A method and application for improving cell viability

By regulating the cell lifespan-related genes of yeast strains, and using the CRISPR/Cas9 system for gene knockout or weakening expression, the problem of neglecting cell lifespan and health status in the existing technology is solved, the efficiency of target product synthesis is improved, and the industrialization process of microbial cell factories is promoted.

CN119530268BActive Publication Date: 2025-07-29DALIAN INSTITUTE OF CHEMICAL PHYSICS CHINESE ACADEMY OF SCIENCES +1
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202410981828.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-07-22
Publication Date
2025-07-29
Estimated Expiration
2044-07-22

AI Technical Summary

Technical Problem

When preparing chemicals using microbial cell factories, the prior art ignores the key role of cell lifespan and health status on fermentation, resulting in limited product synthesis ability and lack of effective means of regulating cellular functions.

Method used

By regulating the cell lifespan and aging-related genes in yeast strains, including nutrient-sensing signaling, mitochondrial function, protein homeostasis and genomic stability, the CRISPR/Cas9 system was used for gene knockout or weakened expression, and the engineered strain was constructed to improve the synthesis efficiency of target products.

Benefits of technology

The synthesis efficiency of target products, such as the yield of perilla perilla, has promoted the industrial production of microbial cell factories, and has demonstrated universality in different yeast strains, improving the biosynthesis efficiency of multiple target products.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure GDA0005457148430000081
    Figure GDA0005457148430000081
  • Figure GDA0005457148430000082
    Figure GDA0005457148430000082
  • Figure GDA0005457148430000091
    Figure GDA0005457148430000091
Patent Text Reader

Abstract

The present invention belongs to the field of application of microbial genetic engineering and metabolic engineering, and specifically relates to a method for improving cell viability by regulating cell lifespan and its application in improving the synthesis efficiency of target products. Specifically, it regulates genes related to cell lifespan and senescence in the strain; among them, the regulatory factors related to cell lifespan and senescence are one or several regulatory factors of nutrient sensing signals, mitochondrial function, protein homeostasis, and genomic stability. This application associates cell lifespan with product synthesis, thereby improving the synthesis efficiency of target products.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of application of microbial genetic engineering and metabolic engineering, and specifically relates to a method for improving cell viability by regulating cell lifespan and its application in improving the synthesis efficiency of target products. Technical Background

[0002] Microbial cell factories provide an economical and environmentally friendly method for producing high-value chemicals from renewable and inexpensive raw materials, including biofuels, fine chemicals, and pharmaceutical chemicals. In recent years, with the development of functional genomics, metabolic engineering, and synthetic biology, Saccharomyces cerevisiae has become an ideal cell factory and is widely used in the biosynthesis process of target products (Front. Bioeng. Biotechnol., 2020, 8: 594347). Utilizing the inherent metabolism and synthesis ability of microorganisms is an effective strategy to improve the synthesis efficiency of products, and a series of modification strategies have been developed accordingly, including genome-scale engineering (Cell, 2018, 174(6): 1549-1558), promoter engineering (Trends. Biotechnol., 2020, 38(5): 468-469), modular pathway engineering (Nat. Commun., 2013, 4: 1409), transporter engineering (Proc. Natl. Acad. Sci. U.S.A., 2018, 115(12): 2964-2969), and cofactor engineering (Nat. Chem. Biol., 2022, 18, 520-529), etc. However, an efficient catalytic reaction process often relies more on high-performance, highly active, and long-lived cells. At the cellular level, the lack of a full understanding of cell function will severely limit the product synthesis ability.

