant level α=0.05;

[0030] Figure 9 The cluster and genetic distance prediction of grape VvTSAD4 protein;

[0031] Figure 10 The positive identification figure of VvTSAD4 gene transformed tomato; wherein, M represents DL250bp DNA Marker.

[0032] Figure 11 The TA content determination figure of VvTSAD4 gene transformed tomato; wherein, the significant level α=0.05. DETAILED DESCRIPTION

[0033] The application will be further described in detail below with examples.

[0034] Those skilled in the art will understand that the following examples are for illustration only and should not be taken as limiting the scope of the present application. In the examples, the specific techniques or conditions are not specified, the techniques or conditions described in the literature in the art or according to the product manual are used. The materials or equipment not specified by the manufacturer are all conventional products that can be purchased.

[0035] Example 1 Genetic evolution analysis of VvTSAD4, a key enzyme in tartaric acid biosynthesis of grape

[0036] The VvTSAD4, a key enzyme in tartaric acid biosynthesis of grape, screened from transcriptome data, was subjected to homology detection by BLASTp function in NCBI database, and cluster and genetic distance analysis was performed by MEGA software, and two development trees were obtained. Figure 9 According to the development tree results, the VvTSAD4 protein is closely related to succinic semialdehyde dehydrogenase (>XP002265514.1) and unnamed protein (>CBI24145.3) in grape (Vitis vinifera).

[0037] Example 2 Expression pattern of key enzyme VvTSAD4 in tartaric acid biosynthesis and its relationship with tartaric acid accumulation in grape berries

[0038] The tartaric acid content of the samples was determined at four developmental stages of the‘Beitun’grape berries, i.e., fruit setting stage (E-L-27), pea size stage (E-L-31), color change stage (E-L-35), and mature stage (E-L-38). Each sample was set in triplicate, and the tartaric acid content of the grape berries was determined as follows:

[0039] The fruit samples were ground into powder under the protection of liquid nitrogen, and 1.000 g of the sample was accurately weighed into a 25 mL centrifuge tube, 10 mL of 20 g / L metaphosphoric acid solution was added, and the mixture was vortexed and mixed, then ultrasonic oscillation extraction was performed for 5 min under ice bath conditions. Subsequently, centrifugation was performed at 8000 r / min and 4°C for 10 min, and the supernatant was collected and filtered with a 0.45 μm filter membrane before determination.

[0040] High performance liquid chromatography (HPLC) chromatographic conditions and preparation of standard:

[0041] An Agilent 1260xilie high performance liquid chromatograph G1314F VWD series detector was used for analysis, and the chromatographic column was a ZORBAX SB-C18 (4.6×250 mm, 5 μm) from the United States.

[0042] Mobile phase: The mobile phase was a mixture of 0.1% phosphoric acid solution and methanol at a volume ratio of 97.5:2.5, and the mixture was isocratically eluted for 12 min. The column temperature was 25°C, the detection wavelength was 210 nm, and the injection volume was 10 μL. The method was used for determination of the tartaric acid (TA) content.

[0043] Standard curve preparation: 0.2 g of tartaric acid (TA) was accurately weighed and dissolved in a 0.1% aqueous phosphoric acid solution to obtain a standard solution. The standard solution was diluted to prepare a mixed standard solution with concentrations of 0.5 mg / ml, 1 mg / ml, and 2 mg / ml. The mixed standard solution was filtered with a 0.45 μm water filter membrane and stored in a brown sample bottle. The TA standard sample was eluted using the mobile phase program described above for determination of the tartaric acid (TA) content. Then, a standard curve was prepared with the standard sample concentration as the horizontal axis and the peak area as the vertical axis.

[0044] The detection results are shown in Table 1. Figure 2 As shown in Table 1, the tartaric acid content accumulated in large amounts in the‘Beitun’grape berries at the fruit setting stage (E-L-27) and pea size stage (E-L-31), and the concentration began to decrease after color change. The tartaric acid content increased by 4.094 mg / g at the E-L-31 stage compared with the E-L-27 stage.