[0003] Cell lifespan is an important indicator of cell performance, and senescence is an important fundamental property of cell lifespan. More than 20 years ago, the lifespan of cells began to be studied using Saccharomyces cerevisiae as a model organism. So far, a relatively deep understanding has been achieved, and many lifespan-related genes and pathways have been analyzed, such as nutrient sensing factors (Cell, 2011, 146, 969-979), proteostasis (PLoS Genet., 2011, 7, e1002253), and autophagy (Rev. Genet., 2009, 43, 67-93). Corresponding environmental and genetic means can improve the stress resistance of cells to internal and external pressures (Science, 2010, 328, 321-326), extend cell lifespan, and provide potential methods for enhancing cell synthesis ability. However, in current research on the preparation of chemicals using microbial cell factories, it is still limited to traditional metabolic engineering modification strategies, ignoring the key role of cell lifespan and health status in microbial fermentation, and there is no reported research on associating lifespan regulation with the preparation of chemicals by microbial cell factories. Summary of the Invention

[0004] The object of the present invention is to improve the synthesis efficiency of target products, and thus a method for improving cell viability by regulating cell lifespan and its application in improving the synthesis efficiency of target products are proposed.

[0005] To achieve the above object, the technical solution adopted by the present invention is as follows:

[0006] A method for improving cell viability, which regulates genes related to cell lifespan and senescence in a strain; wherein, the regulatory factors related to cell lifespan and senescence are one or more of nutrient sensing signals, mitochondrial function, proteostasis, and genomic stability.

[0007] In the first aspect, regulatory factors related to cell nutrient sensing and a method for constructing a strain are provided to regulate cell lifespan, and thus improve the synthesis efficiency of target products. For example, improve the synthesis efficiency of sclareol.

[0008] The regulatory factors include Tor1, Sch9, Gpa2, Gpr1, Ras1, Ras2, Bcy1, Tpk1, Tpk3, Hxt1, Hxk2, Vhs1, Reg1, Mig1.

[0009] Optionally, the method for constructing the strain includes:

[0010] 1) In a yeast strain, knockout any one or several of Tor1, Sch9, Gpa2, Gpr1, Ras1, Ras2, Bcy1, Tpk1, Tpk3, Hxt1, Hxk2, Vhs1, Reg1, Mig1.

[0011] Furthermore, in the sclareol-producing yeast strain SCX42, any one or several of Tor1, Sch9, Gpa2, Gpr1, Ras1, Ras2, Bcy1, Tpk1, Tpk3, Hxt1, Hxk2, Vhs1, Reg1, and Mig1 are knocked out.

[0012] In a specific embodiment, the CRISPR / Cas9 system is used to seamlessly knock out the target gene. First, donor DNA is obtained by fusion PCR, including a 500-bp upstream homologous arm and a 500-bp downstream homologous arm; second, a gRNA plasmid targeting the target gene is constructed (for the specific method, reference can be made to the inventor's previously authorized patent ZL 202010428088.2); then, 500 ng each of the gRNA plasmid and donor DNA are transformed into the sclareol-producing yeast strain SCX42 (Metab. Eng., 2023, 75, 19-28). The genomic DNA of the obtained transformants is extracted for PCR verification, and the strains with correct verification are used for sclareol fermentation. The fermentation medium is a basal medium containing 20 g / L glucose, cultured at 30 °C and 220 rpm for 96 h, and the sclareol yield is determined by gas chromatography.

[0013] 2) In the yeast strain, the genes Tor1 and / or Sch9 are weakly expressed;

[0014] Furthermore, in the sclareol-producing yeast strain SCX42, the genes Tor1 and / or Sch9 are weakly expressed.

[0015] In a specific embodiment, the CRISPR / Cas9 system is used to seamlessly knock out the target gene. First, donor DNA is obtained by fusion PCR, including a 500-bp upstream homologous arm, a promoter, a gene, a CLN2 tag, a terminator, and a 500-bp downstream homologous arm; second, a gRNA plasmid targeting the target gene is constructed (for the specific method, reference can be made to the inventor's previously authorized patent ZL 202010428088.2); then, 500 ng each of the gRNA plasmid and donor DNA are transformed into the sclareol-producing yeast strain SCX42 (Metab. Eng., 2023, 75, 19-28). The genomic DNA of the obtained transformants is extracted for PCR verification, and the strains with correct verification are used for sclareol fermentation. The fermentation medium is a basal medium containing 20 g / L glucose, cultured at 30 °C and 220 rpm for 96 h, and the sclareol yield is determined by gas chromatography.

[0016] Unless otherwise specified, gene knockout, transformation verification, and fermentation production involved in the present invention all follow the above procedures.

[0017] In a second aspect, regulatory factors related to mitochondrial function and a method for constructing strains are provided to regulate cell lifespan and thereby improve the synthesis efficiency of target products. For example, the synthesis efficiency of sclareol is improved.

[0018] The regulatory factors include Ppg1, Atg32, Far3, Far7, Far8, Far9, and Far11.

[0019] Optionally, the method for constructing strains includes:

[0020] In a yeast strain, knocking out any one or several of Ppg1, Atg32, Far3, Far7, Far8, Far9, and Far11.

[0021] Furthermore, in the sclareol-synthesizing yeast strain SCX42, knocking out any one or several of Ppg1, Atg32, Far3, Far7, Far8, Far9, and Far11.

[0022] In a third aspect, regulatory factors related to protein homeostasis and a method for constructing strains are provided to regulate cell lifespan and thereby improve the synthesis efficiency of target products. For example, the synthesis efficiency of sclareol is improved.

[0023] The regulatory factors include Atg1, Atg24, Atg40, Ume6, Atg8, Atg9, Ubr2, Ump1, and Hac1.

[0024] Optionally, the method for constructing strains includes:

[0025] 1) In the yeast strain SCX42, knocking out any one or several of Atg1, Atg24, Atg40, Ume6, and Ubr2.

[0026] Furthermore, in the sclareol-synthesizing yeast strain SCX42, knocking out any one or several of Atg1, Atg24, Atg40, Ume6, and Ubr2.

[0027] 2) In a yeast strain, overexpressing any one or several of Atg8, Atg9, Ump1, and Hac1.

[0028] Furthermore, in the sclareol-synthesizing yeast strain SCX42, overexpressing any one or several of Atg8, Atg9, Ump1, and Hac1.

[0029] In a specific embodiment, the target gene is integrated into a neutral site in the genome using the CRISPR / Cas9 system. First, donor DNA, that is, the expression cassette of the target gene, is obtained by fusion PCR, including a 500 bp upstream homologous arm, a promoter, the target gene, a terminator, and a 500 bp downstream homologous arm; 500 ng each of the gRNA plasmid targeting a specific neutral site (FEMS Microbiol. Lett., 2022, 369, 1-5) and donor DNA are transformed into the sclareol-producing yeast strain SCX42 (Metab. Eng., 2023, 75, 19-28). The genomic DNA of the obtained transformants is extracted for PCR verification, and the strains with correct verification are used for sclareol fermentation.

[0030] Unless otherwise specified, all gene expression operations involved in the present invention follow the above process.

[0031] Fourthly, regulatory factors related to genomic stability and a method for constructing strains are provided to regulate cell lifespan and thereby improve the synthesis efficiency of target products. For example, the synthesis efficiency of sclareol is improved.

[0032] The regulatory factors include Sir2, Hst1, Hst2, Hst3, Hst4, Fob1, Hir1, Ure2, Bmh1, Rad53, Ssd1.

[0033] Optionally, the method for constructing the strain includes:

[0034] In the yeast strain, any one or several of Sir2, Hst1, Hst2, Hst3, Hst4, Fob1, Hir1, Ure2, Bmh1, Rad53, Ssd1 are knocked out.

[0035] Furthermore, in the sclareol-producing yeast strain SCX42, any one or several of Sir2, Hst1, Hst2, Hst3, Hst4, Fob1, Hir1, Ure2, Bmh1, Rad53, Ssd1 are knocked out.

[0036] The yeast host strain includes, but is not limited to, Saccharomyces cerevisiae, Pichia pastoris, Hansenula polymorpha, Yarrowia lipolytica, Kluyveromyces marxianus; the products include, but are not limited to, fatty acids and their derivatives, terpenoids, flavonoids, etc.