[0045] Fruit samples from four developmental stages of the grape 'Beichun' variety were collected: fruit setting (EL-27), fruit size (EL-31), color change (EL-35), and maturity (EL-38). Three replicates were performed for each stage. 100 mg of fruit pulp was rapidly ground into powder in liquid nitrogen. Total plant RNA was extracted using the Qingke Biotechnology RNAprep Pure Polysaccharide Polyphenol Plant Total RNA Extraction Kit, and cDNA was synthesized using the FastKing RT Kit (with gDNase). Detailed instructions for the kit are provided below. Gene expression levels were determined using an Applied Biosystems ABI 7500 quantitative PCR instrument. The fluorescent quantitative primers were:

[0046] Forward primer qVvTSAD4-F: agtctacttcggagccagt; (SEQ ID NO.3)

[0047] Reverse primer qVvTSAD4-R: atcattcgtctcctgccctc. (SEQ ID NO.4)

[0048] The qPCR reaction system is shown in Table 1, and the reaction procedure is shown in Table 2.

[0049] Table 1. qPCR reaction system (20 μL)

[0050]

[0051] Table 2 qPCR reaction procedures

[0052]

[0053] Analysis of the expression levels of VvTSAD4, a key enzyme in tartrate biosynthesis, in these tissues, such as Figure 3 As shown, the expression level of VvTSAD4 gene during the development of 'Beichun' fruit first increased and then decreased. At the EL-31 stage, the expression level of VvTSAD4 gene increased by 86% compared with the EL-27 stage.

[0054] Example 3: Basic information on VvTSAD4, a key enzyme in the biosynthesis of tartaric acid in wine.

[0055] The key enzyme in tartaric acid biosynthesis in wine, VvTSAD4, is annotated in the grape database as an MFS superfamily transporter. The full-length ORF of this gene is 1593 bp, encoding 531 amino acids, and is located on chromosome 19 of the grape genome. The estimated protein size of VvTSAD4 is 56.59 kDa, with an isoelectric point (pI) of 7.46.

[0056] Analyze the structure of VvTSAD4, such asFigure 4 As shown, VvTSAD4 protein contains the same TSAD (PLN02278) family domain, which is a member of superfamily CL11961.

[0057] Example 4 Transient overexpression analysis of key enzyme VvTSAD4 in wine tartaric acid biosynthesis

[0058] (1) Vector construction

[0059] The CDS full length of VvTSAD4 was cloned by using homologous arm primers with enzyme cutting sites, and was connected to pCAMBIA1300 expression vector containing BamHI and SacI sites. The vector has 35S promoter as a strong promoter. The primer sequences are as follows:

[0060] pC1300-VvTSAD4-F: ctctcgagctttcgcgagctcatggggatatcgcagatgg; (SEQ ID NO. 5)

[0061] pC1300-VvTSAD4-R: gcccttgctcaccatggatcctcagttactgcttatatttccgaag. (SEQ ID NO. 6)

[0062] The following steps were specifically followed:

[0063] a. The VvTSAD4 gene was amplified by using grape fruit cDNA template and adding specific primers (SEQ ID NO. 5 and SEQ ID NO. 6) with SacI and BamHI enzyme cutting sites, and the reaction system is shown in Table 3, and the reaction procedure is shown in Table 4. After successful sequencing comparison, the target fragment was recovered by gel (agarose gel DNA recovery kit, Tiangen), and was performed according to the manufacturer's instructions. Figure 5

[0064] Table 3 PCR reaction system

[0065] Reaction components Volume 2x Hieff Canace Gold PCR Master Mix 10 μL Forward primer (10 μM) 0.8 μL Reverse primer (10 μM) 0.8 μL cDNA 1 μL ddH2O 7.4 μL

[0066] Table 4 PCR reaction procedure

[0067]

[0068]

[0069] b. SacI and BamHI were used to double enzyme cut pCAMBIA1300 vector. The enzyme cutting system is shown in Table 5.

[0070] Table 5 pCAMBIA1300 vector enzyme cutting system ​

[0071] Reaction components Volume 10x FuniCut™ Buffer 2 μL pCAMBIA1300 vector 2 μL FuniCut™ BamHI 1 μL FuniCut™ SacI 1 μL ddH2O 14 μL

[0072] Mix the above reaction solution (do not vortex), and centrifuge immediately. Incubate at 37°C for 15 min. Use 1% agarose gel for detection, and recover the cut vector.