[0037] Optionally, the method for constructing the engineered strain is to knockout Tor1;

[0038] Optionally, the target products include fatty acid derivatives such as fatty alcohols, terpenoids such as sclareol, β-elemene, and flavonoids such as xanthohumol.

[0039] An engineered strain for preparing a target product is obtained by the described method, and an engineered strain for preparing the target product is constructed according to the described method.

[0040] The target product is one or more of fatty acids and their derivatives, terpenoids, and flavonoids.

[0041] The target product is sclareol.

[0042] An application of the described method, the application of the method in preparing a target product; wherein, the target product is one or more of fatty acids and their derivatives, terpenoids, and flavonoids.

[0043] The application of the method in preparing sclareol; wherein, the target product is one or more of fatty acids and their derivatives, terpenoids, and flavonoids.

[0044] The beneficial effects that can be produced by this application include:

[0045] The present invention aims to improve the synthesis efficiency of target products by regulating genes and pathways related to the lifespan of Saccharomyces cerevisiae, including endogenous primary metabolites such as fatty acids and fatty alcohols, as well as heterologous secondary metabolites such as sclareol, so as to provide a new idea for optimizing microbial cell factories and promoting the industrialization process of biomanufacturing; specifically:

[0046] (1) The method of regulating cell lifespan to improve the biosynthesis efficiency of target products in the present invention first associates cell lifespan with product synthesis, and promotes the industrial production of products represented by sclareol.

[0047] (2) The related target genes provided by the present invention that can improve the yield of target products will also play an important role in the synthesis of other target products. Description of the Drawings

[0048] Figure 1 It is a diagram of the main lifespan-related mechanisms of yeast provided by an embodiment of the present invention.

[0049] Figure 2 It is an effect diagram of the influence of tor1Δ, sch9Δ, ras2Δ, and ppg1Δ on the sclareol yield provided by an embodiment of the present invention.

[0050] Figure 3 It is an effect diagram of the influence of the deletion of nutrition-sensing related factors on the sclareol yield provided by an embodiment of the present invention.

[0051] Figure 4 It is an effect diagram of the influence of the weak expression of TOR1 and SCH9 on cell growth and sclareol yield provided by an embodiment of the present invention.

[0052] Figure 5 The figure showing that the deletion of the Far complex provided by the embodiment of the present invention can relieve the inhibition of mitophagy, thereby increasing the production of sclareol.

[0053] Figure 6 The figure showing that the weakening of nutrient sensing and the relief of mitophagy inhibition provided by the embodiment of the present invention coordinately increase the production of sclareol.

[0054] Figure 7 The figure showing that the significant reduction of the cell mortality rate in the late fermentation stage by regulating the lifespan-related genes provided by the embodiment of the present invention.

[0055] Figure 8 The figure showing that tor1Δ provided by the embodiment of the present invention improves the biosynthesis efficiency of yeast cells. Detailed implementation manners

[0056] The following non-limiting embodiments can enable those of ordinary skill in the art to more comprehensively understand the present invention, but do not limit the present invention in any way. In the following embodiments, unless otherwise specified, the experimental methods used are all conventional methods, and the materials, reagents, etc. used can be purchased from biological or chemical companies.

[0057] Example 1 Preliminary exploration of the association between cell lifespan and product synthesis

[0058] The sclareol-producing strain SCX42 of the embodiment of the present invention was reported in the paper Metab. Eng., 2023, 75, 19 - 28. In order to preliminarily explore the effect of regulating cell lifespan on the production of sclareol, the nutrient sensing representative factors Tor1, Sch9, and Ras2, as well as the mitophagy regulator Ppg1, were selected for verification.

[0059] In the strain SCX42, the above genes were knocked out according to the CRISPR / Cas9-based gene editing method described above to obtain the corresponding engineered strains.

[0060] The fermentation method of the engineered strain for sclareol is as follows:

[0061] (1) Culture medium

[0062] YPD medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract;

[0063] Fermentation medium (basic component medium): Glucose 20 g / L, (NH4)2SO4 2.5 g / L, KH2PO4 14.4 g / L, MgSO4·7H2O 0.5 g / L, vitamins (Table 1), trace metals (Table 2). Adjust the initial pH to 5.6 with KOH. When in use, select to add 20 mg / L uracil and 60 mg / L histidine as needed.

[0064] Table 1 Vitamin formulation table (1000×)

[0065] Reagent Concentration (g / L) D-Biotin 0.05 Calcium D-Pantothenate 1.0 Ammonium Sulfate 1.0 Pyridoxol 1.0 Nicotinic Acid 1.0 p-Aminobenzoic Acid 0.2 Inositol 25.0

[0066] Table 2 Trace metal formulation table (500×)

[0067] Reagent Concentration (g / L) <![CDATA[FeSO4·7H2O]]> 3.0 <![CDATA[ZnSO4·7H2O]]> 4.5 <![CDATA[CaCl2·2H2O]]> 4.5 <![CDATA[MnCl2·4H2O]]> 1.0 <![CDATA[CoCl2·6H2O]]> 0.3 <![CDATA[CuSO4·5H2O]]> 0.3 <![CDATA[Na2MoO4·2H2O]]> 0.4 <![CDATA[H3BO3]]> 1.0 KI 0.1 <![CDATA[Na2EDTA·2H2O]]> 19.0

[0068] (2) Experimental procedures and conditions

[0069] Streak and activate the engineered strain on a YPD plate. Pick single colonies into 3 / 15 mL of YPD liquid medium and culture with shaking at 30 °C and 220 rpm for 16 h. Inoculate. Wash the seed liquid twice with the fermentation medium and inoculate it into the fermentation medium at an initial OD 600 = 0.1. The liquid loading volume is 20 mL / 100 mL conical flask, and ferment for 72 - 96 h at 30 °C and 220 rpm. Sample at fixed points or at the end point for the analysis of biomass (represented by the absorbance value at 600 nm) and the production of sclareol.

[0070] (3) Sclareol synthesis

[0071] The results showed that the deletion of the nutrient sensing factors Tor1, Ras2 and the negative regulator of mitophagy Ppg1 could significantly increase the production of sclareol ( Figure 2 ). As an upstream of PKA, the deletion of Ras2 could increase the production. Further, the effects of cell lifespan on the product synthesis efficiency were systematically explored from four aspects: nutrient sensing, mitochondrial function, protein homeostasis and genomic stability.

[0072] Example 2 Weakening of the nutrient sensing pathway to increase the production of sclareol

[0073] This part details the effects of the transformation of the nutrient sensing pathways PKA and TORC1 on the production ( Figure 3A). Specifically, in the strain SCX42, the CRISPR / Cas9 system was used to seamlessly knockout the genes related to the PKA pathway and the TORC1 pathway. The specific genes are shown in Table 3. The CAS9 gene was integrated into SCX42 in the starting strain. The donor DNA fragments (500 bp homologous arms upstream and downstream) corresponding to the genes in Table 3 were obtained by fusion PCR. The construction method of the sgRNA expression vector can refer to the previous authorized patent ZL 202010428088.2 of the inventor. The corresponding 20 bp gRNA sequences are shown in Table 4. The sgRNA expression vector and the donor DNA (500 ng each) were transformed into SCX42 by chemical transformation method, coated on the screening plate and statically cultured at 30 °C for 3 days. After the transformants were cultured in liquid SD medium, they were verified correct by colony PCR, and then coated on the plate containing 5-fluoroorotic acid for plasmid loss to obtain the corresponding engineering strains. And under the above culture conditions, sclareol fermentation was carried out.