[0073] c. Use 2xHieff Clone MultiS Enzyme Premix to connect the recovered VvTSAD4 target fragment and linear pCAMBIA1300 vector, and perform 50°C water bath reaction for 20 min. The obtained connection product is pC1300-VvTSAD4 recombinant plasmid. The connection product is transformed into E. coli competent cells DH5a by heat shock method, and is coated on LB solid medium containing kanamycin. Single colonies are picked, and positive clones are detected by PCR (). Figure 6 ), and the positive colonies are sequenced.

[0074] d. Transform the successfully sequenced plasmid into GV3101 agrobacterium competent cells, and sequentially perform ice bath for 5 min, liquid nitrogen rapid freezing for 5 min, 37°C water bath for 5 min, ice bath for 5 min again, add 700 μL of LB liquid medium, take 80 μL of bacterial solution, and uniformly coat on LB solid medium containing kanamycin and rifampicin resistance. After air drying, place in a 28°C incubator for 24-36 h. Pick single colonies, and detect positive clones by PCR for transient transformation of grape fruit.

[0075] (2) VvTSAD4 transient overexpression transformed grape fruit and identification

[0076] In order to verify the function of VvTSAD4 in tartaric acid biosynthesis, the agrobacterium liquid containing pC1300-VvTSAD4 is used to transiently transform grape young fruit fruit by fruit stem infection method, as a test group; and pCAMBIA1300 vector is used as a control.

[0077] The infection method is as follows:

[0078] Shaking: add the agrobacterium liquid containing pC1300-VvTSAD4 to LB liquid medium containing kanamycin and rifampicin resistance, and incubate at 180 rmp and 28°C overnight; the specific culture medium involved is shown in Table 6.

[0079] Table 6

[0080]

[0081]

[0082] Bacterial solution collection: centrifuge at 7000 r / min for 7 min, and pour off the supernatant;

[0083] Resuspension and OD adjustment of bacterial solution 600 Value: Resuspend the bacterial pellet with resuspension solution, and adjust the OD of the solution with UV spectrophotometer 600 to 0.7.

[0084] Infection of grape young fruits: Grape young fruits with uniform growth and size were retained, and the peduncle was soaked with resuspension solution. The samples were randomly taken at 0 d, 2 d, 4 d, 6 d, 8 d and 10 d, and stored at -80°C after the seeds were removed. The RNA was extracted and reverse transcribed into cDNA, and qRT-PCR was performed. The reaction system for qRT-PCR determination is shown in Table 7, and the amplification program is shown in Table 8.

[0085] Table 7 Fluorescence quantitative reaction system

[0086]

[0087] Table 8 qRT-PCR amplification program

[0088]

[0089] The relative expression amount of VvTSAD4 gene showed a significant upward trend and reached a peak at 0 d to 2 d after the fruit was infected (as shown in Figure 8 ). The relative expression amount of VvTSAD4 gene at 2 d after infection was 0.54 higher than that at 0 d, and then it began to decrease significantly at 4 d. The change trend was different from that of the control group. The relative expression amount of VvTSAD4 gene at 2 d and 4 d after infection was 4.512 times and 2.1 times that of the control group, respectively. Compared with 0 d, the growth rate of the relative expression amount of the gene at 2 d was 46.12%, while that of the control group was decreased. From Figure 8 it can be seen that the transgenic grape fruits overexpressed at the DNA level.

[0090] (3) Change of tartaric acid content in VvTSAD4 overexpressing grape fruits

[0091] VvTSAD4 is closely related to grape tartaric acid biosynthesis. Through high performance liquid chromatography detection, the tartaric acid content increased significantly. As shown in Figure 7 , the tartaric acid content increased significantly at 2 d after infection, and increased by 0.3414 mg / g, 0.6159 mg / g and 0.6416 mg / g at 4 d, 6 d and 8 d after infection compared with that at 2 d, 4 d and 6 d, respectively. At 6 d and 8 d after infection, the tartaric acid content of the test group increased by 18.8% and 15.8% compared with that of the control group at the same time.