[0074] Table 3 Information of genes related to the PKA pathway and the TORC1 pathway

[0075] Gene Name NCBI No. Gene Name NCBI No. TOR1 QHB09690.1 RAS1 QHB11701.1 RAS2 QHB11279.1 TPK1 QHB09470.1 PPG1 QHB11409.1 TPK2 QHB12062.1 GPR1 QHB07444.1 TPK3 QHB09836.1 GPA2 QHB08090.1

[0076] Table 4 Information of targeted sgRNA sequences of genes related to the PKA pathway and the TORC1 pathway

[0077] Gene Name 20bp sgRNA Sequence (5’-3’) TOR1 CAAATGGCAGAATTCACCAG / ATTAACCAGTGATTACAAGG RAS2 TGCTAAGCAAGCAATCAACG / AAGCAGCAAGCTGCACCCGG PPG1 AGACAGGGGGTTGTACAGTG / GCAGAGCTATGGTTTCTACA GPR1 CATATCCCAATATACGACAG / AGTTTTGTCACAGCAATTGG GPA2 AGCGCTGGTAGTGACAACGT / CGGCGGGTCAGACATCAACA RAS1 ATTCATTCAATCATACTTTG / ATAAGACAGTAACTCATCAA TPK1 TTTACATCTTCGTTGAAAAA / AGTAAGTCTGTAGAAAAAGA TPK2 ACGTATGAAAAGATTTTACA / CATGGTTTAGTGAAGTTGTA TPK3 TCTTTCATTAAATCCATATA / TATATTTTCGTAAGTTTTCA

[0078] The results showed that the weakening of the nutrient sensing pathway could increase the yield of sclareol ( Figure 3 B). In addition to the effective targets Tor1 and Ras2 in Example 1, the knockout of Gpa2 and Gpr1 could also promote the synthesis of sclareol. However, it should be noted that this pathway is not the weaker the better. For example, the knockout of Sch9 did not increase the yield but decreased slightly. Therefore, the weak expression of some targets may be more beneficial to product synthesis than complete blockade.

[0079] Therefore, taking the effective target Tor1 and the reverse target Sch9 as examples respectively, the knockout was changed to weakening, and the degradation tag CLN2 was used to weaken the expression intensity of the TOR1 and SCH9 genes, and the strains TOR1-CLN2 and SCH9-CLN2 were obtained respectively. The results showed that the weak expression of TOR1 could significantly improve cell growth and make it consistent with the starting strain ( Figure 4 A), and could also significantly increase the yield of sclareol by more than 20% ( Figure 4 B). However, the weakening of SCH9 expression still did not improve cell growth and product synthesis ( Figure 4 ). Therefore, weakening the expression intensity of lifespan-related genes is another effective means to balance cell growth and product synthesis, which is beneficial to subsequent industrial production.

[0080] Example 3: Relieving mitochondrial autophagy inhibition and increasing sclareol production

[0081] During mitophagy, Ppg1 and the Far complex synergistically inhibit the phosphorylation of Atg32, thereby inhibiting the progression of mitophagy. This section explores in detail whether the subunits of the Far complex, including far3, far7, far8, far9, and far11, play similar functions to Ppg1.

[0082] Specifically, in strain SCX42, mitophagy-related genes, including FAR3, FAR7, FAR8, FAR9, and FAR11, were seamlessly knocked out. The specific gene information is shown in Table 5. The specific gene manipulation process is the same as that shown in Example 2, and the sgRNA sequence information is shown in Table 6.

[0083] Table 5 Information on genes related to the mitochondrial autophagy pathway

[0084] Gene Name NCBI No. FAR3 QHB10784.1 FAR7 QHB08343.1 FAR8 QHB10764.1 FAR9 QHB07659.1 FAR11 QHB11253.1

[0085] Table 6 sgRNA sequence information targeting genes related to the mitochondrial autophagy pathway

[0086] Gene Name 20bp sgRNA Sequence (5’-3’) FAR3 AAAAGCATCTCCCCCCACTG / ATACCTGCAAGACACGTACC FAR7 GCGAAAGATGACGTTATGCT / TGAAGAACCTCACGATACCA FAR8 CGACATTATCAGCTCCTACG / ACTGAACGTGAATACTCCCA FAR9 CAATTCAATAGACCCAACAC / AACGGAATAAAGATAGACAG FAR11 ACATTATCAAGCATTCAGGG / ATTGTCCCTAAAGTCAGCAG

[0087] The results showed that the loss of any subunit in the Far complex could increase the yield of sclareol. Combined with the results of Example 1, it was shown that relieving the inhibitory effect of mitochondrial autophagy could promote product synthesis ( Figure 5 ).

[0088] Example 4 Effect of Regulating Protein Homeostasis and Genome Stability on Product Synthesis

[0089] Twenty regulatory factors related to protein homeostasis, genome stability, and other lifespan were knocked out or overexpressed to obtain the corresponding engineered strains as shown in Table 7.

[0090] According to the records in Example 2 above, the corresponding engineered strains were obtained in strain SCX42 according to the records in Table 7. The gene sequence information is shown in Table 7, and the sgRNA sequence is shown in Table 8. For overexpressed genes, including ATG8, ATG9, UMP1, and HAC1, the gene sequence information, promoter, and terminator information are detailed in Table 9, and the corresponding donor DNA was obtained by fusion PCR technology. For the integration site gRNA sequence and site sequence information, please refer to the article FEMS Microbiol. Lett., 2022, 369, 1-5 published by the applicant's research group. The corresponding sclareol yield can then be determined by operating according to the fermentation method of the engineered strain sclareol in Example 1.

[0091] Overall, protein homeostasis and genomic stability had relatively minor effects on sclareol production, with most factors failing to improve product yield. However, a few factors, such as Atg8, Atg9, Ump1, Fob1, and Ssd1, significantly increased sclareol production, providing valuable insights for other product synthesis processes.

[0092] Table 7 Effects of regulating protein homeostasis and genome stability on sclareol production

[0093]

[0094] Table 8 sgRNA sequence information targeting genes related to protein homeostasis and genome stability

[0095]

[0096]

[0097] Table 9 Construction of gene expression cassettes related to protein homeostasis and genome stability

[0098]

[0099] Example 5: Removal of mitochondrial autophagy inhibition and weakening of nutrient sensing pathways synergistically increase sclareol production

[0100] These results suggest that inhibition of negative regulators of mitochondrial autophagy, the nutrient-sensing factor TORC1, and PKA can enhance sclareol production. Therefore, this study further investigated the potential for synergistic enhancement of sclareol production by combining these three factors in pairs.

[0101] Specifically:

[0102] Following Example 2, the TOR1, RAS2, and PPG1 genes were individually or combinedly knocked out in strain SCX42 to obtain the corresponding engineered strains. Gene sequence information and sgRNA sequence information are shown in Tables 3 and 4. The sclareol production yield of the engineered strains was then determined using the fermentation method described in Example 1.

[0103] The results showed that the combined deletion of tor1Δppg1Δ and ras2Δppg1Δ could further increase the yield, reaching 1.3 g / L and 1.2 g / L, respectively. Figure 6 A).

[0104] Furthermore, by separately detecting the accumulation of sclareol during the glucose utilization stage and the ethanol utilization stage of the strain, it was found that the increase in production promoted by knocking out Tor1 and Ppg1 mainly occurred in the ethanol utilization stage, and the engineered strain did not cause the background production mode in the two stages, further indicating that knocking out Tor1 and Ppg1 acts at the cellular level. By observing the cell survival at different fermentation times, the cell mortality of the engineered strains (tor1Δ, ras2Δ, ppg1Δ, gpr1Δ, tor1Δppg1Δ, tor1Δgpr1Δ, ras2Δppg1Δ) was significantly reduced in the later stage of fermentation ( Figure 7 , with the dark color representing dead cells), indicating that regulating the cell lifespan and aging process to extend the cell survival time and maintain cell activity is an effective strategy to improve the synthesis efficiency of the target product.