[0092] Example 5 Genetic transformation of grape tartaric acid biosynthesis key enzyme VvTSAD4 in tomato

[0093] 1. Genetic transformation in tomatoes

[0094] (1) Sowing

[0095] Soak 'Micro-Tom' tomato seeds in 75% alcohol for 1 minute, then rinse once with sterile water, sterilize with 50% 84 disinfectant for 10 minutes, and rinse 5 times with sterile water. Then, sow the treated tomato seeds onto M0 medium with sterile tweezers and incubate in the dark at 24°C for 5-6 days.

[0096] (2) Explant infection and co-culture

[0097] The pC1300-VvTSAD4 Agrobacterium tumefaciens culture was propagated to an OD600 of 0.8. The propagated culture was centrifuged at 3000 rpm for 20 min, the supernatant was discarded, 1 ml of DM medium was added to gently wash the cells, and the supernatant was discarded again. Another 1 ml of DM medium was added, and the cells were resuspended by pipetting and shaking well. The culture was then placed on ice for activation. Simultaneously, cotyledons of newly grown tomato seedlings, measuring 0.8–1.0 cm, were vertically cut from the DM medium using sterile forceps and a scalpel. 2 As explants, the cut explants were placed in pC1300-VvTSAD4 resuspension for 15 min. After infection, the explants were placed on sterile filter paper with sterile forceps to remove excess bacterial solution, and then placed on M1 medium and incubated in the dark at 24°C for 48 h.

[0098] (2) Selection of culture

[0099] After culturing on M1 medium, the explants were transferred to M2 medium and cultured selectively at 24°C under alternating light and dark conditions for 15–20 days. Differentiation culture.

[0100] After selection and culture, the explants were transferred to M3 medium for differentiation culture, and subcultured every 20 days until budding.

[0101] (3) Rooting culture

[0102] Once the buds have differentiated to the point where the growth point is clearly visible, carefully cut the buds off the callus tissue with sterile forceps and a scalpel, avoiding the inclusion of excess callus tissue and avoiding damage to the growth point. Then transfer them to M4 medium and culture them at 24℃ for 16h / 8h alternating light and dark until roots develop.

[0103] Table 9. Culture media used in the tomato genetic transformation system.

[0104]

[0105] 2. Identification of genetically transformed positive plants and determination of TA content

[0106] A portion of leaves from the rooted T0 generation tomato plants were used with a DNA extraction kit. The Plant DNA Kit (Yisheng) was used to extract DNA from tomato leaves. PCR was performed using a 557 bp hygromycin tag, Hpt-F / Hpt-R, as primers. The forward primer Hpt-F was acactacatggcgtgatttcat (SEQ ID NO.7), and the reverse primer Hpt-R was tccactatcggcgagtacttct (SEQ ID NO.8). Molecular positive detection was then performed. Figure 10 The PCR system and methods were the same as those in Tables 3 and 4. Positive tomato seedlings were then transplanted to a greenhouse for growth until maturity, at which point the fruits were harvested and seeds were saved. The seeds were then sown and subjected to routine cultivation management. The TA content of fruits from the T1 generation of transgenic VvTSAD4 lines (OE1, OE2, OE3, OE4) was measured, with wild-type 'Micro-Tom' tomato as the control (WT). The results showed that the TA content of the OE1, OE2, OE3, and OE4 lines was significantly higher than that of the WT lines. Figure 11 Compared with WT, the results were 138.52%, 304.6%, 370.71%, and 123.98%, respectively.

[0107] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.

Claims

1. Use of the key enzyme of wine tartaric acid biosynthesis VvTSAD4 for increasing the tartaric acid content in tomato fruits, characterized in that, The coding sequence of the wine tartaric acid biosynthesis key enzyme VvTSAD4 gene is the nucleotide sequence shown in SEQ ID NO. 2; the amino acid sequence of the wine tartaric acid biosynthesis key enzyme VvTSAD4 is shown in SEQ ID NO.

1. The coding sequence of the wine tartaric acid biosynthesis key enzyme VvTSAD4 gene is the nucleotide sequence shown in SEQ ID NO. 2; the amino acid sequence of the wine tartaric acid biosynthesis key enzyme VvTSAD4 is shown in SEQ ID NO.

1. The coding sequence of the wine tartaric acid biosynthesis key enzyme VvTSAD4 gene is the nucleotide sequence shown in SEQ

Images