[0105] Example 6: Regulating lifespan-related genes to promote the synthesis efficiency of different yeasts and different products

[0106] The above results demonstrated that by regulating the genes and pathways related to yeast cell lifespan and aging, the biosynthesis efficiency of the secondary metabolite sclareol can be significantly improved. To verify the universality of this regulation method and strategy, on the one hand, taking sclareol as an example, the effects of knocking out the gene TOR1 on product synthesis were tested in other yeast chassis, such as Pichia pastoris, Hansenula polymorpha, Yarrowia lipolytica, and Kluyveromyces marxianus.

[0107] Specifically: The key lifespan regulatory gene TOR1 was knocked out in different yeasts, including Saccharomyces cerevisiae, Pichia pastoris, Hansenula polymorpha, Yarrowia lipolytica, and Kluyveromyces marxianus. The specific operation steps are as follows: By fusion PCR method, a donor DNA fragment, namely TOR1up-KanMX6-TOR1dw, was constructed. Among them, TOR1up is the 1000bp sequence upstream of the start codon of the respective TOR1 gene, KanMX6 is the antibiotic G418 resistance gene (sequence reference NCBINo. HQ154040.1), and TOR1dw is the 1000bp sequence downstream of the stop codon of the respective TOR1 gene. The respective donor DNA fragments were transformed into the corresponding host cells and screened on YPD plates containing 200 μg / mL to obtain the corresponding engineered strains, and then the sclareol production of the corresponding engineered strains could be determined according to the sclareol fermentation method of the engineered strains in Example 1.

[0108] As shown in Table 10, the sclareol production of the tor1Δ engineered strains was significantly increased in different yeast chassis.

[0109] Table 10: Regulating lifespan can improve sclareol production in different yeast chassis

[0110]

[0111] On the other hand, we selected other target products, including the primary metabolite fatty alcohol, another terpene compound β-elemene, and the flavonoid compound xanthohumol.

[0112] As described in Example 2 above, the gene TOR1 was knocked out in the fatty alcohol synthesis strain GNFOH120 (Biotechnol. Biofuels Bioprod., 2022, 15, 141.), the elemene synthesis strain YY-100 (Metab. Eng., 2023, 76, 225-231), and the xanthohumol synthesis strain YSC7 (Nat. Commun., 2024, 15, 253.), respectively. The corresponding engineered strains were all from the previously published papers of the applicant. Then, the yield of the corresponding sclareol could be determined by operating according to the sclareol fermentation method of the engineered strain in Example 1.

[0113] The experimental results are as Figure 8 shown. Starting from the fatty alcohol synthesis strain, knocking out the gene TOR1 to obtain the engineered strain (tor1Δ), the fatty alcohol yield was significantly increased, from 190 mg / L to 252 mg / L, an increase of 33%; starting from the β-elemene synthesis strain, the product yield of the tor1Δ engineered strain increased from 495 mg / L to 569 mg / L; starting from the xanthohumol synthesis strain, the product yield of the tor1Δ engineered strain increased from 142 μg / L to 153 μg / L.

[0114] The above results indicate that regulating yeast cell lifespan and senescence can not only increase the yields of secondary metabolites such as sclareol, β-elemene, and xanthohumol, but also improve the biosynthesis efficiency of primary metabolites such as fatty alcohols, which are more closely related to cell growth. Subsequently, the modification targets, methods, etc. provided by the present invention may be used as a general strategy and extended to the synthesis processes of other target products to enhance their biosynthesis efficiency.

Claims

1. Use of a method for improving cell viability, characterized in that: Use of a method for improving cell viability in the preparation of a target product; The method for improving cell viability is to regulate the expression of gene Tor1 in the starting strain or knockout the expression genes Tor1 and Ppg1, wherein regulating the expression of gene Tor1 is to knockout the regulatory expression gene Tor1 or weaken the expression of gene Tor1; The target product is sclareol; The cell is yeast.

2. Use of a method for improving cell viability, characterized in that: Use of a method for improving cell viability in the preparation of a target product; The method for improving cell viability is to knockout the expression gene Tor1 in the starting strain; The target product is fatty alcohol, β-elemene or xanthohumol; The cell is yeast.

Citation Information

Patent Citations

  • Gene mutation expression cassette and application thereof

    CN113151339A